ID: 1126446942

View in Genome Browser
Species Human (GRCh38)
Location 15:48757885-48757907
Sequence TTCCCAGGTGACTCGGATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 81}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126446942 Original CRISPR TTCCCAGGTGACTCGGATAG AGG Intronic
900497048 1:2980535-2980557 TGCCCAGGTGGCTGGGTTAGTGG + Intergenic
901764515 1:11491278-11491300 TCCCCAGGTGATTCTGATACAGG - Intronic
906408663 1:45562020-45562042 TCCCCAGCTGACTCAGAGAGTGG + Intronic
906991497 1:50744197-50744219 TTCCTTGTTGACTTGGATAGTGG - Intronic
908356529 1:63328899-63328921 TCCCCACTTGCCTCGGATAGTGG - Intergenic
908499067 1:64724865-64724887 TTCCCAGCTGTCTCGGTTACAGG + Intergenic
916166115 1:161968747-161968769 TCCCCAGATGACTCTGAGAGGGG + Intergenic
917910155 1:179635558-179635580 TTCCCAAGTGATTCTGATAAAGG + Intronic
1064375312 10:14790117-14790139 TTCCCAGTTGACTGTGATATAGG + Intergenic
1064838214 10:19559304-19559326 TTCTCAGGTAACTTGGCTAGAGG + Intronic
1069967662 10:72134722-72134744 TTCCCAGGTGGCTGGGACAGTGG - Intronic
1070200643 10:74202098-74202120 TTCCCAGGAGACTGGGTTAGAGG - Intronic
1077298717 11:1837704-1837726 TTCCCAGGCGGCCCGGAGAGGGG - Intergenic
1077424389 11:2467535-2467557 GTCCCATGTGACTCGGATTGTGG - Intronic
1077645379 11:3918957-3918979 TTGCCAGGAGACTTGGACAGGGG + Intronic
1079290264 11:19181718-19181740 TTCCCAGGGGACTTGGAGGGTGG + Intergenic
1080455198 11:32412424-32412446 TTCTCTGGGGACTCGGGTAGGGG - Intronic
1088426793 11:109713610-109713632 TTCCCAGGTGACCCAGCTGGAGG - Intergenic
1091034007 11:132217013-132217035 CTCACAGGTGACTTGGACAGTGG + Intronic
1091600021 12:1912434-1912456 TGCCCAGGTGACTCTGTTACTGG - Intronic
1094535643 12:31320341-31320363 TTCCCAGGTCAAGGGGATAGAGG - Intronic
1102524140 12:113499211-113499233 ATCCCAGGTGACACTGATGGAGG - Intergenic
1102543173 12:113637007-113637029 CTCACAGATGACTCGGAGAGAGG - Intergenic
1113625393 13:111792322-111792344 TTCCCAGGTCTCTCTCATAGGGG + Intergenic
1117267599 14:54106116-54106138 TCCCCAGGTGATTCTGATTGAGG + Intergenic
1118177618 14:63457460-63457482 TTTCCAGGTGACTTGGATTTTGG - Intronic
1126446942 15:48757885-48757907 TTCCCAGGTGACTCGGATAGAGG + Intronic
1128332523 15:66765133-66765155 GTGCCAGGTGACTGGGGTAGTGG - Intronic
1131922227 15:97340701-97340723 TTCCCAGGTGACCCAGATGTTGG - Intergenic
1133761648 16:8803501-8803523 TTCCCAGGTGATTCTGATACAGG - Intronic
1135794895 16:25432308-25432330 TTCCCAGCTGATTCTGATACTGG - Intergenic
1136776980 16:32877268-32877290 TTCCCAGGTGCCTCGGCTCCAGG + Intergenic
1143957190 17:10680127-10680149 ACCCCAGGTGACTCGGATGCTGG - Exonic
1147530759 17:41275127-41275149 TTCCCAAGTGACTTTGATGGAGG + Intergenic
1147897302 17:43758980-43759002 CTCCCAGGTGACCCAGAGAGAGG + Intergenic
1147999846 17:44381148-44381170 ATCCCAGGAGACTAGGAAAGGGG + Intronic
1149400953 17:56295403-56295425 TTCCCAGGTGATACTGATACAGG - Intronic
1153973676 18:10248124-10248146 TTCCCAGGAGCCTAGGAGAGAGG - Intergenic
1162369690 19:10271220-10271242 TTCCCAGGTGAGTCGGGGTGGGG + Exonic
1163455527 19:17403918-17403940 CTCCCCGGTGACTTGGATTGGGG - Intronic
925800145 2:7591100-7591122 ATTCCAAGTGACTCTGATAGAGG - Intergenic
926549146 2:14280017-14280039 TTTCCAGGAGACTCCTATAGGGG - Intergenic
932113427 2:69022671-69022693 TTCCCAGGTGATTCTGATTCAGG + Intronic
932456746 2:71854216-71854238 TTCCCATGCGACTGGGATGGGGG + Intergenic
932690218 2:73906914-73906936 ATCCCAGGTGACTCTGAGACAGG + Intronic
932961550 2:76418266-76418288 TTCCCAGGTGATTTGGATGCAGG + Intergenic
933433816 2:82219002-82219024 TTTCCAGGTGATTCTAATAGTGG - Intergenic
935336845 2:102024103-102024125 TTCCCAGATGACTCTGACTGGGG - Intronic
938886123 2:135650549-135650571 TTCCAAGGTGACTCTGAGAGTGG + Intronic
942132835 2:172897957-172897979 TTCCCTGGTGACTGGGCTGGCGG + Intronic
943699557 2:190974853-190974875 TGACGAGGTGTCTCGGATAGTGG - Exonic
1169118997 20:3084267-3084289 TTCCCCGGTGACTGGGCTTGGGG - Intronic
1170735311 20:19009090-19009112 TTCCCAGGTGAGTTGGATGCAGG - Intergenic
1170919237 20:20660812-20660834 CTCCCAGGTGACTTGGTTTGTGG + Intronic
1172205547 20:33160447-33160469 TTCCCAGGAGCCTCCCATAGTGG - Intergenic
1175607935 20:60327067-60327089 TTCCCAGGTGACTTGCCTGGAGG - Intergenic
1178999970 21:37448360-37448382 TTCTCAGGTGACTCTGATTATGG - Intronic
953108242 3:39907003-39907025 TTCCTGTGTGACTCAGATAGAGG + Intronic
955301861 3:57787814-57787836 TTGCCAGCTGACTGGGATATAGG + Intronic
955510062 3:59670900-59670922 TTGTCATGTGACTTGGATAGAGG - Intergenic
955515512 3:59722637-59722659 TTCCCAGGTAACATGGATACTGG - Intergenic
960432052 3:117581221-117581243 TTGCCAAGTGACTCTAATAGAGG - Intergenic
960838359 3:121930720-121930742 TGCCCAGGTGCCTAGGATAGTGG - Intronic
962411420 3:135144471-135144493 TTCCCAGGTGAGGCTGATATGGG + Intronic
966571307 3:181446749-181446771 TCCCCAGGTGATTCTGATACAGG + Intergenic
967930076 3:194684762-194684784 TCCCCAGGGGACTGGGATGGTGG + Intergenic
972256266 4:37358976-37358998 TTCCCAGGACACTCCCATAGTGG - Intronic
975806659 4:78119786-78119808 GTCCCAGGTGATTCTGATACTGG + Intronic
985541647 5:490202-490224 TCCCCAGGTGACACGGATGCTGG - Intronic
986963474 5:13243253-13243275 TTCCCAAGTCACACAGATAGTGG - Intergenic
992540826 5:77761877-77761899 TTCCCATGTAACTCTGATTGTGG - Intronic
993575883 5:89600180-89600202 TTCCCAGGTGATGGGGACAGTGG + Intergenic
995832205 5:116365429-116365451 TTCCTAGGTGCCGCGGATACAGG - Intronic
999246449 5:150157550-150157572 GTCCCAGGTGACACAGGTAGAGG + Intergenic
1002682859 5:180981827-180981849 GACCCAGGGGACTCGGCTAGAGG - Intergenic
1003279041 6:4676161-4676183 TTCCCAGGGGATTCTGATGGAGG + Intergenic
1005939284 6:30548615-30548637 TTGCCAGGTGAGTAAGATAGAGG - Intronic
1008609358 6:53171697-53171719 TTCCCAAGTGACTTGGATTATGG - Intergenic
1015156600 6:130103370-130103392 TTGCCAGGTGATTCTGATAATGG - Intronic
1017052124 6:150403048-150403070 TTCCCAGGTAGCTGGGATACAGG + Exonic
1018897770 6:168032812-168032834 TCCCCAGATGACTCGGACGGGGG + Intronic
1026613055 7:71878047-71878069 TTCCCAGGTGACGCTGATGGTGG + Intronic
1027501122 7:78952272-78952294 TTTCCAAGTGACTCTGATATGGG + Intronic
1031485953 7:122324547-122324569 TTCCCAGGTGATGATGATAGTGG + Intronic
1038343459 8:26709473-26709495 TTCCCAAGTGACTGGGATCATGG + Intergenic
1043608034 8:82026770-82026792 TTCCCAGGTGACTGGGACTTGGG + Intergenic
1051373199 9:16376245-16376267 TTACATGGTGACTTGGATAGTGG - Intergenic
1058436940 9:104971688-104971710 TTCCCAGGTGACTCAAATGACGG + Intergenic
1193442259 X:81556952-81556974 TGCTCAGGTGACACTGATAGTGG - Intergenic