ID: 1126458215

View in Genome Browser
Species Human (GRCh38)
Location 15:48887746-48887768
Sequence ACCTTTAGCTAGATGAACTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 2, 2: 7, 3: 42, 4: 190}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126458212_1126458215 17 Left 1126458212 15:48887706-48887728 CCAAAAGTTGGTTCTCCCAAAAG 0: 1
1: 2
2: 24
3: 147
4: 600
Right 1126458215 15:48887746-48887768 ACCTTTAGCTAGATGAACTAAGG 0: 1
1: 2
2: 7
3: 42
4: 190
1126458214_1126458215 1 Left 1126458214 15:48887722-48887744 CCAAAAGATCGACAAAACTGACA 0: 2
1: 0
2: 3
3: 14
4: 139
Right 1126458215 15:48887746-48887768 ACCTTTAGCTAGATGAACTAAGG 0: 1
1: 2
2: 7
3: 42
4: 190
1126458213_1126458215 2 Left 1126458213 15:48887721-48887743 CCCAAAAGATCGACAAAACTGAC 0: 1
1: 0
2: 1
3: 8
4: 132
Right 1126458215 15:48887746-48887768 ACCTTTAGCTAGATGAACTAAGG 0: 1
1: 2
2: 7
3: 42
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126458215 Original CRISPR ACCTTTAGCTAGATGAACTA AGG Intronic
900889757 1:5441395-5441417 ACATTCAGCTACATGAAATAAGG - Intergenic
904098828 1:28004932-28004954 ACCTTTGGCTAAATTGACTAAGG + Intronic
906226171 1:44123514-44123536 ACACTTAGCTAGATCAACTAAGG - Intronic
908927196 1:69270042-69270064 AACTTTAGCTAGGAGAGCTATGG - Intergenic
909271889 1:73632988-73633010 AACTTTAGCCAGACTAACTATGG + Intergenic
915828993 1:159107654-159107676 ACCATTAGCAAGATTAACCAAGG + Intronic
915967136 1:160320122-160320144 ACTGTTAGCTAGACCAACTAAGG + Intronic
917003974 1:170391189-170391211 ATCTTTAGCTAGATGAACTAAGG - Intergenic
917953767 1:180070640-180070662 GACTTTAGCTAGCTGAACTCTGG - Intronic
918154788 1:181834162-181834184 ACCTTTAGCTAGACTAAAAAAGG + Intergenic
918746999 1:188215432-188215454 AACTTTGGCTAGGTTAACTAAGG - Intergenic
919226777 1:194714112-194714134 ACTCTTAGCTAAATGAACTATGG + Intergenic
919295006 1:195686655-195686677 GCCTTTAGCTATATGGCCTAAGG - Intergenic
920973403 1:210762473-210762495 ACCACTAGCTAGATGAACAAAGG + Intronic
921028894 1:211318997-211319019 ACCTTTACCTAGTTGAAATGTGG + Intergenic
921766224 1:218975364-218975386 ATCTTGAGCTGGATGAACCATGG - Intergenic
922888584 1:229041807-229041829 AACTTTAGCTACATTATCTAAGG + Intergenic
924079534 1:240379845-240379867 ACCACTAGCTAGATTAACCAAGG + Intronic
924079598 1:240380835-240380857 ACCACTAGCTAGATTAACCAAGG + Intronic
1063997665 10:11636021-11636043 ACCTTTATCTACATTAACTTAGG - Intergenic
1064723406 10:18252646-18252668 AGCTGTAGGTAGATGAAATATGG + Intronic
1065085447 10:22170223-22170245 ATCTTTAGCTAGAATGACTAAGG + Intergenic
1065113356 10:22461221-22461243 TCCTTTAGCTATGTGACCTAGGG - Intergenic
1066170606 10:32840247-32840269 ACCATTAGCAAGATTAACCAAGG + Intronic
1066514296 10:36139465-36139487 ACTTTTAGCCAGAGTAACTAAGG - Intergenic
1067096073 10:43301053-43301075 ACCTTTAGTTAAATAAATTAGGG - Intergenic
1067096750 10:43306471-43306493 ACCTTTAGTTAAATAAATTAGGG - Intergenic
1067330671 10:45314664-45314686 ATGCTTAGCTAGATTAACTAAGG + Intronic
1068368215 10:56079749-56079771 ACCACTAGCTAGATTAACCAAGG + Intergenic
1068436371 10:56996436-56996458 ACCTTTAGCTAGATTAACTGAGG + Intergenic
1069487257 10:68831853-68831875 ATCTTTAGCTTGATTAACAAGGG + Intronic
1071004828 10:80871224-80871246 ACCACTAGCTAGATGAAAAAAGG + Intergenic
1072831888 10:98667017-98667039 ACATCTAGCTAGATTAACAAAGG + Intronic
1073417725 10:103398238-103398260 ACCTTTGGAAAGATGAAGTATGG + Intronic
1073884083 10:108018817-108018839 ACCTTTAGCTCTCTGGACTAAGG + Intergenic
1075815709 10:125263568-125263590 ACCTATAGCTAGATGTACTTGGG + Intergenic
1077823711 11:5780511-5780533 ACATTTAGCTAGATTAACTGAGG + Intronic
1080161382 11:29180784-29180806 ATCTTTTCCTAGATGAATTAAGG - Intergenic
1080423051 11:32129454-32129476 AACATTAGCTAGATTAACAAAGG + Intergenic
1080706934 11:34704003-34704025 ACCTTTAGCCAGACTAACAAAGG - Intergenic
1081002742 11:37695145-37695167 ACCTTGAGATAGATGATTTAGGG + Intergenic
1084152530 11:67296948-67296970 ACCTTTAGCTAGGTTGACCACGG - Intronic
1085967589 11:81547196-81547218 ACCTTTTGCAAGCTAAACTAAGG - Intergenic
1086805997 11:91243265-91243287 ACATTTATTTAAATGAACTAAGG + Intergenic
1090740599 11:129656493-129656515 ACTTTTAGCTAGACGAATAAAGG + Intergenic
1091052216 11:132383118-132383140 ATTTTTAGCTAGAATAACTAAGG + Intergenic
1091623102 12:2104801-2104823 ACCTCTTGCTACTTGAACTAAGG - Intronic
1094311538 12:29089043-29089065 ACCTTTAGCTAGACAAAAAAAGG + Intergenic
1097484885 12:60183871-60183893 ACCATTAGCTAGATGGACTTAGG - Intergenic
1100114496 12:91287680-91287702 AGCTTTAACTAGATTAACTAAGG + Intergenic
1104303085 12:127583473-127583495 ATCTTTAGCTAGACCAACCAAGG - Intergenic
1107010386 13:35664636-35664658 ACCCTTAGCTGTATGAACTTGGG + Intronic
1107589737 13:41890435-41890457 AGCTTGAGCTGGATGAACAAGGG + Intronic
1108231876 13:48353194-48353216 GCCTTTAGCTAGATTAACTAAGG + Intronic
1108907041 13:55488978-55489000 ACCATTAGCTAGCTTACCTAAGG - Intergenic
1110079102 13:71288215-71288237 ACCTTTAGCTACATAGATTAAGG - Intergenic
1111093866 13:83483720-83483742 ACGTTTAGTTAGATTAAGTAGGG - Intergenic
1113870688 13:113558119-113558141 ATCTTCCGCTAGAAGAACTAGGG + Intergenic
1115326036 14:32139601-32139623 ACCTTTAGCTAGATTTACCAAGG - Intronic
1115384558 14:32781185-32781207 ACCTCTAGCTAGATTGATTAGGG + Intronic
1116513417 14:45775483-45775505 ACTTTTACCTGGATGGACTAAGG - Intergenic
1117199222 14:53371260-53371282 ACCTTTAGCTGGATGGAGTGGGG + Intergenic
1117269017 14:54122260-54122282 ACTTTTAGCTAGATGAAAAGAGG - Intergenic
1117734825 14:58757864-58757886 ACCTATAGCTAGATGACCTTTGG - Intergenic
1117987166 14:61398008-61398030 ACCTTTAACAAGATGAACAGTGG - Intronic
1120181487 14:81347169-81347191 ACCTTTAGCTAGACTAACCAAGG + Intronic
1124242443 15:28040590-28040612 ATCTTTAGCTAGACTGACTAAGG + Intronic
1126243896 15:46480332-46480354 ACTTTTAGCTAGACAAACTAAGG - Intergenic
1126458215 15:48887746-48887768 ACCTTTAGCTAGATGAACTAAGG + Intronic
1127348225 15:58123136-58123158 CCTGTTAGCTAGATGAACAAAGG - Intronic
1135819908 16:25674670-25674692 ACCTTAAGCTAAATAAACTTAGG + Intergenic
1140184757 16:72758111-72758133 ACTTTTAGCTAGATTGACTAAGG - Intergenic
1140354405 16:74293056-74293078 ACCTTTAAGGAGAGGAACTAGGG + Intergenic
1142840891 17:2628984-2629006 ACCATTAGCAAGATTAACCAAGG - Intronic
1144099003 17:11927650-11927672 ACCCTGACCCAGATGAACTAGGG + Intronic
1148121619 17:45215952-45215974 AGCTGTAGCTAGTTCAACTAAGG - Intergenic
1154373567 18:13789287-13789309 ACCTTTAGGTAGATTGACCAAGG - Intergenic
1156606884 18:38677006-38677028 ACCATTAGCGAGATCAACCAAGG - Intergenic
1157938084 18:51895089-51895111 ACCATCAGCTAGATTAATTACGG - Intergenic
1159437049 18:68431716-68431738 GCTTTTAGCTATATCAACTATGG + Intergenic
1159566173 18:70053045-70053067 ACCTTTTGCTATATGACCTTGGG + Intronic
1160342296 18:78100128-78100150 AGCCTTAGCTAGATGGAATAGGG - Intergenic
1163707602 19:18824561-18824583 AACTTTAGCTAGATTGACCAAGG - Intergenic
1164895052 19:31869161-31869183 ACCTCTAGCCAGATGTACTAAGG + Intergenic
1166425195 19:42671137-42671159 GTTTTTAGCTAGATGACCTAGGG + Intronic
926519097 2:13887254-13887276 ACCTTTAGCCAGGCTAACTAAGG + Intergenic
928589047 2:32794684-32794706 ACCTTTAGATAGATGGACTAAGG + Intronic
928943053 2:36746695-36746717 ACCACTAGCTAGATTAACAAAGG - Intronic
932661721 2:73660174-73660196 ATCTTTAGCTAGATTCACCAAGG - Intergenic
932977534 2:76622088-76622110 ACCCCTAGCTAGATTAACAAAGG - Intergenic
933374766 2:81465413-81465435 ACTCCTAGCTAGATGAAATAAGG + Intergenic
933855233 2:86406997-86407019 AACTTTAGCTAGATTAATCAAGG + Intergenic
935348530 2:102132696-102132718 ACCTTTAGCTGGATTGACTGTGG + Intronic
936164712 2:110110314-110110336 ACCATTAGCAAGATTAACCAAGG + Intronic
936551315 2:113443272-113443294 ACCTTCCTCAAGATGAACTAGGG + Intronic
936653870 2:114461842-114461864 ACCTTTAGCTATAAGAAGAATGG + Intronic
939336076 2:140829862-140829884 ACCTTTAGCTAGACTAATTAAGG + Intronic
941496844 2:166215511-166215533 ACCTTTAACTAGACTAACCAAGG + Intronic
942879415 2:180840668-180840690 ACCTCTAGCTAGAAGAACACAGG - Intergenic
946513133 2:220382043-220382065 ACCTTTAGCCAGACTAACTAGGG - Intergenic
947021229 2:225678311-225678333 ATCATTAGCTAGATGAACAAAGG - Intergenic
947465676 2:230342783-230342805 ATCTTTAGCTAGACTAACCAAGG - Intronic
1169617642 20:7467671-7467693 ACCTTTAGTCAGACTAACTAAGG - Intergenic
1170205493 20:13793614-13793636 AAGTTTAGCTAAATAAACTATGG - Intronic
1171445527 20:25200685-25200707 ACCTTTAGCTAGACTGACTAAGG - Intronic
1177016159 21:15790138-15790160 ACATTTAGTTAGATGAACTGGGG - Intronic
1178733130 21:35123550-35123572 ACCATTAGCAAGATTAACCAAGG + Intronic
1178959322 21:37050138-37050160 ACCATTAGCAAGATTAACCAAGG + Intergenic
1179559501 21:42205274-42205296 ACCTCTAGCAAGATGAGCAAAGG - Intronic
1180306375 22:11129349-11129371 AACTTAAGGTTGATGAACTAGGG - Intergenic
1180544894 22:16491532-16491554 AACTTAAGGTTGATGAACTAGGG - Intergenic
1184635728 22:45828505-45828527 ACTTTTAGCTAGGTGGACTAAGG + Intronic
950592128 3:13945063-13945085 ACCATTAGTAAGATTAACTAAGG - Intronic
951167220 3:19497146-19497168 ACCATTAGCTAGACTAACAAAGG - Intronic
955114387 3:55982853-55982875 ACCTTTTGCTAGAAGAATGAGGG + Intronic
956571148 3:70696633-70696655 ACCTTTAGATACATGATCTAAGG - Intergenic
958885305 3:99719948-99719970 GCCTTGAGCTAGATCAACTTTGG + Intronic
959797844 3:110453618-110453640 ACCTTTAGCCAGATTAACTAAGG - Intergenic
960207530 3:114920833-114920855 ATCTTTAGCTAGATTACCCAAGG + Intronic
960305806 3:116059541-116059563 ACCTTTATCCAGGTGAACCATGG - Intronic
960419075 3:117421269-117421291 ACTTTCATCAAGATGAACTAAGG + Intergenic
961392372 3:126560375-126560397 AGCTTTAGCTAGATTGACTAAGG - Intergenic
962025783 3:131546215-131546237 GCCTTTAGCTAGATGAAACCTGG - Intronic
962857464 3:139360885-139360907 ACATTTAGATAGATGTGCTAAGG + Intronic
966092987 3:176162634-176162656 ACCATTAGCAAGATTAACCAAGG + Intergenic
967210388 3:187163065-187163087 ACCTCTATCTAGATGAATGAAGG + Intronic
968429262 4:545680-545702 ACCTTTAGCAACAAGAGCTAAGG - Intergenic
969134856 4:5021327-5021349 ACCTTTAGCAAGATGACATAGGG + Intergenic
971617837 4:28815769-28815791 ACCTTTAGCTGGACAAACTAAGG + Intergenic
971759273 4:30744308-30744330 ACCTTTAGTTATATGAATCAAGG - Intronic
974245341 4:59308130-59308152 ACATCTAACTAGAAGAACTATGG - Intergenic
975603825 4:76132262-76132284 ACCTTTGGGTAGATGGATTATGG + Intronic
980893293 4:138837338-138837360 ACGGTTAGCTGAATGAACTAGGG + Intergenic
981139309 4:141249891-141249913 ACCATTAACTAGATTAACCAAGG - Intergenic
982939603 4:161533315-161533337 ACCACTAGCTAGATTAATTAAGG + Intronic
983176130 4:164590025-164590047 ACCTTAAGATAGTTAAACTAGGG + Intergenic
983263803 4:165486466-165486488 CCCTTTAGCTAAATGAATTTGGG - Intronic
984137974 4:175965534-175965556 ACCTCTAGTTAGGTTAACTAAGG + Intronic
986842995 5:11719700-11719722 AGATTTAACTAAATGAACTAAGG - Intronic
987028912 5:13957295-13957317 ACCATTAGCTTGAAGAGCTAAGG + Intergenic
988642267 5:33053460-33053482 ACCTTTAGCTAGTCTAACTAAGG + Intergenic
989072914 5:37530695-37530717 ACCATTAGCAAGATTAACCAAGG - Intronic
989251600 5:39322584-39322606 ACCTTTAGCTAGGCTAACTCAGG + Intronic
989472344 5:41835068-41835090 ACCTTTAGCCAGACTAACAACGG + Intronic
989554464 5:42777149-42777171 GTCTGTAGCCAGATGAACTAAGG + Intronic
992306347 5:75443110-75443132 ACCTTTAGCTAGATGGACTAAGG - Intronic
993883621 5:93391998-93392020 ACCGTTAGCAAGATTAACCAAGG - Intergenic
994239262 5:97401295-97401317 ACCTTTAGCCAGAGTAACTTGGG - Intergenic
994308019 5:98230430-98230452 ACCCTTAGCTAGACTAACTAAGG + Intergenic
994864499 5:105248917-105248939 TCCTTTAGCTAGATGAAATAAGG + Intergenic
995483877 5:112619577-112619599 ACCTTTAGGGAGATGTTCTAGGG + Intergenic
995773048 5:115692794-115692816 AACTTTACCTAGATGGGCTAAGG - Intergenic
996425172 5:123306103-123306125 ACATTTTGCTACATGAAATAAGG - Intergenic
996496167 5:124159241-124159263 ACATTTAGCTAGATAAAATAAGG + Intergenic
996561505 5:124834489-124834511 ACCATTAGCAAGATTAACCAAGG + Intergenic
997183946 5:131862341-131862363 ACCACTAGCTAGATTAACCAAGG - Intronic
999532948 5:152482477-152482499 ACCTTTCACTAGATGAATTACGG - Intergenic
1002038395 5:176491444-176491466 ACCTTTTGCTTGATGATTTATGG - Intronic
1003422603 6:5972259-5972281 ACCTTTAGCTACATGAATTAAGG + Intergenic
1003493472 6:6643387-6643409 ACCTTATGCTAAATGAAATAAGG + Intronic
1003562413 6:7192687-7192709 ATGTTTAGCTAGATTGACTAAGG - Intronic
1003819528 6:9880695-9880717 ACCCTTAGCTAGACTAACTAGGG + Intronic
1004888799 6:20077676-20077698 ACCATTAGCAAGATTAACCAAGG + Intergenic
1005445798 6:25921351-25921373 ATCTTTAGCTCCATCAACTATGG - Exonic
1005624630 6:27651884-27651906 ACTTTTAGCTAGACTGACTAAGG + Intergenic
1006775160 6:36586774-36586796 AGCTTTAGATAGAGGAACTGTGG - Intergenic
1008394433 6:50990555-50990577 AGTTTTAGCTAGAGGAACTCTGG - Intergenic
1008466457 6:51836733-51836755 ACCTTTAGCCATATGTTCTAAGG + Intronic
1009301870 6:62033880-62033902 ACCTTTAGCCAGAATAATTAAGG + Intronic
1009375163 6:62959011-62959033 ACCTTTGGTCAGATTAACTAAGG - Intergenic
1009492202 6:64305054-64305076 ATCTTTAGTTAGATGGATTAAGG + Intronic
1011208827 6:84932302-84932324 ACCTTTACCTATATCAACTTTGG - Intergenic
1015723660 6:136275530-136275552 ACCTTTAACATGATGAACCAAGG + Exonic
1016458654 6:144258690-144258712 ACCCTTACCTAGATTAACTAAGG - Intergenic
1020859113 7:13466162-13466184 AGCTTTAGCAAGGTCAACTATGG - Intergenic
1021038511 7:15831394-15831416 AACTTTCCCTAGAAGAACTAAGG - Intergenic
1021893488 7:25211184-25211206 ACCCTTAGCTAATTTAACTAAGG - Intergenic
1022262959 7:28724405-28724427 CCCTCTACCTAGCTGAACTAAGG - Intronic
1022348545 7:29543040-29543062 ACCTTTAGCCAGACTAATTAAGG + Intergenic
1022386934 7:29909393-29909415 ACCTTTAGTTAGATAGACTAAGG + Intronic
1024745084 7:52397049-52397071 ACCATTAGCAACATGAACCAAGG - Intergenic
1024893899 7:54234255-54234277 ACCATTAGCCAGATTAACCAAGG + Intergenic
1024917515 7:54518482-54518504 ACCTTTAGCTAGAATAACTAAGG - Intergenic
1029787303 7:102805657-102805679 ACCTTTACCTCCATAAACTATGG + Intronic
1030047589 7:105511380-105511402 ACCTATAGCTACTTGAAGTATGG + Intronic
1030774210 7:113513589-113513611 ACCTTTAGCTAGACAACTTAGGG - Intergenic
1031138273 7:117910363-117910385 ACCTTTAGGTAGAGGAAGTCAGG - Intergenic
1031523564 7:122796411-122796433 ACCTTAAGCAAAATGAACAAAGG + Intronic
1032920227 7:136537127-136537149 ACCATTAGCTAGATTAATAAAGG + Intergenic
1032961029 7:137034462-137034484 ACCTTTAGAAAGATGAACAAAGG + Intergenic
1034000347 7:147405188-147405210 ACATGTAGCTAAATCAACTACGG + Intronic
1034751261 7:153571039-153571061 ACCTTGAGATAGATGAGTTAGGG + Intergenic
1036666727 8:10749225-10749247 ATCTTTAGGTAGATTGACTAAGG - Intronic
1038368202 8:26959193-26959215 ACCTTTAGAAAAATGAACAAAGG - Intergenic
1038877257 8:31565363-31565385 AACTTTAGCTAGATTGACTAAGG + Intergenic
1039210928 8:35214075-35214097 ACCTTTAGCTGTATTGACTAAGG - Intergenic
1039683500 8:39769290-39769312 AAATTTAGCTTGATGAATTAAGG + Intronic
1040688404 8:49905361-49905383 ACTCTTAGCTAGATTAGCTAAGG - Intergenic
1041082021 8:54223023-54223045 TCCTTTAGTTACATGAACTTGGG - Intergenic
1041254974 8:55972135-55972157 CACTTGAGCCAGATGAACTATGG - Intronic
1041826916 8:62105891-62105913 ACCACTAGCTAGATTAACAAAGG + Intergenic
1043700373 8:83280092-83280114 AGCTTCAGCTAGATTAAGTAAGG - Intergenic
1044631519 8:94284009-94284031 ATCTTTAGCTCTGTGAACTAGGG - Intergenic
1046405639 8:113769218-113769240 AACTTGAGATAGATGAATTAGGG + Intergenic
1046919436 8:119712632-119712654 ACCTTTAGCTAGATTGACCAAGG - Intergenic
1047083263 8:121488291-121488313 ACCTTTAGCCAGACTACCTAAGG + Intergenic
1048544990 8:135378360-135378382 GCCTTTAGCTTGTTCAACTAAGG - Intergenic
1049901676 9:173839-173861 ACCTTCCTCAAGATGAACTAGGG - Intronic
1050059830 9:1695503-1695525 ACCTTTACCTGGATTAACTAAGG + Intergenic
1050396784 9:5206706-5206728 ACCTTTAACTAGACAAACTAAGG + Intergenic
1050677250 9:8070386-8070408 ACCATAAGCTAGATTAACAAAGG - Intergenic
1050731612 9:8715595-8715617 AACTTTAGTTAGAAGAAATATGG - Intronic
1051031289 9:12682789-12682811 AACATTAGCTAGATGACCTAAGG - Intergenic
1052453098 9:28657647-28657669 ACCGTTAGCTAAACAAACTAAGG - Intronic
1055011147 9:71566815-71566837 ATCTTAAGCTAGCAGAACTATGG - Intergenic
1055656656 9:78456856-78456878 ACCATTAGCAAGATTAACCAAGG + Intergenic
1056094634 9:83240348-83240370 GCCTTTAGCTAGATTAACCAAGG - Intergenic
1057898064 9:98925412-98925434 ACCTTTAGCTAAAGAAACAAGGG - Intergenic
1058293418 9:103273894-103273916 ACCACTAGCTAGATTAACAAAGG - Intergenic
1059622133 9:116018395-116018417 ACCCTTAGCTAGACTAAGTAAGG - Intergenic
1061638591 9:131932360-131932382 ACCTTTAGCCAGACTAATTAGGG + Intronic
1188590456 X:31828153-31828175 ACCATTAGCAAGATTAACCAAGG + Intronic
1188815981 X:34714781-34714803 TCCTGTAGCTAGATGATCAATGG + Intergenic
1188860445 X:35249504-35249526 ACATTAAGCTAAATGAAATAAGG - Intergenic
1190371301 X:49744076-49744098 ACCATTAGCTAGACTAACAAAGG + Intergenic
1190442990 X:50494491-50494513 GGCTTAAACTAGATGAACTAAGG + Intergenic
1190891187 X:54569654-54569676 ATCTTTAGCCAGATGATCAAGGG - Intergenic
1191995098 X:67086049-67086071 ACCGCTAGCTAAATGAACCAAGG - Intergenic
1192065107 X:67875663-67875685 ACCACTAACTAGATGAACGAAGG - Intergenic
1192633737 X:72798002-72798024 ATCTTTAGCTAGACTAACTAAGG - Intronic
1192647973 X:72922799-72922821 ATCTTTAGCTAGACTAACTAAGG + Intronic
1192762609 X:74109494-74109516 ACCATTAGCTAGACTAACAAAGG + Intergenic
1192881411 X:75287920-75287942 ACCATTAGCTAGATTAACAAAGG + Intronic
1193266196 X:79472583-79472605 AGCTTTAACAAGATGCACTAAGG + Intergenic
1194795673 X:98209002-98209024 ACCTTTTTCTAGATGAAAGAAGG + Intergenic
1194989619 X:100532792-100532814 ACATTTAGCTAGACTAAGTAAGG - Intergenic
1195563968 X:106321062-106321084 ATCTTTAGCTAGATTGACCAAGG + Intergenic
1196198467 X:112859402-112859424 ACTTGTAGCTAGAAGAACCAAGG - Intergenic
1198470897 X:136945982-136946004 ACCTCTAGCTAGATGATTCAAGG - Intergenic
1198665248 X:139014354-139014376 ACCTTTAGCCAGATTAACCAAGG + Intronic
1199143927 X:144343102-144343124 ACCTTTAGCCAGACTAACTAAGG - Intergenic
1199368040 X:147010836-147010858 ATCTTTAGCCAGACAAACTAAGG - Intergenic