ID: 1126456879

View in Genome Browser
Species Human (GRCh38)
Location 15:48872488-48872510
Sequence TGTAAGCCCAAAGCTTCTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 600
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 569}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126456876_1126456879 -10 Left 1126456876 15:48872475-48872497 CCATTAAAAACTATGTAAGCCCA 0: 1
1: 0
2: 1
3: 12
4: 200
Right 1126456879 15:48872488-48872510 TGTAAGCCCAAAGCTTCTAGGGG 0: 1
1: 0
2: 0
3: 30
4: 569

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126456879 Original CRISPR TGTAAGCCCAAAGCTTCTAG GGG Intronic