ID: 1126450926

View in Genome Browser
Species Human (GRCh38)
Location 15:48808195-48808217
Sequence CTGGTAGCAGTGATAATGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126450926 Original CRISPR CTGGTAGCAGTGATAATGAG TGG (reversed) Intronic
900389989 1:2429585-2429607 TTGGGAGCAGTGAGAATTAGGGG + Intronic
901193629 1:7427423-7427445 CTGGCAGGAGTGACAATCAGTGG - Intronic
904830479 1:33303449-33303471 CATGTAGCAGTGATGCTGAGGGG + Intergenic
908210049 1:61890943-61890965 TTGGTGGCAGTGACAATGATAGG + Intronic
917451151 1:175148443-175148465 CTGCTCGCTCTGATAATGAGTGG + Intergenic
920312719 1:205058118-205058140 CTGGTGGCAGGGCTGATGAGAGG - Intronic
924590800 1:245402393-245402415 AAGGCAGCAGTGAGAATGAGAGG - Intronic
1064368944 10:14734249-14734271 CTGGTTTCCATGATAATGAGTGG + Intronic
1064773004 10:18743842-18743864 CTGGTACCAGTGGTAGAGAGTGG + Intergenic
1065410132 10:25417008-25417030 CTAGTAGCAGTGCAAATGGGAGG + Intronic
1069821739 10:71232704-71232726 TTGGTAGCTGTGATAAGGAAGGG + Intronic
1073680366 10:105697037-105697059 TTGGTACCAGGAATAATGAGAGG + Intergenic
1076018157 10:127045730-127045752 CTGGTACAAGTGAGAATGAAGGG + Intronic
1080768638 11:35320228-35320250 CTGGTAACAGTGACAATAACAGG + Intronic
1081430910 11:42975701-42975723 ATGGTAGCAGTGAAAAGAAGGGG - Intergenic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1083302456 11:61746094-61746116 CAGGTACCAGTGATCATGAGAGG - Exonic
1084416220 11:69034266-69034288 CTGGGAGCAGTGAGCTTGAGGGG - Intergenic
1085790731 11:79495174-79495196 CAGGTAGTTGTGAGAATGAGAGG - Intergenic
1086169566 11:83820446-83820468 CTGATAGCATTGATAATAATTGG - Intronic
1087094286 11:94305269-94305291 TGGGTAGTAGTGGTAATGAGAGG - Intergenic
1090624945 11:128598667-128598689 TTGGTAACAGTGACAAGGAGGGG - Intergenic
1092577924 12:9810326-9810348 CAGGTAGCTGTGTTAATAAGTGG + Intergenic
1095632532 12:44395341-44395363 ATGGCAGTAGTGATAATGATGGG - Intergenic
1098689494 12:73468651-73468673 CTGGAAGCAGTGGCAATCAGAGG + Intergenic
1101764651 12:107686502-107686524 ATGGTAGCAGGGAGGATGAGAGG + Intronic
1107009883 13:35659221-35659243 CTAGTAGCTGTTATAATGAAGGG + Intronic
1107057098 13:36118199-36118221 CTGGCTGCAGTGTGAATGAGGGG + Intronic
1107384479 13:39893400-39893422 CTGGTAGCAGTGAAGAGGTGGGG - Intergenic
1108371531 13:49774352-49774374 CTGGCAGCAGTCATAACTAGGGG + Intronic
1112688535 13:101861881-101861903 CTGGTGACAGTGAGAATGAGTGG - Intronic
1114225364 14:20733033-20733055 CTTGTAATAGTGATAATTAGGGG + Intronic
1115845615 14:37530108-37530130 TTGGTAGCAGTGAGAATGGGAGG + Intronic
1117245878 14:53886215-53886237 CTGGTAGCAGTGGTTCTCAGTGG - Intergenic
1117261111 14:54034368-54034390 GTGTTAACAGAGATAATGAGTGG - Intergenic
1118312185 14:64702454-64702476 CTGGAAGCAGTGATGGTGAAGGG + Intergenic
1122611121 14:102984215-102984237 CTGGGAGCAGTGACAGAGAGTGG - Intronic
1125341824 15:38683062-38683084 CTGGGACCAGTGAGAAGGAGGGG - Intergenic
1126450926 15:48808195-48808217 CTGGTAGCAGTGATAATGAGTGG - Intronic
1126553101 15:49954089-49954111 CTAGTAGCAGTGACATTCAGAGG - Intronic
1128107073 15:65052934-65052956 CAGGGAACAGTGTTAATGAGGGG - Intronic
1128379828 15:67104463-67104485 CTGGACTCAGGGATAATGAGGGG - Intronic
1130917943 15:88320733-88320755 CTGGAAGCAGAGATCATTAGGGG - Intergenic
1139630807 16:68230932-68230954 CTGGGAGCAGTGCTGAAGAGGGG + Exonic
1139652666 16:68370464-68370486 ATGGTGGCAGTGATAAAGTGAGG - Intronic
1140267993 16:73436626-73436648 CTGGTAGCAGTGGCAGTGGGTGG - Intergenic
1140810458 16:78572224-78572246 GAGATAGCAGTGATAATGGGTGG + Intronic
1141337495 16:83170761-83170783 CTGGTAACAGTGTGGATGAGAGG + Intronic
1141434219 16:83990085-83990107 ATGGTGGCAGTGATAGTGACTGG - Intronic
1142643940 17:1300240-1300262 CTGGAAGGAGGGATGATGAGTGG + Exonic
1143427491 17:6851761-6851783 ATGGTGACAGTAATAATGAGGGG + Intergenic
1143994214 17:10992822-10992844 CTGGTGGGAGTGGTAGTGAGAGG - Intergenic
1144084005 17:11791979-11792001 GTGGTAAAAGTGATCATGAGGGG + Intronic
1146498445 17:33343782-33343804 TTGGGGGTAGTGATAATGAGAGG - Intronic
1148224192 17:45886943-45886965 CTGATAGCAGAGAGAATGATAGG - Intergenic
1149735235 17:58987627-58987649 TTGGTAGATGTGAGAATGAGAGG + Intronic
1149788254 17:59454609-59454631 CTGGCAGCAGTGCTAGGGAGAGG + Intergenic
1152214607 17:79024925-79024947 GTGGTCCCAGTGATAAGGAGTGG - Intronic
1155412663 18:25563562-25563584 CTGGTGGAAGTGCTAATGACAGG + Intergenic
1158017161 18:52797746-52797768 CTGGCAGCAGTGGTGATGGGTGG + Intronic
1158371352 18:56808980-56809002 CTAGTAGAAGTGAGAATTAGAGG - Intronic
1158737846 18:60104078-60104100 GTGGAAGCAGTGATAGGGAGGGG + Intergenic
1160173587 18:76574448-76574470 TTGCTAGCAGTTATAATGAATGG - Intergenic
1161638600 19:5405345-5405367 CTGGAAGCAGGGAACATGAGGGG + Intergenic
1162367898 19:10260286-10260308 CTGGCAGCAGTGCTCAGGAGAGG - Intergenic
925037150 2:696820-696842 ATGATAGCAGAGATAATGGGGGG - Intergenic
927491267 2:23522656-23522678 CTGGTAGCCTTGAGTATGAGTGG + Intronic
928272982 2:29873807-29873829 AGGATAGCAGTGATAATGACTGG + Intronic
928334482 2:30384683-30384705 CTGATAGGAATGATAATGTGAGG + Intergenic
930330009 2:49970884-49970906 CTGGGAGCAGGGAAAATGGGAGG + Intronic
931879250 2:66549807-66549829 CTGGTAACTGTGTTTATGAGTGG - Intronic
931881000 2:66571023-66571045 CTGATAACAGTGACAATGAAAGG + Intronic
933052057 2:77612256-77612278 CTGGTACCAGTAAGACTGAGTGG + Intergenic
935637274 2:105259030-105259052 ATGGGAGCAGAGATAATGATGGG + Intergenic
937703426 2:124890473-124890495 GTGGTGGCAGAGATAAGGAGGGG - Intronic
939854929 2:147346691-147346713 GTGGTAGCAGTGATGGTGTGTGG - Intergenic
941860788 2:170277767-170277789 CTGGTGACAGTGGTACTGAGGGG - Intronic
943011889 2:182460242-182460264 CTGGGAGTATTGAAAATGAGAGG - Intronic
944136609 2:196406462-196406484 CTTGTAGCAGTGCAGATGAGAGG - Intronic
945556344 2:211281041-211281063 CTTGGGGCAGTGAGAATGAGGGG + Intergenic
946202218 2:218076968-218076990 ATGATAGCTGTGATTATGAGAGG - Intronic
946460350 2:219863297-219863319 TTGGGAGCAGTTATAATGGGTGG + Intergenic
948655433 2:239473915-239473937 GTGGTGGCAGTGAGAAGGAGAGG + Intergenic
1169575095 20:6950924-6950946 CTGGTAGCAATGCAAATTAGAGG + Intergenic
1175055715 20:56195773-56195795 CTGTTACCAGTGTTAAGGAGAGG - Intergenic
1175642578 20:60643276-60643298 CTGGTGGGAGTGAAGATGAGAGG - Intergenic
1178605336 21:34031415-34031437 CTGGTAGAATTGAAAATGAGTGG + Intergenic
1178952734 21:36998523-36998545 GTGGTAGCAGGGATCTTGAGAGG - Intergenic
1181493818 22:23276831-23276853 CTGGTAGCAGTGAGGGAGAGCGG - Intronic
1184378250 22:44128719-44128741 CTGGTAGCAGGGACAGTGGGAGG - Intronic
950455152 3:13088462-13088484 CTGGGAGGAGTGAGAGTGAGTGG - Intergenic
952302450 3:32115448-32115470 CTGGCTGTAATGATAATGAGAGG - Intronic
953232234 3:41075383-41075405 CTGGGAGAAGTGACCATGAGTGG - Intergenic
954820723 3:53324666-53324688 CTGTTAGCAGTCACAATGTGTGG - Intronic
954996985 3:54890793-54890815 CTGGTAGAAGTGATAAGCTGGGG + Intronic
955191980 3:56770088-56770110 CTGGGAGCAGTAAGGATGAGGGG - Intronic
956125516 3:66007669-66007691 CTGGTAGCAGTAATATGGATGGG + Intronic
956339347 3:68204339-68204361 CTGGTAGCAGAGATGATCATGGG + Intronic
961651501 3:128418767-128418789 CTGGTAGCAGTGCTAATCAGAGG - Intergenic
964172420 3:153786469-153786491 CTTGTAGCACTAATAATGTGTGG + Intergenic
964187788 3:153967366-153967388 GTGGTAGCAGCAATGATGAGGGG + Intergenic
965843092 3:172930131-172930153 CTGGTAGCAGTGAGACTGGTGGG - Intronic
966526692 3:180927135-180927157 CTGGTAGTAATGTTAATCAGAGG - Intronic
971731303 4:30385211-30385233 CTGGTAGCAGTCATGACCAGAGG + Intergenic
974869759 4:67626412-67626434 CTATTAGCAGTGAAGATGAGAGG - Exonic
974891554 4:67890271-67890293 GTGGTGGCAGTGAGGATGAGAGG - Intergenic
976622065 4:87138686-87138708 CTAGTAGCAGTGGTGAGGAGTGG + Exonic
978077794 4:104554614-104554636 GAGGTTGCAGTGGTAATGAGGGG + Intergenic
980828241 4:138097717-138097739 CTGTGAACAGTGATAATGAACGG + Intergenic
983291074 4:165806422-165806444 ATGCTAGCTTTGATAATGAGTGG - Intergenic
984594302 4:181649952-181649974 CTGGTAGGAGTGATTATCACTGG + Intergenic
985378001 4:189362855-189362877 CTTGTGGTAGTGATTATGAGGGG + Intergenic
987199357 5:15559045-15559067 CTGTTAGCAGTAATAATGAATGG - Intronic
987287527 5:16472415-16472437 CTGAAAGAACTGATAATGAGTGG - Intergenic
988715643 5:33824626-33824648 CTGTCAGCTGTGCTAATGAGTGG + Intronic
989212008 5:38865948-38865970 CTGGTGGCAGTGATGATGGCAGG + Intronic
990623364 5:57584370-57584392 ATGGTAGCAGTGGGAATGAGGGG - Intergenic
992059976 5:73034324-73034346 CTGGCAGTACTGTTAATGAGAGG - Intronic
994256355 5:97600837-97600859 CTGGTTGCAGTGCAAAGGAGGGG - Intergenic
995100210 5:108291910-108291932 CTGAGGGCAGTGATAGTGAGAGG - Intronic
996590572 5:125142704-125142726 GTGGTAGCTGTGATAAGAAGAGG + Intergenic
997487844 5:134246701-134246723 CTGGTGGAAGTGAGAATGAGGGG - Intergenic
998548321 5:143051286-143051308 CTGGAAGCAGTGGTTATAAGCGG - Intronic
1002362875 5:178687104-178687126 CTTGTAGCAGAGTTCATGAGAGG - Intergenic
1004131083 6:12920854-12920876 GTGGTAGCAGTTATTATTAGGGG - Intronic
1007396685 6:41582003-41582025 CTCACAGCAGTGAGAATGAGTGG + Intronic
1008838171 6:55863579-55863601 GTTGTAGCAGTGATAATTAAAGG - Intronic
1010435406 6:75824302-75824324 ATGGCAGCAGTGTTAATGTGTGG + Intronic
1010543154 6:77117213-77117235 CTGGGAGGAGTCACAATGAGTGG + Intergenic
1013448282 6:110253029-110253051 CTGGTAGAAGTGATTCTAAGTGG + Intronic
1014231167 6:118904120-118904142 CTGGTAGCAGTGCAAATGATAGG + Intronic
1014270938 6:119335233-119335255 TTGGTAGGAGTGATAAGGAAAGG - Intronic
1016823237 6:148365481-148365503 CTGGTAGAGGTGATGAGGAGGGG + Intronic
1018526526 6:164716382-164716404 AGGTTATCAGTGATAATGAGGGG + Intergenic
1020820841 7:12965233-12965255 ATGGTAGCAGTGAGGATGAGAGG - Intergenic
1021264194 7:18498636-18498658 CTGGCAGCAGTGCAAAGGAGTGG + Intronic
1022093019 7:27120050-27120072 CAGGCAGCAGTAAGAATGAGAGG - Intronic
1025120428 7:56297083-56297105 CTAGAAGCAGTGATCATGATTGG - Intergenic
1025553979 7:62280188-62280210 CTGGTGGCAGAAATAATGATTGG - Intergenic
1025560801 7:62373086-62373108 CTGGTGGCAGAAATAATGATTGG + Intergenic
1030581489 7:111361275-111361297 ATGGTAGCAGTGAGAATAATAGG - Intronic
1037210325 8:16378227-16378249 CTGGTTGCAGTGATAACATGGGG - Intronic
1039738920 8:40361852-40361874 CTGGCAGCAGTGATCAGTAGGGG + Intergenic
1039847124 8:41333424-41333446 CTGGGAGCAGGGAACATGAGTGG + Intergenic
1040979389 8:53230185-53230207 CTGGGAGAAGTGTTAATGAATGG - Intronic
1041909515 8:63073458-63073480 CTGGCAGAAGTGATACTGTGTGG + Intronic
1044906907 8:97014111-97014133 CTGGCAGCAGTTATACCGAGAGG + Intronic
1045078705 8:98600569-98600591 ATGGAAGCAGTGGTAATGTGAGG - Intronic
1049612765 8:143563065-143563087 CTGGTAGCAGAGTTTTTGAGGGG + Intergenic
1050913552 9:11103595-11103617 CTGGCAGCAGTGGCAGTGAGTGG + Intergenic
1051793370 9:20834537-20834559 CTAGTAGCAGTGAAAAGGAATGG + Intronic
1052069914 9:24069229-24069251 CTGGTAGTACTGAGAATGAGCGG + Intergenic
1052115796 9:24647001-24647023 CTAGAAGCAGTGGTAATCAGAGG - Intergenic
1052369126 9:27644902-27644924 CTAGAAGCAGTGACAATCAGAGG + Intergenic
1057546838 9:96025399-96025421 CTGTTAACAGTGACACTGAGTGG + Intergenic
1059686913 9:116646584-116646606 CAGGTTGCAGTGGGAATGAGTGG - Intronic
1060432953 9:123566138-123566160 CTGGCAGCAGTGAGAATCAATGG - Intronic
1061358763 9:130126864-130126886 TTGCATGCAGTGATAATGAGTGG + Intronic
1191167968 X:57411576-57411598 CTAGGAGCAGTGAAAAGGAGAGG - Intronic
1192061339 X:67830431-67830453 CTTGTAGGAGGGATAATCAGTGG - Intergenic
1193753651 X:85379353-85379375 ATGGTAGCAGTGGTAATGCTGGG + Exonic
1194240026 X:91434652-91434674 CCAGTAGCAGTGATAGGGAGGGG - Intronic
1197479132 X:126960985-126961007 TTGGTAGCTTTGATAATGAAAGG - Intergenic
1198560604 X:137846314-137846336 CTGGTAGCAGTCATAATCTAAGG - Intergenic
1198848649 X:140941310-140941332 ATGGTAGCAGTGAAGATGGGGGG - Intergenic
1201421046 Y:13799364-13799386 ATGGTAGCTTTGATAAAGAGTGG + Intergenic
1201781580 Y:17729169-17729191 TTGGTAGCTGTGACAATGCGTGG + Intergenic
1201819973 Y:18176821-18176843 TTGGTAGCTGTGACAATGCGTGG - Intergenic
1202173068 Y:22071963-22071985 TTGGTAGCTGTGACAATGCGTGG + Exonic
1202218292 Y:22514408-22514430 TTGGTAGCTGTGACAATGCGTGG - Exonic
1202324894 Y:23681647-23681669 TTGGTAGCTGTGACAATGCGTGG + Intergenic
1202545877 Y:25988407-25988429 TTGGTAGCTGTGACAATGCGTGG - Intergenic