ID: 1126462378

View in Genome Browser
Species Human (GRCh38)
Location 15:48927540-48927562
Sequence ATGCCAGGGGTTTCATGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 165}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126462378_1126462384 22 Left 1126462378 15:48927540-48927562 CCACCACATGAAACCCCTGGCAT 0: 1
1: 0
2: 0
3: 19
4: 165
Right 1126462384 15:48927585-48927607 ACTATAAACCCCTAGACCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 88
1126462378_1126462383 21 Left 1126462378 15:48927540-48927562 CCACCACATGAAACCCCTGGCAT 0: 1
1: 0
2: 0
3: 19
4: 165
Right 1126462383 15:48927584-48927606 TACTATAAACCCCTAGACCCTGG 0: 1
1: 0
2: 0
3: 8
4: 61
1126462378_1126462385 23 Left 1126462378 15:48927540-48927562 CCACCACATGAAACCCCTGGCAT 0: 1
1: 0
2: 0
3: 19
4: 165
Right 1126462385 15:48927586-48927608 CTATAAACCCCTAGACCCTGGGG 0: 1
1: 0
2: 0
3: 11
4: 85
1126462378_1126462387 30 Left 1126462378 15:48927540-48927562 CCACCACATGAAACCCCTGGCAT 0: 1
1: 0
2: 0
3: 19
4: 165
Right 1126462387 15:48927593-48927615 CCCCTAGACCCTGGGGTTCCTGG 0: 1
1: 0
2: 0
3: 35
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126462378 Original CRISPR ATGCCAGGGGTTTCATGTGG TGG (reversed) Intronic
900962933 1:5937194-5937216 ACACCAGGGGTTTCCTGGGGAGG + Intronic
901150375 1:7097278-7097300 AGGCCAGGGCTTTGATGGGGTGG + Intronic
901823318 1:11844360-11844382 ATGGCAGGGGGTTGAGGTGGGGG - Intergenic
902483178 1:16723224-16723246 AGCCCTGGGGTTTCATTTGGGGG - Intergenic
902692379 1:18117981-18118003 ATGCCAGGCTCTTCAGGTGGTGG - Intronic
903414253 1:23170752-23170774 ATGACAGGGGCCTGATGTGGTGG - Intronic
909060757 1:70876565-70876587 CTTCCAGGGTTTTCATGTTGTGG + Intronic
913612984 1:120526569-120526591 AGCCCTGGGGTTTCATTTGGGGG - Intergenic
914578203 1:148995680-148995702 AGCCCTGGGGTTTCATTTGGGGG + Intronic
914931014 1:151933221-151933243 ATGCAAGGGTTTTCATGGAGGGG + Intergenic
917212516 1:172644833-172644855 ATGGCAGGGGTTTGGGGTGGAGG - Intergenic
918419156 1:184344798-184344820 GTGCCTGGGATTTCATGTGATGG + Intergenic
920225548 1:204436135-204436157 ATTTCAGGGGTTTCATGTGTAGG + Intronic
920415023 1:205793400-205793422 ATGCCAGGGGTCTGTGGTGGAGG - Intronic
923622927 1:235592656-235592678 AAGCCAGGGGTTACAGGTCGTGG - Intronic
924828017 1:247562350-247562372 GTGCCAGAGGATGCATGTGGTGG + Intronic
1063460675 10:6213205-6213227 ATGCCAGGGGCTTCAGGATGGGG + Intronic
1065537293 10:26727646-26727668 AGGCCAGGTGTGGCATGTGGTGG - Intronic
1065935241 10:30515307-30515329 ATGCCATGGGCTTACTGTGGAGG + Intergenic
1068752848 10:60615603-60615625 ATGCCAGCATTTTCATGCGGAGG - Intronic
1070024055 10:72614746-72614768 ATGCCAGAGGTTTCAGGGAGAGG + Intronic
1073572325 10:104591008-104591030 CTGCCAGGGGTTGCACGTTGAGG - Intergenic
1073728883 10:106267876-106267898 ATGCAAGGGGTTCAGTGTGGTGG + Intergenic
1074845086 10:117390734-117390756 GTACCAGTGGTTTCTTGTGGGGG + Intergenic
1076720417 10:132389951-132389973 ATGCCAGGTTCTGCATGTGGAGG + Intergenic
1085041765 11:73330976-73330998 AGGCCAGGGGTTTCTAGGGGTGG + Intronic
1085754785 11:79193377-79193399 ATTTTAGGGGTTTCATGTGGTGG + Intronic
1088848987 11:113690215-113690237 ATGCCAGGTGTGGCCTGTGGTGG - Exonic
1089158061 11:116417136-116417158 ATTCCAGGGGTTTCATTAGATGG - Intergenic
1089625549 11:119748668-119748690 ACCCCATGGGTTTCAGGTGGCGG + Intergenic
1090360264 11:126167360-126167382 AACCCACGGGATTCATGTGGAGG - Intergenic
1091357704 11:134950447-134950469 AGGCCTGGGGTTTCAGGTGAGGG + Intergenic
1092657642 12:10703905-10703927 ATGCCAGAGTTTTCAGGTGGTGG - Intronic
1093866124 12:24229250-24229272 ATGCCAGGGGGCTAATGTGGCGG + Intergenic
1095136896 12:38615735-38615757 ATGACAGGGTTTTTATGAGGGGG - Intergenic
1096429274 12:51529984-51530006 TGTCCAGGGGTTTTATGTGGTGG - Intergenic
1097107290 12:56633296-56633318 ATGCCAGGAGTATCTGGTGGGGG - Intronic
1097684782 12:62681036-62681058 ATTCCATGGGTTTGATGTGGGGG + Intronic
1099823446 12:87744995-87745017 ATGCCAGCTTTTTCATATGGTGG - Intergenic
1102684743 12:114715948-114715970 ATGCCAGGGGCTGGATGTGGTGG + Intergenic
1103022143 12:117542589-117542611 GTGCCAGGGGTTAAATATGGGGG - Intronic
1103904268 12:124319464-124319486 AGCCCAGGGGTTTCTGGTGGGGG - Intergenic
1107680179 13:42839858-42839880 ATGTCAGAGGTTCCATGTTGGGG + Intergenic
1108819615 13:54332232-54332254 TTGCCAGGGGTTCCACATGGAGG + Intergenic
1110553730 13:76835215-76835237 TTACCAGGGTCTTCATGTGGTGG + Intergenic
1114486292 14:23064227-23064249 CCGCCAGGGGTTTGATGTCGGGG + Exonic
1114541083 14:23459429-23459451 ATGCCATGAGTTTAATTTGGGGG - Intergenic
1116164634 14:41318818-41318840 ATGCCAAGGGATTCCAGTGGAGG - Intergenic
1121172215 14:91864081-91864103 ATGCCAGGGGATCCATTTGGTGG + Intronic
1122518635 14:102326816-102326838 ATGCCAGCGGATCCATGTGAGGG + Exonic
1122770817 14:104096887-104096909 AGGCCAGGGTTTTCAGGAGGAGG - Intronic
1202854498 14_GL000225v1_random:42414-42436 ATCCCACGGGTTTCCTGTAGTGG + Intergenic
1124530538 15:30501729-30501751 ATGACAGGGGTTTCATGCACTGG + Intergenic
1124768121 15:32505969-32505991 ATGACAGGGGTTTCATGCACTGG - Intergenic
1125267513 15:37900397-37900419 ATTCTAGGGGTTGCATGTTGAGG - Intergenic
1125922689 15:43534940-43534962 ATGCCAGGGGGTCTCTGTGGAGG - Exonic
1126462378 15:48927540-48927562 ATGCCAGGGGTTTCATGTGGTGG - Intronic
1126681487 15:51206405-51206427 AAGCTAGGGGTTTGGTGTGGAGG - Intergenic
1127996926 15:64158558-64158580 GTGCCAGGGGAGTCATGTGGTGG - Intronic
1130925499 15:88382822-88382844 ATGCCAGGTGTTTAGTGTAGAGG + Intergenic
1135274022 16:21095524-21095546 TTGCCAGGGGTTACAACTGGGGG + Intronic
1138345188 16:56316252-56316274 ATGCCAGGCCTTCCATGTGTTGG - Intronic
1138677969 16:58665636-58665658 ATGCTAGGGGCTCCAGGTGGAGG + Exonic
1141697147 16:85625504-85625526 ATCCCAGGGGTGTCACCTGGGGG - Intronic
1142081034 16:88148863-88148885 GTGCCGGGGGGTTCATGTGTGGG + Intergenic
1144607331 17:16678488-16678510 ATGCCAGGGTATCCATTTGGTGG - Intergenic
1150510767 17:65750587-65750609 GTGCCAAGGCTTTTATGTGGAGG + Intronic
1153488377 18:5625043-5625065 TTGCCATGGGTTTCCTGTTGGGG + Intronic
1153790179 18:8571659-8571681 GAGCCAGGGGTTCCCTGTGGAGG - Intergenic
1154447521 18:14447710-14447732 ATGTCAGGGATTTCAAATGGAGG - Intergenic
1154497202 18:14970707-14970729 ATGCCTGGGGTTTCAGGTGAGGG - Intergenic
1157136944 18:45065314-45065336 ATGCCAGGTGTTTGATGTCTTGG - Exonic
1157481161 18:48054657-48054679 ATGCCAGGCGGTTCTCGTGGTGG - Intronic
1159049498 18:63406193-63406215 GTGCCAGTAGTTTCAGGTGGTGG + Intronic
1161411735 19:4121652-4121674 GTTCCAGGGGGTTCATGTTGTGG - Intronic
1163829658 19:19541557-19541579 ATGCCAGGGGGCTCTTGTGCAGG + Intronic
1164774475 19:30842308-30842330 CTTCCAGGGGTCTCATGTGAAGG + Intergenic
1165130350 19:33628198-33628220 ATGCAAAGGGCTTCCTGTGGAGG + Intronic
1166732132 19:45064924-45064946 CTGTCAGGGGTTCCAGGTGGAGG + Intronic
1167832826 19:52040353-52040375 ATGGGAAGGGTTTCTTGTGGAGG + Intronic
1168290914 19:55357116-55357138 AGGCCAGGGGTCTAGTGTGGAGG - Intronic
926374550 2:12213476-12213498 CTGGCAGGGCTTTTATGTGGAGG - Intergenic
927083698 2:19654333-19654355 ATGCCAGGGAATGAATGTGGGGG - Intergenic
927162013 2:20273152-20273174 AAGTCAGTGTTTTCATGTGGAGG + Intronic
933110433 2:78393468-78393490 CTGTCAGGGGTTGCATTTGGGGG - Intergenic
934496293 2:94803587-94803609 ATGCCAGGGTTTTCTTCTGAGGG - Intergenic
934960040 2:98665040-98665062 ATGCCAGGGGCTGGGTGTGGTGG + Intronic
937029547 2:118726836-118726858 ATTCCAGGGGGTTCATCTGGAGG - Intergenic
937333813 2:121048275-121048297 ATGCCAGGGGTAGCATGGGATGG + Intergenic
938615390 2:132992504-132992526 AAGCCAGGTGTTACATGTGATGG + Intronic
939027561 2:137032126-137032148 ATGCCATGGGTTGGGTGTGGTGG - Intronic
941903783 2:170702073-170702095 ATGCCAGGGGATCCATTTTGTGG + Intergenic
944445497 2:199784511-199784533 ATGCCAGAGGTTTATTGGGGAGG + Intronic
947531244 2:230909918-230909940 GTTCCAGGGTTTTGATGTGGTGG - Exonic
948931401 2:241134798-241134820 GTGGCAGGGGTGTCAGGTGGGGG - Intronic
1170338864 20:15301016-15301038 CTGCCAGTGGTGCCATGTGGGGG - Intronic
1175910011 20:62400645-62400667 ATGCCTGGGACTTCATTTGGAGG + Intronic
1180927256 22:19564683-19564705 TTGCCAGGGGTTGCATTTGAGGG - Intergenic
949486913 3:4548679-4548701 AAGTCAGGAGTTTCATTTGGGGG + Intronic
950223969 3:11218500-11218522 AGGACAGTGGTTTCTTGTGGGGG + Intronic
950470792 3:13185043-13185065 ATGCCAGGGGTTTCAGATTCGGG + Intergenic
950675564 3:14552232-14552254 ATGCCAGGAGCTGGATGTGGTGG + Intergenic
951274844 3:20672573-20672595 ATGCCAGTGGATTCATTTGGTGG - Intergenic
953481241 3:43254228-43254250 AAGCCAGGGGTTTCTTGCAGAGG - Intergenic
953556758 3:43952221-43952243 ATGGCAGGGTTTTACTGTGGAGG - Intergenic
954602170 3:51878290-51878312 GTGCCAGGGGCTGCATGTGAGGG - Intergenic
954608077 3:51929140-51929162 GTGCCAGGGGCTGCATGTGAGGG - Intergenic
956420395 3:69080709-69080731 ATGCCAGAGCTTTCCTCTGGGGG + Intergenic
960185490 3:114632863-114632885 ATGTCAGGGTTTCCAAGTGGAGG + Intronic
962688016 3:137866155-137866177 ATGCCAGTGGATCCATTTGGTGG - Intergenic
964211333 3:154231792-154231814 CTGACATGGGTTTCATGAGGAGG - Intronic
964293616 3:155209482-155209504 ATGTTAGGGGTTTGGTGTGGTGG - Intergenic
966318757 3:178677587-178677609 AGGCCAGGGGTTTTAGGAGGAGG - Intronic
967092532 3:186147447-186147469 ATGACTGTGGTTTCTTGTGGTGG - Exonic
968968483 4:3781447-3781469 AGGGGAGGAGTTTCATGTGGCGG - Intergenic
968968529 4:3781647-3781669 AGGGGAGGGGTTTCATGTGGGGG - Intergenic
970033476 4:11704322-11704344 ATGCCAGAGGTTACAAGTAGTGG - Intergenic
974461303 4:62191637-62191659 ATGCCAGATGTTTCTTGTGCGGG + Intergenic
974640948 4:64629953-64629975 TGCTCAGGGGTTTCATGTGGTGG + Intergenic
977572087 4:98639197-98639219 GTAGCAGGGGGTTCATGTGGAGG - Intronic
979950907 4:126892405-126892427 ATACCAGGGGGTACATGTGCAGG + Intergenic
982687519 4:158508923-158508945 TTGCCAGGGGTTAAAGGTGGGGG + Intronic
984249334 4:177312650-177312672 ATGCCAGGCTTTTTATGTGTGGG - Intronic
986725545 5:10593820-10593842 ATGGCAGAGGGTTCATGAGGGGG - Intronic
988229311 5:28453574-28453596 ATGCCTGGGCTGTCATCTGGAGG + Intergenic
989013443 5:36900967-36900989 ATTCCAGGGGGTACATGTGCAGG + Intronic
994047324 5:95324846-95324868 CTGCCAAGACTTTCATGTGGGGG + Intergenic
995189151 5:109302375-109302397 TGGCCAGGGGTATGATGTGGAGG - Intergenic
995323478 5:110863767-110863789 ATGCCAAGGGTTTTAAGAGGTGG - Intergenic
996125053 5:119716099-119716121 ATGCAGGAAGTTTCATGTGGAGG + Intergenic
997175512 5:131772230-131772252 TTGCCAGGGGCTCGATGTGGGGG + Intronic
998547474 5:143042627-143042649 AAGCCAGGGCTTCCATGGGGAGG - Intronic
1001009878 5:168087714-168087736 AAGACAGGGGTTTCATCTGCAGG - Intronic
1002890611 6:1328240-1328262 CAGCCAGGGGTTGCATGTGCAGG - Intergenic
1002908360 6:1469168-1469190 ATGCCAGGTGTTACCTGTGGTGG - Intergenic
1003148655 6:3530351-3530373 ATCCCAGGCTTTTCAGGTGGTGG - Intergenic
1005820180 6:29592150-29592172 ATGCCAGCAGATTCATTTGGTGG - Intronic
1006756690 6:36422383-36422405 ATGTCAGGGGTTGCATCTTGAGG + Intronic
1009901474 6:69812464-69812486 ATGCCAGGGAATCCATTTGGTGG + Intergenic
1011701593 6:89960219-89960241 ATGCCAGGTGTTTCAAATAGAGG - Intronic
1014218269 6:118774094-118774116 TTACCAGGGGTTGCATGTTGGGG + Intergenic
1015689951 6:135910785-135910807 TTGCCAGGGGTTAGATGCGGGGG - Intronic
1017678745 6:156842232-156842254 AATCCAGGGGTCTCATCTGGGGG - Intronic
1019288724 7:236692-236714 ATGGTCGGGGTTTCATGCGGAGG + Intronic
1019288764 7:236818-236840 ATGGTCGGGGTTTCATGCGGAGG + Intronic
1019687313 7:2388904-2388926 ATCCCAGGGGTTCCAGGAGGAGG + Intergenic
1019687336 7:2388992-2389014 ATCCCAGGGGTTCCAGGAGGAGG + Intergenic
1019687408 7:2389242-2389264 ATCCCAGGGGTTCCAGGAGGAGG + Intergenic
1021634981 7:22683153-22683175 ATGACAGTGGTTACATGTGGAGG + Intergenic
1023282462 7:38585160-38585182 ATGCCATGGGGTTCTTGTGAGGG - Intronic
1023937925 7:44752523-44752545 TTGCCAGGGGTTAAATGTGGGGG - Intronic
1024228560 7:47346721-47346743 ACACCAGGGGTGGCATGTGGGGG - Intronic
1024709799 7:52002730-52002752 ATGCCAGTGGGTTCATTTGATGG + Intergenic
1028077960 7:86537880-86537902 ATGCCAGGGGATCCACTTGGTGG + Intergenic
1028815855 7:95143634-95143656 CTGCCAGGGGTTTCATAAGGAGG - Intronic
1031154928 7:118098579-118098601 ATGCTAGCTGTTTCATGTGTTGG + Intergenic
1031797393 7:126193340-126193362 ATACCACGGGTGGCATGTGGTGG + Intergenic
1036488578 8:9202404-9202426 GTGCCAGCGGATTCATTTGGTGG - Intergenic
1036754166 8:11461405-11461427 AAGCCCTGGGTCTCATGTGGCGG - Intronic
1036998963 8:13695167-13695189 ATGCCATGGCTTTACTGTGGAGG + Intergenic
1038227070 8:25667383-25667405 GTGCCAGGGGATTCATTTAGTGG + Intergenic
1039378270 8:37059459-37059481 CTGCCAGGGGATTGATGGGGAGG + Intergenic
1041116629 8:54545181-54545203 ATGCCTGGAGTTTCCTGTGTGGG + Intergenic
1042068311 8:64902994-64903016 AAGCCAGTGGTATCATGTGAAGG - Intergenic
1043553168 8:81398386-81398408 GTGACAGGGGATTCATGGGGTGG + Intergenic
1052523897 9:29587371-29587393 TTGCCAGGGGTTGGAGGTGGTGG + Intergenic
1053288696 9:36866018-36866040 ATGACAGGGATTTCAGGTTGGGG + Intronic
1055650328 9:78400536-78400558 GTGCCAGTGGATTCATTTGGTGG - Intergenic
1057662053 9:97012622-97012644 GTGTCAGTGGTTTCATGTGGTGG - Intronic
1057814540 9:98284979-98285001 TTGCCAGGGGTTTCAGATGTGGG + Intergenic
1059980929 9:119771129-119771151 ATGTCAGGGATTTCATGAGTTGG - Intergenic
1185876651 X:3707355-3707377 GTGCCTGGGGTTTCCTGAGGTGG - Intronic
1188049658 X:25469080-25469102 CTGCCAGGGAATTCAAGTGGGGG + Intergenic
1188383363 X:29525848-29525870 ATGTCAGGGGCTTCATGTGTGGG - Intronic
1188827803 X:34857870-34857892 ATGGCAGTGATGTCATGTGGGGG + Intergenic
1189120245 X:38386462-38386484 TTGCCAGGGGTTGGAGGTGGGGG - Intronic
1190399398 X:50016741-50016763 TTGCCAGGGGTTTAGGGTGGGGG - Intronic
1191258659 X:58290978-58291000 AAGCCAGGGGTTTCCGGTGGAGG - Intergenic
1192106573 X:68322997-68323019 TTGCCAGAGGATACATGTGGTGG + Intronic
1196062114 X:111420312-111420334 GTGCCAGGGGTTAGGTGTGGAGG + Intergenic
1196270552 X:113705358-113705380 TTGCCAGGGGTTTCAGGGGAGGG - Intergenic
1196314767 X:114209971-114209993 ATGCCAGAGGATCCATTTGGTGG - Intergenic
1198717536 X:139574900-139574922 ATGCCAGTGGTATCATCTGATGG - Intergenic
1200016045 X:153164604-153164626 GGACCAGGGGTTTCATGTGAAGG + Intergenic
1200788708 Y:7281048-7281070 ATGCCTGGGATTTCCTGAGGTGG + Intergenic