ID: 1126460807

View in Genome Browser
Species Human (GRCh38)
Location 15:48913314-48913336
Sequence CTGTGTACCTAGAAGGATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 594
Summary {0: 2, 1: 16, 2: 172, 3: 176, 4: 228}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126460805_1126460807 -9 Left 1126460805 15:48913300-48913322 CCAGGTCACTGGAGCTGTGTACC 0: 4
1: 113
2: 154
3: 112
4: 218
Right 1126460807 15:48913314-48913336 CTGTGTACCTAGAAGGATTATGG 0: 2
1: 16
2: 172
3: 176
4: 228
1126460804_1126460807 -8 Left 1126460804 15:48913299-48913321 CCCAGGTCACTGGAGCTGTGTAC 0: 4
1: 112
2: 164
3: 107
4: 255
Right 1126460807 15:48913314-48913336 CTGTGTACCTAGAAGGATTATGG 0: 2
1: 16
2: 172
3: 176
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126460807 Original CRISPR CTGTGTACCTAGAAGGATTA TGG Intronic
905864403 1:41368843-41368865 ATGTGTACCTAGAGGGATCCAGG - Intronic
906053977 1:42899996-42900018 TTATGTTCCTAGGAGGATTATGG + Intergenic
906564064 1:46784007-46784029 TTGTATACCTAGGAGGATTATGG + Intronic
907349136 1:53811539-53811561 TTGTGTGCCTAGGAGGATTATGG - Intronic
908175126 1:61547720-61547742 TTGTGTACCTAGGAGGATTATGG + Intergenic
909673571 1:78214481-78214503 TTGTGTACCTAGGAGGATTATGG - Intergenic
909741722 1:79037443-79037465 CTGTGTGCCTAGAAGAGCTATGG + Intergenic
910077593 1:83298961-83298983 TTGTGTACCTAGTAAGATTATGG - Intergenic
910598529 1:89005567-89005589 TTGTGTACCTAGGAGGATTATGG + Intergenic
910738998 1:90494740-90494762 TTGTGTACCTAGGAGGATTATGG + Intergenic
910916589 1:92296243-92296265 GTGTGTACCTAGAAGGAAGATGG + Intronic
911678910 1:100691764-100691786 TTGTGTACCTGGGAGAATTATGG + Intergenic
913339747 1:117747069-117747091 TTCTGTTCCTAGGAGGATTATGG + Intergenic
914927156 1:151898359-151898381 TTGTGTACCTAGAAGAATTATGG - Intronic
915128509 1:153681507-153681529 CTGTCTACCTAGTAGGATTCAGG + Intronic
915372843 1:155365936-155365958 CTGTTTACCCCTAAGGATTAAGG + Intronic
915743620 1:158139440-158139462 CTGTGTCCCTAGTAGCATGAAGG + Intergenic
915793047 1:158695844-158695866 TTGTGTACCTAGGAGGAATACGG + Intergenic
916579914 1:166097654-166097676 TTGTATACCTAGGAGGATTATGG - Intronic
916923581 1:169494449-169494471 CTTTATAGCTAGAAGGCTTATGG - Intergenic
917057898 1:171003961-171003983 TTGTGTACCTAGGAGGATTATGG + Intronic
917253199 1:173085153-173085175 CTGTGTACCTGACAGTATTATGG + Intergenic
917898506 1:179517169-179517191 TTATGTACCTAGGAGGATTATGG + Intronic
919549501 1:198966611-198966633 TTGTGTACCTACAAGGATTATGG + Intergenic
919711263 1:200731738-200731760 CTGTGGACCTTTAAGGATTTAGG - Intergenic
920371074 1:205479701-205479723 CTGTGTACCACGCAGGATTTAGG + Intergenic
920727044 1:208445906-208445928 TTGTGTACCTAGGAGGATTATGG + Intergenic
921409822 1:214823599-214823621 TTGTGTATCTAGGAGGATTATGG + Intergenic
922396075 1:225202410-225202432 TTATGTTCCTAGGAGGATTATGG + Intronic
922657896 1:227401922-227401944 TTGTGTGCCTGGGAGGATTATGG - Intergenic
922666174 1:227471324-227471346 CTGTGTACCTGGAAAGCTTCAGG + Intergenic
923279296 1:232426876-232426898 TTGTTTACCTAAAAGGATTGTGG - Intronic
923648209 1:235845759-235845781 TTGTGTACTTAGGAGGATTATGG - Intronic
923808663 1:237288530-237288552 TTGTGTACCTAGGAGGATTATGG + Intronic
923874680 1:238034682-238034704 TTGTGTACCTAGGAGGATTATGG - Intergenic
924302337 1:242652218-242652240 TTGTGTACCTAGGAGGATTATGG + Intergenic
924637162 1:245799139-245799161 CTCTGTACCTAATAGGAATAAGG - Intronic
1063668596 10:8081613-8081635 CTGTGCTCCTAGCAGGATTCTGG - Intergenic
1064908153 10:20370245-20370267 TTGTGTACCTAGGAGGATAATGG + Intergenic
1066145524 10:32554038-32554060 TTGTGTACCTAGGAGGGTTATGG + Intronic
1067983734 10:51117258-51117280 CTGTGCACAAAGAAGCATTATGG - Intronic
1068480771 10:57585701-57585723 TTGTGTACCTAGGAGGATTATGG - Intergenic
1068718978 10:60221024-60221046 CAGTATACCTCAAAGGATTAAGG - Intronic
1069112887 10:64468581-64468603 TTATGTTCCTAGGAGGATTATGG - Intergenic
1069150523 10:64953956-64953978 TTGTGCACCTAGGAGGATTATGG + Intergenic
1069242730 10:66162929-66162951 TTGTGTACCTAGGAGGATTACGG + Intronic
1071024197 10:81092949-81092971 TTATGTTCCTAGGAGGATTATGG + Intergenic
1071484722 10:86091407-86091429 TTGTGTACCTAGGAGGATTATGG - Intronic
1072651325 10:97298071-97298093 CTCTGTACCTAGATAGAGTAAGG - Intergenic
1074985823 10:118658744-118658766 TTGTGTACCTCAGAGGATTATGG + Intergenic
1075542984 10:123330851-123330873 CTGAGTACCTAGAAACACTAAGG + Intergenic
1075660637 10:124193301-124193323 TTGTGTACCTGGGAGGATTATGG + Intergenic
1075982769 10:126755620-126755642 TTGTGTACCTAGGAGGATTATGG + Intergenic
1076166297 10:128285243-128285265 CTGAGTACCCAGGAGGATAAGGG - Intergenic
1076666314 10:132094948-132094970 TTGTGTACCTACGAGAATTATGG + Intergenic
1078288581 11:9983351-9983373 TTGTGTACCTAGGGAGATTATGG - Intronic
1079023041 11:16924681-16924703 CTATTTCCCTAGAAGGATAAGGG - Intronic
1079177030 11:18151846-18151868 CTGAGCACCTAGAAGCATTTTGG - Intronic
1079273720 11:19013611-19013633 TTGTGTACCTAGGAGGATTATGG + Intergenic
1079791730 11:24747775-24747797 TTGTGTACCTAGGAGGATTATGG + Intronic
1079952167 11:26819236-26819258 TTATGTTCCTAGTAGGATTATGG + Intergenic
1080324120 11:31050275-31050297 TTGTGTGCCTAGGAGGATTATGG - Intronic
1080402281 11:31947321-31947343 TTGTGTACCTAGGAGGATTATGG - Intronic
1081195253 11:40152712-40152734 TTGTGTACCTAGGAGGATTATGG - Intronic
1082140499 11:48603279-48603301 TTGTGTACCTCGGAAGATTATGG + Intergenic
1082567689 11:54700378-54700400 TTGTGTACCTAGGAAGATTATGG + Intergenic
1082820038 11:57538505-57538527 CTGTGCACCTAGAAGAAAGAGGG + Intergenic
1082903895 11:58285368-58285390 TTGTGTTCCTAGGAGGATTATGG - Intergenic
1082916846 11:58446570-58446592 TTGTGTACCTAGGAGGATTATGG - Intergenic
1083072839 11:60003960-60003982 TTGTGTATCTAGGAGGATTATGG - Intergenic
1083304246 11:61754501-61754523 CTGGGTACCTAGCAGGCTCAAGG - Intronic
1084840538 11:71842943-71842965 TTGTGTACCTAGAAGGATTATGG - Intergenic
1085741591 11:79082162-79082184 CTTTGCACCTAGAAGGACCATGG - Intronic
1085929910 11:81069513-81069535 CTGTGTGCCTGGAAGACTTAAGG + Intergenic
1087714016 11:101585866-101585888 TTGAGTACCCAGAAGGAATAAGG + Intronic
1088137727 11:106578021-106578043 TTGTGTCCCTGGGAGGATTATGG + Intergenic
1088239513 11:107758960-107758982 TTATGTACCTAGGAGGATTATGG - Intergenic
1088388054 11:109281645-109281667 TTGTATACCTAGAAGGATCATGG + Intergenic
1089107378 11:116024058-116024080 TTGTGTACCTAGCAGGATAATGG - Intergenic
1089826394 11:121281767-121281789 TTGTGTACCTAGGAGGATTATGG + Intergenic
1089954242 11:122555782-122555804 TTATGTACCTAGGAGGATTATGG + Intergenic
1090648007 11:128781636-128781658 CTGTGTTCCTATCATGATTATGG + Intronic
1090757304 11:129803770-129803792 CTGTGTACCTAGGAGGATTATGG - Intergenic
1091210541 11:133854527-133854549 TTGTGTACTTAGGAGGATTATGG + Intergenic
1091766482 12:3123352-3123374 CTGTGCACAAAGAAGGGTTAAGG - Intronic
1092693623 12:11144308-11144330 TTGGGTACCTGGGAGGATTATGG + Intronic
1093010515 12:14101934-14101956 TTGTGTACCTAGGAGGATTATGG - Intergenic
1093172553 12:15875968-15875990 TTGTATACCTAGGAGGGTTATGG - Intronic
1093389579 12:18602303-18602325 TTATGTGCCTAGGAGGATTATGG - Intronic
1093409280 12:18845308-18845330 TTGTGTACCTAGGAGGATTATGG + Intergenic
1093488749 12:19681398-19681420 TTGTGTTCCTAGGAGGATTATGG + Intronic
1093720555 12:22437372-22437394 TTGTGTACCTAGGAGGATTATGG - Intergenic
1094176009 12:27542066-27542088 ATGTGTACCTTGTAGGAATATGG + Intronic
1094263464 12:28527817-28527839 TTATGTTCCTAGGAGGATTATGG + Intronic
1094362095 12:29641013-29641035 TTGTGTATGTAGGAGGATTACGG - Intronic
1094447368 12:30546245-30546267 TTGTGTACATAGGAGGATTATGG + Intergenic
1094718390 12:33035130-33035152 TTGTGTAGCTAGGAGGATTATGG + Intergenic
1094802144 12:34048922-34048944 TTGTGTACCTAGGAGGATTATGG - Intergenic
1095115271 12:38344831-38344853 TTGTGTACCTAGGAGGATTATGG - Intergenic
1095248192 12:39946580-39946602 TTGTGTACCTAGGAGGATTATGG + Intronic
1095665172 12:44788933-44788955 TTGTGAACCTAGGAGGATTATGG - Intronic
1095732681 12:45522377-45522399 TTGTGCACCCAGGAGGATTATGG - Intergenic
1095892760 12:47250042-47250064 TTGTGTACCTAGGAGGATTAGGG - Intergenic
1096888612 12:54743709-54743731 TTATGTACCTAGGAGGATTATGG + Intergenic
1096956841 12:55534771-55534793 TTTTGTACCTAGAAGAATTGTGG - Intergenic
1097385986 12:58950476-58950498 TTGTGTACCTAGGAGGATTATGG + Intergenic
1097691150 12:62735730-62735752 CTGACTCCCTAGGAGGATTAGGG + Intronic
1097760533 12:63459450-63459472 TTGTGTACCTAGGAGGATTATGG - Intergenic
1098960940 12:76739207-76739229 TTGTGTACCTAGGAGGATTATGG + Intergenic
1099393040 12:82103206-82103228 TTGTGTACCTAGGAGGATTATGG - Intergenic
1099473030 12:83074559-83074581 TTGTGTACCTAGGAGGATCATGG + Intronic
1099777431 12:87151389-87151411 CTGTGTACCTAGGAGGATTATGG + Intergenic
1100088143 12:90936658-90936680 TTGTGTACCTAGAAGGATTATGG + Intronic
1100291012 12:93214961-93214983 TTGTGTACCTAGGAGGATTATGG + Intergenic
1100842619 12:98629163-98629185 GGGTGGACCTAGAAGGCTTAGGG - Intronic
1101635282 12:106535488-106535510 TTGTGCACCTAGGAGGATTATGG + Intronic
1102916753 12:116760067-116760089 TTGTGTACCAAGGAGGATTATGG + Intronic
1104504516 12:129318842-129318864 TTGTGTACCTAAGAGGATTATGG + Intronic
1105260187 13:18773261-18773283 GTGTGTACCTATAAAGATTCAGG - Intergenic
1105314438 13:19244239-19244261 TTGTGTTCCTAGGAGGATTATGG - Intergenic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1105908242 13:24835096-24835118 TTGTGTGCCTAGGAGAATTATGG - Intronic
1105930749 13:25049423-25049445 TTGTGTGCCTAGGAGGATTATGG - Intergenic
1107184816 13:37505780-37505802 TTGTCTACCTAGGAGGATTATGG - Intergenic
1107666246 13:42693881-42693903 TTGTGTACCTAGGAAGATTATGG + Intergenic
1107756019 13:43622977-43622999 TTGTCTACCTAGAAGGATTATGG + Intronic
1108315830 13:49236257-49236279 CTGTGAACCTAGAAGCAAGACGG + Intergenic
1108469796 13:50756435-50756457 TTGTGTACCTAGAAAGATTATGG + Intronic
1108817085 13:54305325-54305347 TTGTGTACCTAGGAGGATTATGG - Intergenic
1109047951 13:57437691-57437713 TTGTGTACCTAGGAGGATTATGG + Intergenic
1109508422 13:63336971-63336993 TTGTGTACCTAGGAGGATGATGG + Intergenic
1110561853 13:76918025-76918047 TTGTGTACGTGGGAGGATTATGG - Intergenic
1110661220 13:78061010-78061032 TTGTGTACCTAGGAGCATTACGG + Intergenic
1110748079 13:79079504-79079526 TTATGTTCCTAGGAGGATTATGG - Intergenic
1110852637 13:80262717-80262739 TTGTGTATCTAGGAAGATTATGG + Intergenic
1110977324 13:81855577-81855599 CTGTGTACCCACACGTATTACGG - Intergenic
1111165772 13:84455571-84455593 TTGTATACCTAGGAGGATTATGG + Intergenic
1111758106 13:92424492-92424514 CTGTGTACCCAAAAAGATAAAGG - Intronic
1112035382 13:95492384-95492406 TTGTGTACCTAGGAGGATTATGG + Intronic
1112156842 13:96826876-96826898 TTGTGTACTGAGAAAGATTAGGG - Intronic
1112738073 13:102443407-102443429 TTGTGTACCCAGAAGGATTATGG - Intergenic
1112945305 13:104920257-104920279 TTGTGTACTTAGGAGGATTATGG - Intergenic
1113269945 13:108662502-108662524 TTGTGTACCTAGGAGGATTATGG + Intronic
1113329941 13:109317879-109317901 TTGTGTACCTAGGAGGATTATGG - Intergenic
1114692332 14:24595490-24595512 TTGTGTACCTAGGAGGATTAGGG + Intergenic
1115265152 14:31493044-31493066 TTGTGTACCTAGAAGGATTATGG - Intronic
1115299234 14:31865568-31865590 TTGTGTACCTAGGAGGATTATGG - Intergenic
1115680309 14:35730656-35730678 TTGTGTACCTACGAGGATTATGG - Intronic
1115835503 14:37397692-37397714 TTGTGTACCTAGGAGCATTATGG + Intronic
1115969800 14:38932550-38932572 TTGTATACCTAGGAGTATTATGG - Intergenic
1116049046 14:39781239-39781261 TTGTGCATCTAGGAGGATTATGG + Intergenic
1116346695 14:43803212-43803234 TTATGTACCTTGAAGGATTATGG - Intergenic
1117115842 14:52510380-52510402 ATGTGAAACTAGAGGGATTATGG - Intronic
1117510803 14:56448858-56448880 TTGTGTACCTAGGAGGATTATGG + Intergenic
1117639829 14:57786189-57786211 TTGTGTACCTAGGAGAATTATGG - Intronic
1117768464 14:59107767-59107789 TTATGTTCCTAGGAGGATTATGG - Intergenic
1118107686 14:62678751-62678773 CTGTGTAACTACAAGTATTTTGG - Intergenic
1118162312 14:63302348-63302370 TTGTGTACCCAGGAGGATTATGG - Intergenic
1118181604 14:63499322-63499344 CTGTGAAACTAGAAGGGCTATGG + Intronic
1118532218 14:66718925-66718947 TTGTGTACCTAGGAGGATTATGG + Intronic
1119098461 14:71856350-71856372 TAGTGTACCTAGCAGGATTATGG - Intergenic
1121459848 14:94066267-94066289 TTGTGTACCTAGGAGGATTATGG - Intronic
1121516619 14:94556448-94556470 TTATGTACCTAGGAGGATTATGG + Intergenic
1124380713 15:29162581-29162603 TTATGTACCTAGGAGGATTATGG - Intronic
1124557118 15:30736376-30736398 TTGTGTACCTACGAGGATTATGG - Intronic
1124667893 15:31609490-31609512 TTGTGTTCCTGGGAGGATTATGG - Intronic
1124674144 15:31669368-31669390 TTGTGTACCTACGAGGATTATGG + Intronic
1125269410 15:37921684-37921706 TTATGTACCTAGGAAGATTATGG + Intergenic
1125378421 15:39059516-39059538 AAGTGTTCCTAGAAAGATTAAGG - Intergenic
1126134068 15:45374078-45374100 CTATCTACCTAACAGGATTAAGG - Intronic
1126460807 15:48913314-48913336 CTGTGTACCTAGAAGGATTATGG + Intronic
1126572708 15:50168952-50168974 CTGTGTACCTAAGAGGATTATGG - Intronic
1126577489 15:50210907-50210929 TTGTGTACCTAAGAGGATTATGG - Intronic
1127525258 15:59786547-59786569 TTGTATACCTAGGAGGATTATGG + Intergenic
1128238718 15:66085098-66085120 TTGTGTACCTAGGAGGATTATGG - Intronic
1128415008 15:67436823-67436845 TTGTGTACCTAGGAGGATTATGG - Intronic
1129097606 15:73225514-73225536 TTGTGTACCTAGGAGCATTATGG + Intronic
1130289500 15:82584699-82584721 CTGTGTAGATAGATGCATTATGG - Intronic
1132210301 15:100017085-100017107 TTGTGTACCTAGGAGGGTTATGG + Intronic
1132403686 15:101529503-101529525 CTGTGAACACAGAAAGATTAAGG - Intergenic
1133527772 16:6623083-6623105 CTGTGTCCCTTGAAGTATTATGG + Intronic
1135901572 16:26464826-26464848 TTGGGTACTTAGGAGGATTATGG - Intergenic
1138114775 16:54351643-54351665 CTGTGTACCAAGGAGGATACAGG - Intergenic
1138797979 16:59993241-59993263 TTGTGTACCTACGAGGATTATGG + Intergenic
1138881005 16:61014825-61014847 TTATGTTCCTAGGAGGATTATGG - Intergenic
1142779645 17:2171437-2171459 CTGGGTAGAAAGAAGGATTACGG + Intronic
1146583381 17:34059765-34059787 TTGTGTACCGGGGAGGATTATGG - Intronic
1147463202 17:40589160-40589182 TTATGTACCTAGGAGGATTATGG + Intergenic
1148151879 17:45401969-45401991 CTCAGTACCTAGAAGGTTTGAGG - Intronic
1148669982 17:49403125-49403147 CTCTGTTCCTAGAAGGATTTGGG + Intronic
1148966100 17:51437495-51437517 CTATGTACCTATAAGGAATGTGG - Intergenic
1150538946 17:66076478-66076500 TTGTGTACCTAGGAGGAATATGG - Intronic
1150945683 17:69743245-69743267 TTGTGTACCTAGGAGAATTATGG + Intergenic
1151048380 17:70948169-70948191 TTGTGTAGCTAGGAGGATTATGG - Intergenic
1153069495 18:1089268-1089290 TTGTGTACCTAGGAGGATTGTGG + Intergenic
1153168987 18:2293537-2293559 TTGCGTACCTAGGAGGATTATGG + Intergenic
1153400471 18:4679028-4679050 TTGTGTACCTAGGAGGATTATGG - Intergenic
1153965942 18:10182161-10182183 TTGTGTACCTGGGAGGATTACGG + Intergenic
1154094075 18:11393844-11393866 TTGTGTAACTAGGAGGATTATGG - Intergenic
1156011393 18:32501399-32501421 TTGTGTACCTAGGAGGATTATGG + Intergenic
1158331525 18:56368085-56368107 TTGTGTACCTAGGAGGATTATGG + Intergenic
1158341582 18:56472362-56472384 CTGTGAAACCAGAAGGCTTATGG - Intergenic
1158756476 18:60331851-60331873 TTGTGTACCAAGGAGGGTTATGG - Intergenic
1158829748 18:61264086-61264108 TTGTGTACCTAGGAGGGTTATGG - Intergenic
1159787076 18:72727131-72727153 CTGTGAACCTAGGAGGATTATGG - Intergenic
1160267606 18:77353774-77353796 TTGTGTACCTAGGAGGATTATGG + Intergenic
1164237829 19:23352311-23352333 TTTTGTACCTAGGAAGATTATGG - Intronic
1164251719 19:23483078-23483100 TTGTGTACCTAGGAGGATTATGG - Intergenic
1164267441 19:23632902-23632924 TTGTGTACCTAGGAGGATTATGG - Intronic
1166604269 19:44126759-44126781 TTGTGTACCTAGGAGGATTATGG + Intronic
925479154 2:4251028-4251050 TTATGTTCCTAGGAGGATTATGG + Intergenic
926081341 2:9988876-9988898 CTGTGTATCTATAAAGAATAAGG - Intronic
926819336 2:16835390-16835412 CTATGAACCAAGTAGGATTAGGG + Intergenic
926872760 2:17441267-17441289 TTGTGTACCTAGGAGGATTATGG + Intergenic
927251383 2:20997734-20997756 CTGTGTAACTTGAAGGACTATGG - Intergenic
928443250 2:31311271-31311293 TTATGTTCCTAGGAGGATTATGG + Intergenic
930486522 2:52017854-52017876 TTATGTACCTAGGAGGATTATGG + Intergenic
931525232 2:63145475-63145497 TTGGGTACCTAAGAGGATTATGG + Intronic
931547859 2:63408820-63408842 TTGTGTACCTAGGAGGATTATGG - Intronic
931993007 2:67809735-67809757 TTGTGTACCTAGGAGGGTTATGG - Intergenic
932074513 2:68650590-68650612 CTGAGTACCTAACAGGATTTTGG - Intronic
932100669 2:68896660-68896682 TTGTGTACCTAGGAGGACTATGG + Intergenic
932191741 2:69746672-69746694 GTGTGGACCAAGAAGCATTATGG - Intronic
932270365 2:70403719-70403741 TTGTGTCCCTAGGAGGATTATGG - Intergenic
932384908 2:71323395-71323417 TTATGTTCCTAGGAGGATTATGG + Intronic
932954650 2:76337363-76337385 TTATGTACCTAGCAGGATTATGG + Intergenic
933121334 2:78541947-78541969 TTGTGTACCTAGGAGGATTATGG - Intergenic
933531508 2:83517697-83517719 TTGTGTGCCTAGGAGGATTATGG - Intergenic
934886805 2:98032156-98032178 GTGTCAACCTAGATGGATTAAGG - Intergenic
936713295 2:115158302-115158324 CTCTTTACCTAGAAATATTAAGG - Intronic
936772735 2:115934544-115934566 GTGTGTCCCTAGCAGAATTAAGG + Intergenic
937057846 2:118954340-118954362 TTGTGTACCTAGAAGGATTATGG - Intronic
937069269 2:119050365-119050387 TTGTGTACCTAGGAGGATTATGG + Intergenic
937305756 2:120869500-120869522 CTCATTACCTAGGAGGATTATGG - Intronic
937521775 2:122720904-122720926 TTATGTACCTAGGAGGATTATGG - Intergenic
937561599 2:123231258-123231280 TTATGTTCCCAGAAGGATTATGG + Intergenic
937663019 2:124452314-124452336 TTATGTTCCTAGAAGGATTATGG - Intronic
937828949 2:126399421-126399443 TTATGTTCCTAGGAGGATTATGG + Intergenic
938038091 2:128053243-128053265 TTGTGTACCCAGGAGGATTATGG + Intergenic
940172377 2:150843098-150843120 TTGTGTACCTAGGAAGATTATGG + Intergenic
940431332 2:153593351-153593373 TTGTGTACCTAGGAGGATTATGG - Intergenic
940709398 2:157144038-157144060 TCATGTACCTAGGAGGATTATGG + Intergenic
941479375 2:165987207-165987229 CTGTGTACCAAGAAGTAATGTGG + Intergenic
941627424 2:167845015-167845037 TTGTCTACCTAAGAGGATTATGG - Intergenic
943129666 2:183839950-183839972 TTATGTTCCTAGGAGGATTATGG - Intergenic
943891257 2:193289942-193289964 TTGTGTACTTGGGAGGATTATGG + Intergenic
944306467 2:198185431-198185453 CTGTATACCTAGAAGTTTGAAGG + Intronic
944528889 2:200648807-200648829 TTGTGTACCTAGGAGGATTATGG + Intronic
944874061 2:203943861-203943883 TTGTGTACCTAGGAGGATTATGG + Intronic
945075312 2:206032456-206032478 TTGTGTATTTAGGAGGATTATGG - Intronic
945132115 2:206584545-206584567 GTCTCTACCTAGGAGGATTATGG - Intronic
945482588 2:210360888-210360910 TTATGTACCTAGGAGGATTATGG + Intergenic
945864525 2:215161657-215161679 TTGTGTACCTAGGAGGATTATGG - Intergenic
946036446 2:216746219-216746241 TTGTGTACCTAGGAGGATTATGG - Intergenic
947288809 2:228547990-228548012 CTGTTTACTTAGAAGAATAAAGG + Intergenic
947457089 2:230265185-230265207 TTGTGTACCTGGGAGGATTATGG + Intronic
947905462 2:233758288-233758310 CTGTGTACCTGGATGGTTTGTGG - Intronic
948572425 2:238926082-238926104 CTGTGTACCTGGGAGGAGCATGG - Intergenic
948815143 2:240506701-240506723 GTGTGTACCAAGATGGATTGAGG + Intronic
1169336208 20:4759541-4759563 TTGTGTACCTAGGAGGATTATGG + Intergenic
1169401309 20:5282910-5282932 TTGTGTTCCTAGGAGGATTATGG - Intergenic
1169517476 20:6333242-6333264 TTGTGTACCTAGGAGGATTATGG + Intergenic
1170245778 20:14220249-14220271 TTGTTTACCTAGGAGGATTATGG + Intronic
1170483717 20:16794132-16794154 GTGTGTTCCTAGGAGGTTTATGG + Intergenic
1170721030 20:18879352-18879374 TTGTGTACCTAGCAGGATTGTGG + Intergenic
1170863168 20:20127909-20127931 TTGTGTACCTAGGAGGATTATGG + Intronic
1171165587 20:22967467-22967489 TTGTGTACCTAGGAGGATTATGG - Intergenic
1171205098 20:23272923-23272945 CTGTGAATCTAGAAGAGTTATGG - Intergenic
1176175003 20:63717275-63717297 CTGTATACCTTGAAAAATTAGGG - Intronic
1177174449 21:17689251-17689273 TTGTGTACCTAGCAGGATTATGG + Intergenic
1177195596 21:17900910-17900932 TTGTGTACCTAGGAGGATTATGG + Intergenic
1177675988 21:24299629-24299651 CTGAGAACCTAGTAAGATTATGG + Intergenic
1178054299 21:28781870-28781892 CTGTTTACCTAGAAGCCTTGGGG - Intergenic
1178059362 21:28834916-28834938 TTGTGTACCTAGGAGGATTATGG - Intergenic
1178801667 21:35801340-35801362 TTGTGTACCTATAAGGATTATGG - Intronic
1178959020 21:37047283-37047305 TTGTGTACCTAGGAGGATTGTGG - Intergenic
1183048458 22:35241146-35241168 TTGTGTACCTAGGAGGATTATGG + Intergenic
1184220139 22:43094660-43094682 CTGAGCACCTAGAAGGATTAGGG + Intergenic
949604055 3:5634409-5634431 TTGTGTACCTAGGAGGGTTATGG + Intergenic
949814247 3:8041064-8041086 TTGTGTACCTAGGAGGGTTATGG - Intergenic
950592400 3:13947857-13947879 TTGTGTACCTAGGAGGATTATGG + Intronic
950603561 3:14057840-14057862 TTGTGTACCTAGGAGAATTATGG + Intronic
951269606 3:20608288-20608310 TTGTGTACCTAGGATGATTATGG - Intergenic
951761179 3:26148713-26148735 TTGTGTACCTAGAAGGATAATGG - Intergenic
952162483 3:30707766-30707788 CTGGATATCTAGAAGGATAATGG + Intergenic
953723961 3:45381611-45381633 TTGTGTACCTAGGAGGATTATGG + Intergenic
955103479 3:55874296-55874318 CTTTGTACATGGAAGGAGTATGG + Intronic
955175644 3:56611288-56611310 TAGTGTACCTAGGAGGATTATGG + Intronic
955193660 3:56785094-56785116 CTTTGTCCCTGGAAGGATCAAGG - Intronic
955450778 3:59064742-59064764 TTATGTTCCCAGAAGGATTATGG + Intergenic
956950254 3:74274081-74274103 TTATGTACCTAGGAGGATTATGG - Intronic
957016404 3:75069521-75069543 TTGTGTACCTAGGAGAATTATGG + Intergenic
958013790 3:87914616-87914638 TTGTGTACCTAGGAGGATTATGG - Intergenic
958262992 3:91404189-91404211 TTGTGCACCTAGGAGGATTATGG + Intergenic
958480800 3:94643474-94643496 TTGTGTACCTAGGAGGATTATGG + Intergenic
958490500 3:94766367-94766389 TTGTGTACCTAGGAGGATTATGG + Intergenic
959046954 3:101485030-101485052 TTGGGTACCTAGGAGGATTATGG - Intronic
959279767 3:104323400-104323422 TTGTGTATCTAGGAGGATTATGG - Intergenic
959436133 3:106317321-106317343 CTGTGTACCTAATAGGATTATGG - Intergenic
959756980 3:109910888-109910910 TTATGTACCTAGGAGGATTATGG + Intergenic
959875159 3:111373600-111373622 TTATGTTCTTAGAAGGATTATGG - Intronic
959997258 3:112693397-112693419 TTGTGTACCTAGGAGGATTATGG - Intergenic
960512858 3:118571688-118571710 TTGTGTGCCTAGGAGGATTATGG + Intergenic
960516530 3:118608256-118608278 TTATGTTCCTAGGAGGATTATGG - Intergenic
962344640 3:134610260-134610282 CTGTGTACCTGGAGGGAAGATGG - Exonic
962401859 3:135067412-135067434 TTGTGTACCTAGGAGGATTATGG + Intronic
964160628 3:153641007-153641029 TTGTGTACCTAGTAGGATTATGG - Intergenic
964188986 3:153980350-153980372 TTGTGTACCTAGGAGGATTATGG - Intergenic
965052728 3:163671391-163671413 TTGTGTACCTAGGAGGATTATGG + Intergenic
965321905 3:167261549-167261571 TTGTGTACCTAGAAGGATTATGG + Intronic
965708300 3:171531733-171531755 CTGACTACCAAGAAGGATTTTGG - Intergenic
966020425 3:175202837-175202859 TTGTGTACCTAGGAGGATTATGG + Intronic
966117700 3:176485236-176485258 TTGTATACCTAGGAGGATTATGG + Intergenic
966686649 3:182703194-182703216 CTATGATCCTAGAAGGATTGTGG + Intergenic
966992021 3:185242596-185242618 TCATGTACCTAAAAGGATTATGG + Intronic
967209065 3:187150558-187150580 TTGTGTACCTAGGAGGATTATGG - Intronic
967257527 3:187609052-187609074 TTGCGTACCTAGGAGGATTATGG + Intergenic
967278938 3:187804005-187804027 CTGAGAACCTTGAAGGATTAAGG - Intergenic
967399930 3:189049419-189049441 TTGTGTACCTAGGAGGACTATGG - Intronic
967420486 3:189266812-189266834 CTTTGTAACTAGAAAGATCAAGG - Intronic
967431373 3:189389887-189389909 CTGTCTACCTAGAAGGAAGTAGG + Intergenic
967465943 3:189806251-189806273 CTGTGTAGCTAGAAGCAGGAGGG + Intronic
969277747 4:6148451-6148473 CTGTGTATCTCGAAGGACTGTGG - Intronic
969781627 4:9408937-9408959 TTGTGTACCTAGAAGGATTATGG - Intergenic
970257997 4:14189347-14189369 CTGTATACTTACAAGGATTATGG - Intergenic
970346592 4:15158821-15158843 TTGTGCACCTAAGAGGATTATGG + Intergenic
970658637 4:18260257-18260279 TTGTGTACCTAGGAGGATTATGG + Intergenic
971054162 4:22894058-22894080 CTGTGTACCTAGAATTGATAAGG + Intergenic
971183135 4:24349520-24349542 TTGTGTACCTAGGAGGATTATGG + Intergenic
971659161 4:29389810-29389832 CTGTGTAGCTAGAAGCAAGATGG - Intergenic
971901009 4:32658225-32658247 TTGTGTATGTAGGAGGATTATGG + Intergenic
972048805 4:34702552-34702574 TTATGTTCCTAGGAGGATTATGG - Intergenic
972189082 4:36568661-36568683 TTGTGTACCTAGGAGGATTGTGG + Intergenic
973179594 4:47251710-47251732 TTGTGTACCTACGAGGATTATGG + Intronic
973782395 4:54300705-54300727 TTGTGCACCTAGGAGGATTATGG - Intergenic
973787076 4:54342125-54342147 TTGTGTACCTAGGAGGATTATGG - Intergenic
974165075 4:58191177-58191199 TTATGTTCCTAGGAGGATTATGG - Intergenic
974474455 4:62361615-62361637 TTGTGTATCCAGGAGGATTATGG + Intergenic
974950954 4:68582538-68582560 TTGTGTACCTAGGTGGATTTTGG - Intronic
975517247 4:75260261-75260283 TTGTGTCTCTAGGAGGATTATGG - Intergenic
975680191 4:76868300-76868322 TTGTGTACCTGGGAGGATTATGG - Intergenic
975796644 4:78012922-78012944 CTGTGTACCAAGAAGAATGATGG - Intergenic
976856470 4:89610196-89610218 TTGTGTACCTAGGAGGATTATGG - Intergenic
977020003 4:91746926-91746948 TTGTGTATCTAGGAGGATTATGG + Intergenic
977746770 4:100558657-100558679 TTATGTACCTAGGAGAATTATGG - Intronic
978670694 4:111244389-111244411 TTGTGTCCCTAGGAGGATTATGG - Intergenic
978726704 4:111977678-111977700 TTATGTACCTAGGAGGATTATGG + Intergenic
978999690 4:115200891-115200913 TTGTGTACCTAGGAGGATTATGG + Intergenic
979498438 4:121411386-121411408 TTGTGTACCTAGGAGGATTATGG + Intergenic
979704838 4:123709277-123709299 TTGTGTACCTAGGAGGATTATGG - Intergenic
979794901 4:124834380-124834402 TTGTGTACCTAGGAGGATTATGG + Intergenic
979995465 4:127426141-127426163 TTGTGTACCTAGGAGAATTATGG - Intergenic
980087195 4:128403623-128403645 CTGTGTACCTAGAAGGATTATGG + Intergenic
980523520 4:133960835-133960857 TTGTGTACCTAGGAGCATTATGG - Intergenic
980543799 4:134230627-134230649 CTGTCTTCATAGAATGATTAAGG + Intergenic
980580351 4:134742426-134742448 TTGTGTACCTAGAATGATTATGG + Intergenic
980610157 4:135150338-135150360 CTGTGTTCCCAGAAAGATGATGG - Intergenic
980676207 4:136085201-136085223 CTGTGTTCCCAGAGGGCTTATGG - Intergenic
981346628 4:143683928-143683950 TTGTGCACCTAGGAAGATTATGG - Intronic
981400983 4:144313621-144313643 TTGTGTACCTAGGAGGATTATGG + Intergenic
981461093 4:145014360-145014382 TTGTGTACTTAGGAGAATTATGG - Intronic
981760801 4:148192699-148192721 TTGTGTACCAAGGAGGATTATGG + Intronic
982189950 4:152843636-152843658 TTGTGTACCTAGGAGGATTATGG + Intronic
982218777 4:153107123-153107145 TTGTGAACTTAGGAGGATTATGG + Intergenic
982312165 4:153997396-153997418 TTGTGTACCTAGGAGGATTATGG + Intergenic
983449775 4:167895401-167895423 TTGTGTATCTAGGAGGATTATGG - Intergenic
983544943 4:168953135-168953157 TTGTGTACCTGGGAGGATAATGG + Intronic
984266712 4:177505454-177505476 TTGTGTACCTAGGAGGATTAGGG + Intergenic
984323559 4:178224338-178224360 TTGTGTACCTGGGAGGATTCTGG - Intergenic
984474992 4:180224759-180224781 CTTTGTTCCTAGGAGGATTATGG + Intergenic
984558609 4:181241969-181241991 CTGTGTGCCCAGAAGGAGAAAGG + Intergenic
984721670 4:182978359-182978381 TTGTGTACCTAGGAGGATTATGG - Intergenic
986870225 5:12036736-12036758 TTATGTTCCTAGGAGGATTATGG - Intergenic
988344592 5:30021045-30021067 CTGTGTACCTAGTAGGATTATGG - Intergenic
988723567 5:33903384-33903406 TTATGTTCCTAGGAGGATTATGG + Intergenic
989071394 5:37515221-37515243 CTGTGTAGATAGAAGGTTTTAGG + Intronic
990233324 5:53739260-53739282 TTGTGTACCTAGGAGGATTATGG - Intergenic
990572768 5:57095358-57095380 TTGTGTACCTAGGAGGATTATGG - Intergenic
990633165 5:57693106-57693128 ATGTCTGTCTAGAAGGATTAAGG - Intergenic
990776233 5:59308964-59308986 TTGTGCACCTAGGAGGATTATGG + Intronic
991117364 5:62969982-62970004 TTATGTACCTAGGAGGATTATGG - Intergenic
991438722 5:66623176-66623198 ATCTGTAGCTACAAGGATTATGG + Intronic
991575164 5:68095369-68095391 CTGTGAACCTTGAAGGTTCATGG + Intergenic
991599902 5:68341872-68341894 CTGTGTCCTTTGAAGGATGAGGG + Intergenic
991923867 5:71684347-71684369 TTATATACCTAGGAGGATTATGG - Intergenic
993250350 5:85513323-85513345 TTGTGTACCTAGGAGGATTATGG + Intergenic
993695696 5:91059076-91059098 CTGTATACATAGGAGGATTTGGG + Intronic
993883888 5:93394813-93394835 TTGTGTACCTAAGAGGATAATGG + Intergenic
993917042 5:93756147-93756169 TTGTGTACCTAGAGGGATTATGG - Intronic
993964761 5:94347081-94347103 TTGTATACCTAGGAAGATTATGG - Intronic
994304040 5:98180673-98180695 TTATGTTCCTAGGAGGATTATGG - Intergenic
994568383 5:101482982-101483004 TTGTGTACCCAGGAGGATTGTGG + Intergenic
994883581 5:105529309-105529331 TTGTGTATCTAGAAGGATTATGG + Intergenic
995317914 5:110797376-110797398 TTATGTACCTAGCAGGATTATGG + Intergenic
995473021 5:112523341-112523363 TTGTGTGCCTAGGAGGATTATGG + Intergenic
995722493 5:115151301-115151323 TTATGTTCCTAGGAGGATTATGG - Intronic
995817797 5:116191563-116191585 CTGTGTACCTAGGAGGATTATGG - Intronic
996124156 5:119706159-119706181 TTGTGTACCTAGGAGGATTATGG + Intergenic
996288951 5:121829071-121829093 TTATGTACCTAGAAAGATTATGG + Intergenic
996325404 5:122267478-122267500 TTTTGTATCTAGGAGGATTATGG - Intergenic
996504800 5:124257235-124257257 TTGTGTACCTAGGAGGATTATGG + Intergenic
998429153 5:142055368-142055390 TTATGTAGCTAGAAGGATAATGG - Intergenic
998777492 5:145618901-145618923 TTATGTACCTAGGAGGATTACGG + Intronic
998940854 5:147280560-147280582 TTGTGTACCTAGGAGGATTATGG - Intronic
999148550 5:149411896-149411918 CTGTGTGCCCAGAGGGATAATGG - Intergenic
999677090 5:154015068-154015090 TTATGTTCCTAGGAGGATTATGG - Intronic
999818500 5:155200948-155200970 TTGTGTACCTCGGAGGATTATGG - Intergenic
1000757916 5:165184183-165184205 TTGTGTACCTAAGAGGATTCTGG + Intergenic
1001012856 5:168114347-168114369 CTCTGTGCCAAGAAGTATTACGG - Intronic
1002813836 6:660125-660147 TTCTGTACCTAGGGGGATTATGG - Intronic
1003029441 6:2589291-2589313 TTGTGTACCTAGAAGGATTAAGG + Intergenic
1003323889 6:5077207-5077229 CTAGGTTCCTATAAGGATTACGG + Intergenic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1003450870 6:6230364-6230386 CTGTGTACCTAAGAGGATTATGG - Intronic
1003581939 6:7347841-7347863 TTGTGTACCTAGGAGGATTATGG - Intronic
1003711929 6:8602415-8602437 TTGTGTACCTAGGAGGATTATGG + Intergenic
1003930495 6:10919793-10919815 TTATGTTCCTAGGAGGATTATGG + Intronic
1005072489 6:21874605-21874627 TTGTGTACCTAGGAGGATCATGG - Intergenic
1005760261 6:28961199-28961221 TTATGTACCTAGAAGGATTTTGG - Intergenic
1006173135 6:32106950-32106972 ATGTGTACCTACAAGGATGCAGG - Intronic
1007892644 6:45310203-45310225 TTGTATACCTAGGAGGATTATGG - Intronic
1007979299 6:46134158-46134180 CTTTGTAACTAGAATGATAAAGG + Intronic
1008121470 6:47622063-47622085 TTGTGTAGCTAGGAGGAATATGG + Intronic
1008288683 6:49685702-49685724 ATCTTTACCTAGAAGGAATATGG + Intergenic
1008528630 6:52433895-52433917 TTGTGTTCCTAGGAAGATTATGG + Intronic
1008992416 6:57618698-57618720 TTGTGCACCTAGGAGGATTATGG - Intronic
1009181041 6:60517811-60517833 CTGTGCACCTAGGAGGATTATGG - Intergenic
1009453164 6:63825174-63825196 TTGTGTACCTAGGAGGATTGTGG - Intronic
1009968771 6:70604636-70604658 TTGTGTGCCTAGGAGGATTATGG - Intergenic
1010008969 6:71028266-71028288 TTGTGTACCTGGGAGGATTATGG + Intergenic
1010076378 6:71803429-71803451 TTCTGTACCTAGGAGGATTATGG + Intergenic
1010967173 6:82224349-82224371 TTGTGTTCCGAGAAGGATTCAGG - Intronic
1011133157 6:84072794-84072816 TTGTGTACCTAGGAGGATTATGG + Intronic
1011168618 6:84479421-84479443 TTGTGTACCTAGGAGGATTATGG - Intergenic
1011233311 6:85187897-85187919 TTGTGTATTTAGGAGGATTATGG - Intergenic
1011329076 6:86183907-86183929 TTGTGTACCTAGGAGGATTATGG + Intergenic
1011789741 6:90885499-90885521 TTGTGTACCTAGGAGGATTATGG + Intergenic
1011893319 6:92194129-92194151 TTGTCTACCTAGGAGGATTATGG + Intergenic
1012155946 6:95819897-95819919 TTGTGTACCTAGGAGGATTATGG - Intergenic
1012793737 6:103734323-103734345 TTGTGTACCTACGAGGATTATGG - Intergenic
1012922672 6:105235394-105235416 TTGTGTACCTAGGAGGATTATGG - Intergenic
1013852647 6:114534660-114534682 TTGTGTACCTAGGAGGATTATGG + Intergenic
1013901019 6:115156245-115156267 TTGTGTACTTAGGAGGATTATGG + Intergenic
1013913770 6:115310243-115310265 TTATGTTCCCAGAAGGATTATGG + Intergenic
1014603888 6:123448507-123448529 TTGTGTAAGTAGGAGGATTATGG - Intronic
1014681413 6:124435160-124435182 CTGGATAACTAGAAGGAATATGG + Intronic
1014738763 6:125124378-125124400 CTGTGTACCTAGCAGGATTATGG - Intronic
1015663317 6:135600460-135600482 TTGTGTACCTAGGAGAATTATGG + Intergenic
1015836348 6:137424386-137424408 CTGTCTACCTAGAAGACTTGAGG + Intergenic
1015849800 6:137560183-137560205 TTGTGTACCTAGGAGGATTATGG + Intergenic
1016290030 6:142518645-142518667 CTATGTTCCTAGGAGGATTATGG + Intergenic
1017190495 6:151648412-151648434 TTGTGTACCTAGGAGGATTACGG + Intergenic
1018009398 6:159655713-159655735 TTGTGTTCTTAGGAGGATTATGG - Intergenic
1018114953 6:160574116-160574138 TTGTGTACCTAGGAGGATTATGG + Intronic
1018339683 6:162838510-162838532 CTGTGTACCTCAAAGGAAAAGGG + Intronic
1018436935 6:163769122-163769144 CTGTATACCAAGAAGAATAAAGG + Intergenic
1019614174 7:1951456-1951478 CTGTGCACTTAGAATGGTTATGG - Intronic
1020373689 7:7461657-7461679 TTGTATACCTAGGAGGATAATGG - Intronic
1020915234 7:14184549-14184571 TTGTATACCTAGGAGGATTATGG - Intronic
1022777716 7:33544913-33544935 TTGTGTACCTAGGAGGTTTATGG + Intronic
1023205740 7:37747651-37747673 CTGTGTACCCAGAATGATTCTGG + Intronic
1023701262 7:42893567-42893589 CTGTGTACCTAGGAGGATTATGG - Intergenic
1024545466 7:50513745-50513767 TTGTGTACCTAGGAGGATTATGG - Intronic
1025772784 7:64528596-64528618 TTATGTACCTAGGAGGATAATGG - Intronic
1027295367 7:76764166-76764188 TTGTGTACCTAGTAAGATTATGG - Intergenic
1027350463 7:77306406-77306428 TTGTGTACCCAGGAGGATTATGG + Intronic
1027417652 7:77990271-77990293 TTGTGTACCTAGGAGGATTATGG + Intergenic
1028182974 7:87747702-87747724 TTGTGTACCTAGGAGGATTATGG + Intronic
1028962246 7:96761873-96761895 TTGTGTACCTAGGAGGATTATGG + Intergenic
1028993578 7:97076011-97076033 TTGTGTACCTAGGAGGATTATGG + Intergenic
1029275079 7:99399128-99399150 CTGTGTACCTTGAAGGCCTCTGG - Intronic
1030325202 7:108211680-108211702 TTGTGTACCTAGGAGGATTAAGG - Intronic
1030935983 7:115585320-115585342 TTGTGTACCTAGGAGGATTGTGG - Intergenic
1031879220 7:127177270-127177292 TTGTGTACCTAGGAGGATTATGG - Intronic
1031925725 7:127636498-127636520 CTGTGTACCTATAAACATTAGGG + Intergenic
1032922657 7:136567050-136567072 CTATGTTCCTAGGAGGATTATGG + Intergenic
1033900199 7:146128645-146128667 TTGTGTACCTAGAAATATTTGGG - Intronic
1034683208 7:152947043-152947065 TTATGTTCCTAGGAGGATTATGG + Intergenic
1034705492 7:153139521-153139543 TTATGTTCCCAGAAGGATTATGG + Intergenic
1036837794 8:12089793-12089815 TTGTGTACCTAGAAGGATTATGG + Intergenic
1037946312 8:22991698-22991720 CTGTGTACCAAGAAGGCAGAGGG + Intronic
1038237074 8:25769471-25769493 TTGTGTTCCTAGGAGGATTATGG - Intergenic
1039095558 8:33880944-33880966 TTGTGTACCTAGGAGGATTATGG + Intergenic
1039123565 8:34175608-34175630 TTGTGTACCTAGGAGGATTATGG - Intergenic
1039268489 8:35854668-35854690 CTAGGTACCTAGGAGTATTATGG - Intergenic
1039641453 8:39227602-39227624 TTGTGTACCTAGGAGGATTATGG - Intronic
1040635684 8:49270510-49270532 TTGTGTACCTAGGAAGATTATGG + Intergenic
1040800243 8:51331755-51331777 CCTAGTACCTAGGAGGATTATGG - Intronic
1041153679 8:54961985-54962007 CTGTGTGCCAAGGAGGATTCCGG + Intergenic
1041227756 8:55717116-55717138 TTGTGTACCTAGGAGGATTATGG - Intronic
1041293759 8:56333496-56333518 TTGTGTACCTAGGAGGATTATGG + Intergenic
1041364168 8:57083563-57083585 TTGTGTACCTAGGAGGATTATGG - Intergenic
1041570559 8:59333141-59333163 TTGTGTACCGAGGAGGATTATGG + Intergenic
1041637087 8:60156447-60156469 TTGTGTACCTAGGAGGATTATGG - Intergenic
1041877995 8:62712456-62712478 TTGTGTACCTAGGAGGATTATGG + Intronic
1042088590 8:65133886-65133908 TTGTGTACCTAGGAGGATTATGG - Intergenic
1042122882 8:65507449-65507471 TTGTGTACCTAGGAAGATTATGG + Intergenic
1042304151 8:67313985-67314007 TTGTGTATCTAGGAGGATTATGG + Intronic
1042330982 8:67580308-67580330 TTGTGTTGGTAGAAGGATTAGGG - Intronic
1042467139 8:69140876-69140898 TTGTGTACCTAGGAGTATTATGG + Intergenic
1042506700 8:69568296-69568318 CTGTTTATCTAGAAAGATGAAGG + Intronic
1044227600 8:89736942-89736964 TTGTGTGCCTAGGAAGATTATGG - Intergenic
1044907241 8:97017680-97017702 TTATGTTCCTAGAAGGATTATGG - Intronic
1045048960 8:98305653-98305675 CTCTGTACCAAGAAGGAATTTGG + Intergenic
1045269575 8:100650363-100650385 CTGTTTACCTGGAAGAGTTACGG - Intronic
1045394242 8:101744744-101744766 CTGTGTGCCTGGAAGTATAAAGG - Intronic
1045767155 8:105686958-105686980 CTGTGTGCGTAGAAGGAAGAGGG - Intronic
1045779813 8:105849748-105849770 TTGTGTACCTAGGAGGCTTATGG - Intergenic
1046074402 8:109299524-109299546 TTATGTTCCTAGGAGGATTATGG - Intronic
1047118361 8:121870819-121870841 CTGTGTACCTAAAAACATTTGGG + Intergenic
1047130772 8:122017487-122017509 GTGTGTACCTAGGAGGATTACGG + Intergenic
1050132337 9:2425996-2426018 CTGGGTACCAAGGAGGATAATGG + Intergenic
1050147373 9:2583593-2583615 TTGTGTACCTAGGAGGATTATGG - Intergenic
1050784597 9:9385569-9385591 CAGAGTAGCTAGAAGGTTTATGG - Intronic
1052392796 9:27900818-27900840 ATCTGTACCTACATGGATTAAGG + Intergenic
1052731470 9:32291279-32291301 TTGTGTACCTACAAGGATTATGG + Intergenic
1054728834 9:68679774-68679796 CTGTGTATCTAGGAGCATTATGG + Intergenic
1054805681 9:69393967-69393989 CTGTGTACCTGAAAGGCTCAAGG + Intergenic
1054867782 9:70020369-70020391 TTGTGTACCTAGGAGGATTATGG + Intergenic
1055022044 9:71680437-71680459 CTGTGTAGATAGAATCATTAAGG + Intergenic
1055736266 9:79334405-79334427 TTATGTTCCTAGAAGGATTATGG - Intergenic
1055905826 9:81292494-81292516 CTGTGAACCTAGGAGGATTATGG + Intergenic
1056322743 9:85452115-85452137 TTGTGTACCTAGGAGGATTATGG + Intergenic
1056699051 9:88887124-88887146 TTGTGTACCTAGGAGGATTATGG + Intergenic
1057119509 9:92558851-92558873 TTGTATACCTAGGAGGATTATGG + Intronic
1058085047 9:100739788-100739810 TTGTGTACCTATAAGGATTAAGG + Intergenic
1058156689 9:101524197-101524219 TTATGTACCTATGAGGATTATGG + Intronic
1058308415 9:103471392-103471414 TTGTGTACCTAGGAGGATTATGG + Intergenic
1058410386 9:104724982-104725004 TTGGGTACCTAGGAGGATTATGG - Intergenic
1058623218 9:106905640-106905662 TTGTGTACCTAGGAGGATTATGG + Intronic
1058628592 9:106961785-106961807 ATGTGTATCTAGAAGGGTCAAGG + Intronic
1059673774 9:116516891-116516913 TTATGTTCCCAGAAGGATTATGG - Intronic
1187219205 X:17307791-17307813 TTGTGTACCTAGGAAGATTATGG + Intergenic
1187681405 X:21770980-21771002 TTGTGTAGCTAGGAGGATTACGG - Intergenic
1187748372 X:22433615-22433637 TTGTGTACCTAGGAGGACTATGG - Intergenic
1188045912 X:25426163-25426185 TTGTGTACCTAGGAGGATTGTGG + Intergenic
1188738015 X:33742158-33742180 TTGTGTACCTAAGATGATTATGG + Intergenic
1189413585 X:40794508-40794530 TTGTGTTCCTAGGAGGATTATGG - Intergenic
1189603170 X:42648752-42648774 TTGTGTGCCTAGGAGAATTATGG - Intergenic
1189879039 X:45470510-45470532 TTGTGTACCTAGCAGGATTATGG - Intergenic
1189879195 X:45471431-45471453 TTGTGTACCTAGGAGGATTATGG + Intergenic
1190389229 X:49915533-49915555 CTGTGTACATGGAAGTCTTAAGG + Intergenic
1190448918 X:50558027-50558049 TTGTGTACCTAGGAGGATTATGG - Intergenic
1191067631 X:56367208-56367230 TTGTGTACCTAGGAGGATGATGG + Intergenic
1191080637 X:56506040-56506062 TTGTGTACCTAGGAGGATTATGG - Intergenic
1191681824 X:63848365-63848387 CTCTGTAACTAAAAGGGTTATGG + Intergenic
1191692320 X:63952943-63952965 TTATGTTTCTAGAAGGATTATGG - Intergenic
1191779883 X:64854010-64854032 TTGTGTACCTAGGAGGATTATGG + Intergenic
1191903583 X:66064403-66064425 TTGTGTACATAGGAGGATTATGG + Intergenic
1191954121 X:66625437-66625459 TTGTGTACCTAGGAGGATTATGG - Intronic
1192014594 X:67315843-67315865 TTGTGTGCCTAGGAGGATTATGG + Intergenic
1192069080 X:67918131-67918153 ATGTGTCCCTAGGAGGATTACGG + Intergenic
1192881120 X:75285018-75285040 TTGTGTACCTAGGAGGATTATGG + Intronic
1192914532 X:75638300-75638322 TTGTGTACCTAGGAGGACTGTGG + Intergenic
1192968186 X:76202397-76202419 TGATGTACCTAGAAAGATTATGG + Intergenic
1192970276 X:76221305-76221327 TTGTGTACCTAGGAAGATTATGG + Intergenic
1192979055 X:76319169-76319191 TTGTGTACCTAGGAGGATTATGG + Intergenic
1192995140 X:76505484-76505506 TTCTGTAGCTAGGAGGATTATGG + Intergenic
1193062737 X:77223467-77223489 CCGTGTACTTAGGAGGATTACGG - Intergenic
1193076997 X:77364940-77364962 TTGTGTACCTAGGAGGATTATGG - Intergenic
1193154585 X:78158835-78158857 TTGTGTACCTAGGAGGATTAGGG - Intergenic
1193156843 X:78183270-78183292 TTGTGTACCTAGGAGGATTATGG - Intergenic
1193371053 X:80697652-80697674 CTGTGTACCTATAAAAATTGAGG - Intronic
1193578503 X:83232765-83232787 TTGTGTACCTAGGAGAATTATGG - Intergenic
1193680984 X:84518690-84518712 TTATGTTCCTAGGAGGATTATGG + Intergenic
1193786017 X:85760551-85760573 TTGTGTACCTTGGAGGATTATGG + Intergenic
1193826320 X:86231494-86231516 TTGTGTACCTAGGAGGATTATGG + Intronic
1193937609 X:87641813-87641835 CTGTGTACCTAGGAGGATTATGG - Intronic
1194237192 X:91399204-91399226 TTATGTTCCTAGGAGGATTATGG - Intergenic
1194466219 X:94237734-94237756 TTGTGTGCCTAGGAGGATTATGG + Intergenic
1194543478 X:95203541-95203563 CTGTGTACTTGGGAGGATTATGG + Intergenic
1194926928 X:99836571-99836593 TTGTGTACCTAGGAGGATTATGG + Intergenic
1194932154 X:99901410-99901432 CTATGTTCCTAGGAGGATTATGG + Intergenic
1195019486 X:100812479-100812501 TTGTGCACCTAGGAGGATTATGG + Intergenic
1195075859 X:101326647-101326669 TTATGATCCTAGAAGGATTATGG - Intergenic
1195795443 X:108642159-108642181 TTGTGTACCTAGGAGGATTATGG - Intronic
1196170889 X:112587528-112587550 TTGTGTACCTAGAAGGATTATGG - Intergenic
1196225192 X:113157932-113157954 TTATGTTCCTAGAAGGATTATGG + Intergenic
1196235469 X:113274551-113274573 TTTTGTGCCTAGGAGGATTATGG - Intergenic
1196464813 X:115960826-115960848 CTGTGTACCTAGGAAGATTATGG - Intergenic
1196518598 X:116644247-116644269 CTGAGTAACTAGGTGGATTATGG - Intergenic
1196675755 X:118418903-118418925 TTGCGTACCTAGGAAGATTATGG + Intronic
1196737475 X:118992442-118992464 TTGTGTACCTAGGAGGATTATGG - Intronic
1197066247 X:122237321-122237343 TTGTGTACCTAGGAGGATTATGG + Intergenic
1197132391 X:123020088-123020110 TTGTGTACCTAGGAGGAATATGG - Intergenic
1197518903 X:127473096-127473118 TTGTGTACCTGGGAGGATTATGG - Intergenic
1197671665 X:129284445-129284467 TTGTGTACCTAGGAGGATTATGG + Intergenic
1198526781 X:137509330-137509352 TTGTGTACCTAGAAGGACTATGG + Intergenic
1198843232 X:140880969-140880991 TTGCGTACCTAGGAGGATTATGG - Intergenic
1199057868 X:143319135-143319157 TTGTATACCTAGGAGGATTATGG + Intergenic
1199521521 X:148741356-148741378 TTATGTACCTAGGAGTATTATGG + Intronic
1199668512 X:150121207-150121229 TTGTGTACCTAGGAGGATTATGG - Intergenic
1201306688 Y:12556592-12556614 TTGTGTACCTAGCTGGATTATGG - Intergenic
1201315796 Y:12644140-12644162 TTGTGTACCCAGGAGGATTGTGG - Intergenic