ID: 1126455723

View in Genome Browser
Species Human (GRCh38)
Location 15:48859956-48859978
Sequence CACTAGAGCCTGCAACCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4328
Summary {0: 1, 1: 0, 2: 7, 3: 318, 4: 4002}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126455723_1126455726 21 Left 1126455723 15:48859956-48859978 CCCAGGGGTTGCAGGCTCTAGTG 0: 1
1: 0
2: 7
3: 318
4: 4002
Right 1126455726 15:48860000-48860022 TAGCCACTGCACCCCAGCCTAGG 0: 19
1: 755
2: 13189
3: 181109
4: 260727

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126455723 Original CRISPR CACTAGAGCCTGCAACCCCT GGG (reversed) Intronic
Too many off-targets to display for this crispr