ID: 1126458367

View in Genome Browser
Species Human (GRCh38)
Location 15:48889317-48889339
Sequence GTGGATTCTCTAGGTGACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 120}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126458362_1126458367 22 Left 1126458362 15:48889272-48889294 CCTTGATGGAATTTAAGAGCCAT 0: 1
1: 0
2: 0
3: 14
4: 168
Right 1126458367 15:48889317-48889339 GTGGATTCTCTAGGTGACACTGG 0: 1
1: 0
2: 0
3: 7
4: 120
1126458363_1126458367 3 Left 1126458363 15:48889291-48889313 CCATTTGTCAGAATGTTTCATAC 0: 1
1: 0
2: 0
3: 25
4: 255
Right 1126458367 15:48889317-48889339 GTGGATTCTCTAGGTGACACTGG 0: 1
1: 0
2: 0
3: 7
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126458367 Original CRISPR GTGGATTCTCTAGGTGACAC TGG Intronic
900866564 1:5273152-5273174 GTGTATTCTCCAGGTAAAACTGG + Intergenic
902534041 1:17108658-17108680 CTGGATGCTTTAGGTGGCACAGG + Intronic
903271052 1:22188516-22188538 GTGCTTTCTCTAAGTCACACTGG + Intergenic
904600912 1:31672261-31672283 GTGGCTTCTCTGGGATACACAGG - Intronic
907784221 1:57596110-57596132 GCTGATTCTCTAGGTATCACTGG + Intronic
909547110 1:76860247-76860269 GTGGCTTCTCTTGGTGGCACGGG + Intergenic
910289422 1:85586154-85586176 ATGAATTCACTAGGTGACTCTGG + Intergenic
915954775 1:160212683-160212705 GTGGAATCTCTAGGCAACCCAGG - Intronic
919674652 1:200369384-200369406 GTGGATGCTGTAGGAGACAAAGG - Intergenic
923266966 1:232323894-232323916 ATGGATTTTCTAGATGAGACTGG - Intergenic
1067278584 10:44854872-44854894 GTGGATGCCCTGAGTGACACAGG - Intergenic
1073986939 10:109220377-109220399 GTGGATTCTCTAGGAGCTAATGG - Intergenic
1073992912 10:109284063-109284085 AAGGATTCTCTTGGTGACACAGG - Intergenic
1079229191 11:18634695-18634717 CTGGGTTCTCTGGGTGTCACGGG + Intronic
1079444029 11:20543573-20543595 GTGGAATTGCTAGGTCACACAGG - Intergenic
1080862759 11:36164102-36164124 GGTGATCCTCTAGGTCACACAGG + Intronic
1083002947 11:59313455-59313477 GTGGAGTCTAAAGGTCACACTGG + Intergenic
1088178327 11:107080093-107080115 GTGCATTCTATACATGACACAGG + Intergenic
1088476526 11:110245426-110245448 GTGGGTTCTTTTGGTGAGACAGG - Intronic
1090105865 11:123853328-123853350 GTGGTGTCCCTAGGTGGCACTGG - Intergenic
1095755275 12:45758460-45758482 TTGGCTTCCCTAGGTCACACTGG - Intronic
1101733663 12:107446719-107446741 GTGGATTATCTGGTAGACACAGG + Intronic
1101883622 12:108642547-108642569 GTGTGTTCGCTAGGCGACACTGG - Intergenic
1102852371 12:116260913-116260935 GTAGATGCTCTAGGTAACAAAGG + Intronic
1102940011 12:116932213-116932235 CTGTATTCTCTAGGAGACACTGG + Intronic
1103152714 12:118655298-118655320 GTGGCTTCTCCAGGTGATTCTGG - Intergenic
1104905976 12:132213749-132213771 CTGCATTCTCCAGGTGGCACCGG + Intronic
1105227437 13:18449283-18449305 GTTGATTTTCTAGGTAACAACGG - Intergenic
1105634432 13:22203687-22203709 GTGGATTCACCAGGTGAGGCAGG + Intergenic
1105839159 13:24238549-24238571 GGGAATTCACTGGGTGACACAGG + Intronic
1106835143 13:33625990-33626012 TTGGATTTTCTTAGTGACACTGG - Intergenic
1107588662 13:41880889-41880911 GTGGAGCCTCTATGAGACACAGG - Intronic
1108462878 13:50684724-50684746 GTGGATTCTCTGTGTGAGTCTGG - Intronic
1110701634 13:78555304-78555326 GTGGTTTCTCTATGTCACCCAGG - Intergenic
1114011890 14:18377736-18377758 GTTGATTTTCTAGGTAACAACGG - Intergenic
1119123099 14:72098132-72098154 GGGGTTGCTCTAGGTGACAGAGG - Intronic
1120739307 14:88090132-88090154 GTGGATTCTCTCTATGACATGGG - Intergenic
1122820066 14:104338036-104338058 GTTAATTCTAGAGGTGACACTGG - Intergenic
1123580968 15:21714698-21714720 GTGGCTTCTCTATGGGACAGGGG - Intergenic
1123617617 15:22157321-22157343 GTGGCTTCTCTATGGGACAGGGG - Intergenic
1126458367 15:48889317-48889339 GTGGATTCTCTAGGTGACACTGG + Intronic
1127442396 15:59022921-59022943 GTGGATTCCCTGGATGACAGAGG + Intronic
1129292428 15:74578536-74578558 GTGGAGTGTCTGGGGGACACAGG + Intronic
1130966236 15:88699914-88699936 GTGATTTCTCAAGGTGACTCAGG + Intergenic
1133974847 16:10593283-10593305 TTGGCTTCTCGAGGTGTCACTGG + Intergenic
1140788555 16:78367490-78367512 TTGGCTTCCCTGGGTGACACTGG - Intronic
1141031307 16:80591465-80591487 GTGCAGTCTCAAGGTGACAGAGG - Intergenic
1141642368 16:85348740-85348762 GTGGATTGTCCAGGAGACTCGGG + Intergenic
1141787237 16:86209735-86209757 GCAGATTCTCTAGGTGATATGGG - Intergenic
1141945345 16:87305519-87305541 CTGGCATCTCTAGGTGACGCGGG + Intronic
1142575946 17:907739-907761 TAGGATTCTCAAGTTGACACAGG + Intronic
1142758451 17:2029303-2029325 GTGGATTCTAAAGGTGATAAAGG + Intergenic
1152011251 17:77719661-77719683 GTGGTTTCCCTGGGTTACACTGG + Intergenic
1152052913 17:77996396-77996418 CTGGATTCTCTAGGCTGCACGGG - Intergenic
1153444706 18:5158086-5158108 GCAGATGCTCTAGGGGACACAGG - Intronic
1155882227 18:31163330-31163352 GTTGGTTCTCTAGATGTCACAGG + Intergenic
1157385790 18:47259406-47259428 TTGGCTTCTCTAGGAAACACTGG - Intergenic
1158150461 18:54362376-54362398 GTGGATTCTCACATTGACACTGG - Intronic
1160304368 18:77718012-77718034 GTGTCTTCTCTCTGTGACACTGG - Intergenic
1163845612 19:19636788-19636810 CTGGAGTCCCTAGGTGGCACAGG + Exonic
1164826910 19:31290606-31290628 GTAGCGTCTCTAGGTGACTCCGG - Intronic
1168368922 19:55814782-55814804 CTGGATTATCTAGGACACACGGG + Intronic
930721121 2:54639338-54639360 ATGGTTTCTCAAGGTGAAACAGG - Intronic
937885003 2:126893660-126893682 ATGGATGCTCTGGGTGACAGTGG - Intergenic
938525044 2:132121558-132121580 GTTGATTTTCTAGGTAACAATGG + Intergenic
947009363 2:225548683-225548705 GTGGATTCTCGTGGTAGCACTGG - Intronic
947891428 2:233624985-233625007 GTGGATTTTCTACTTCACACGGG - Intronic
1169275983 20:4234055-4234077 GTGGCTTTTCTTGCTGACACAGG - Intronic
1169666678 20:8045051-8045073 GTGGCTTCTCCATGTTACACAGG - Intergenic
1171192460 20:23168770-23168792 GAGGTGTCTCTAGGTGACAAGGG + Intergenic
1173911099 20:46671569-46671591 GTGGGTTCTCTAGGAAACAGGGG + Intronic
1176771482 21:13078295-13078317 GTTGATTTTCTAGGTAACAACGG - Intergenic
1180436382 22:15308544-15308566 GTTGATTTTCTAGGTAACAACGG - Intergenic
1181118183 22:20647230-20647252 GTGGATTAACTAGGTGCTACTGG + Intergenic
1181562232 22:23712272-23712294 GTGGTTTCTCTATGTTACCCAGG - Intergenic
1181742859 22:24935357-24935379 GATGATTCTCTCGGTGGCACTGG + Exonic
1182142793 22:27976610-27976632 GTGGATTCACTATCTGAGACTGG + Intergenic
950096008 3:10330773-10330795 GTGGAGTTTCTAGGTGACTGTGG + Intronic
956061202 3:65349797-65349819 GAGGAATCTGTAGGTGGCACAGG + Intergenic
957149731 3:76470520-76470542 GTGGCCTCTCTACGTGACTCGGG + Intronic
957332512 3:78783801-78783823 GTGGCTTCTCTTGGTGAACCAGG + Intronic
958983772 3:100756445-100756467 GTGATTTCTGTAGGTGACAAAGG - Intronic
959227354 3:103602985-103603007 GTGGATGCTCAGGGTGTCACTGG - Intergenic
964532308 3:157681778-157681800 GCAGATTCTCTAAGTGGCACGGG + Intergenic
965042132 3:163522231-163522253 GTGGATTCTTTTTATGACACAGG - Intergenic
965998232 3:174913308-174913330 GTGGCTTATTTAGGTGTCACAGG + Intronic
970958958 4:21850505-21850527 GTAGAGTCCCGAGGTGACACAGG - Intronic
971359330 4:25922437-25922459 GTCTATTCTCTTTGTGACACAGG + Intronic
976055926 4:81066948-81066970 GTGACTTCTCTAGGGGACATAGG - Intergenic
982118905 4:152120327-152120349 GTAGAGTCCCGAGGTGACACAGG - Intergenic
984137146 4:175954992-175955014 TTGGATTCTCAAGTAGACACAGG - Intronic
985819479 5:2149854-2149876 GTGCATTCTCCAGAGGACACTGG - Intergenic
986430838 5:7679522-7679544 GGTGATTCTCTAGGTGACAGAGG + Intronic
986546987 5:8908347-8908369 GTGCACTCTCTCTGTGACACTGG - Intergenic
988865005 5:35324763-35324785 GTGCATTCTCTGTGTGCCACAGG - Intergenic
988923357 5:35964336-35964358 CTGGGTTCTCTGGGTGACGCTGG - Intronic
989417931 5:41202195-41202217 GTGAATTCTCCAGGTAACAGAGG + Intronic
992592554 5:78310352-78310374 GTGGCTTGTCGAGGTCACACTGG - Intergenic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
998413894 5:141931389-141931411 GTGGATTTTCTAAGTGAGACAGG + Intronic
1001163506 5:169342368-169342390 GTGGATTCTCATGCTGACCCAGG - Intergenic
1002075311 5:176705042-176705064 GTGGCTTCTCTAGGAAACACAGG - Intergenic
1002854121 6:1022575-1022597 GTGGAATCTCTAGGTATCCCTGG + Intergenic
1016450704 6:144179519-144179541 GTGGAATTTCTAGGTGCCTCTGG + Intronic
1017107350 6:150900446-150900468 GTGGATTCCCCAGGGGAAACTGG - Intronic
1017107790 6:150904414-150904436 CTGAATTCACTAGGAGACACAGG + Intronic
1019949149 7:4357070-4357092 GTGGAATCACTGGGTCACACGGG + Intergenic
1020475984 7:8595041-8595063 GTGGAATCTCAAGGTCACCCTGG + Intronic
1027566303 7:79799411-79799433 GTATATTCTGAAGGTGACACAGG - Intergenic
1030464809 7:109887461-109887483 GTGGACCCTCTAGGTGAAAGTGG - Intergenic
1031310232 7:120187227-120187249 GTGGATTTTCTAGGAGATCCAGG + Intergenic
1031972232 7:128073217-128073239 GTTGATTCTGTAGGTGGCACTGG - Intronic
1033235832 7:139637153-139637175 GTGGAAGCTCCAGGTGACGCAGG - Intronic
1033494079 7:141876619-141876641 GTGCATTCTCTGTGTGCCACAGG + Intergenic
1045848838 8:106669298-106669320 GTGGATTCTGTAGGAGATAATGG + Intronic
1046726829 8:117684779-117684801 TTGGCTTCTCTAGGCCACACTGG + Intergenic
1046812027 8:118543711-118543733 TTGGCTTCCCTGGGTGACACTGG - Intronic
1050317883 9:4422015-4422037 GTGGTTTCTATTGGTGACAGAGG - Intergenic
1055834470 9:80421910-80421932 GTGCATTTTCTGGGTGACAAAGG - Intergenic
1057942930 9:99300502-99300524 GGGGCTTTTCAAGGTGACACTGG - Intergenic
1060157466 9:121329680-121329702 CTAGAGCCTCTAGGTGACACTGG - Intronic
1061207536 9:129173604-129173626 GTGGAATGTCTTGGTGAGACGGG + Intergenic
1187799729 X:23047931-23047953 ATGAATTCCTTAGGTGACACTGG + Intergenic
1188735762 X:33713196-33713218 GTGGAATCTCTATCTGAGACTGG - Intergenic
1192537554 X:71941237-71941259 GTGGATTCTGAATGTGAGACAGG - Intergenic
1198706980 X:139460381-139460403 GTAGATTCTCTGGGTGAAGCAGG + Intergenic
1199266515 X:145834088-145834110 GCGAATTCTCTGTGTGACACTGG + Intergenic
1201229086 Y:11845762-11845784 GTGTTTTCTCTATGTGCCACAGG - Intergenic