ID: 1126463936

View in Genome Browser
Species Human (GRCh38)
Location 15:48943491-48943513
Sequence AAGTATCCACTGATGGATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 188}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126463936_1126463941 28 Left 1126463936 15:48943491-48943513 CCTTTATCCATCAGTGGATACTT 0: 1
1: 0
2: 1
3: 26
4: 188
Right 1126463941 15:48943542-48943564 AATAATGCTACAATGAACACGGG 0: 5
1: 99
2: 758
3: 2298
4: 4253
1126463936_1126463943 30 Left 1126463936 15:48943491-48943513 CCTTTATCCATCAGTGGATACTT 0: 1
1: 0
2: 1
3: 26
4: 188
Right 1126463943 15:48943544-48943566 TAATGCTACAATGAACACGGGGG 0: 1
1: 4
2: 50
3: 189
4: 510
1126463936_1126463940 27 Left 1126463936 15:48943491-48943513 CCTTTATCCATCAGTGGATACTT 0: 1
1: 0
2: 1
3: 26
4: 188
Right 1126463940 15:48943541-48943563 GAATAATGCTACAATGAACACGG 0: 30
1: 489
2: 1641
3: 3153
4: 3912
1126463936_1126463942 29 Left 1126463936 15:48943491-48943513 CCTTTATCCATCAGTGGATACTT 0: 1
1: 0
2: 1
3: 26
4: 188
Right 1126463942 15:48943543-48943565 ATAATGCTACAATGAACACGGGG 0: 1
1: 4
2: 66
3: 274
4: 706

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126463936 Original CRISPR AAGTATCCACTGATGGATAA AGG (reversed) Intronic
906941277 1:50257700-50257722 AAGTGTGCCCTGATGGCTAAGGG + Intergenic
907764135 1:57391717-57391739 AAGAATGCACAGATGGATTAGGG - Intronic
911611470 1:99962920-99962942 AAATGTCTACTGATGGATGAAGG + Intergenic
913484689 1:119323236-119323258 AAGAGTCCACTGGTGGGTAATGG + Intergenic
914684228 1:149964283-149964305 TTGTATGCACTGATGGAGAAGGG - Exonic
916378635 1:164183938-164183960 ACATATCCACTGTTGGAGAATGG - Intergenic
916660325 1:166917496-166917518 AAGAAACCACTGCTGGATTAAGG + Exonic
919514269 1:198502123-198502145 AAATGTCCATTGGTGGATAAAGG - Intergenic
919598865 1:199598748-199598770 ACTTATCCACTGATGGACACAGG - Intergenic
919873562 1:201843478-201843500 AAGTAGCTCCTGAAGGATAAAGG - Intronic
921220627 1:212971186-212971208 AAATATCCATCGATGGATAAAGG - Intronic
921740272 1:218676713-218676735 AACTACCCACTGATGCAAAATGG - Intergenic
923188476 1:231596946-231596968 AAGTATCCATTCAGGGATAGAGG + Intronic
1063433680 10:6013390-6013412 AAGTATCCACAGGTGGCTAGTGG + Intronic
1063477195 10:6339685-6339707 CAGTGTCCACTGATGGAGAATGG + Intergenic
1065229514 10:23582943-23582965 TGGTACCCACTGATGGAGAAAGG + Intergenic
1065858587 10:29851067-29851089 ATGAATCCACTGAGAGATAATGG + Intergenic
1068453663 10:57227371-57227393 AAGTGTCCATTAATAGATAATGG - Intergenic
1069037282 10:63658548-63658570 AAGTCTTCACTGAAGGTTAAGGG + Intergenic
1069598563 10:69688368-69688390 ATGAATCCATTCATGGATAAAGG + Intronic
1070070951 10:73088678-73088700 AAGTATCCACTGTTGGACACTGG - Intronic
1073154028 10:101332359-101332381 CATTATCCACTGAAGGCTAAAGG - Intergenic
1074484699 10:113863985-113864007 AAGTGTCCATTGATGGATCGTGG + Intronic
1075227103 10:120639550-120639572 AAGTATCCACTGCAGGACAGAGG + Intergenic
1076910884 10:133388762-133388784 AAGGAACCACTGATGGAGCAGGG - Intronic
1079430422 11:20384494-20384516 CAGTATACACTGGAGGATAAAGG + Intergenic
1080727615 11:34914086-34914108 AAGTATCTACTGAGGCCTAAAGG - Intronic
1081283521 11:41240624-41240646 AAGAATCCACTTATGCAAAACGG - Intronic
1081654932 11:44850878-44850900 AAGTGCCCACAGATGGGTAAAGG - Intronic
1082190676 11:49239541-49239563 AAGTGTCCACTGACGATTAATGG + Intergenic
1084082840 11:66840244-66840266 GAGTAGCCACTGAGGGACAAAGG - Intronic
1085188498 11:74596990-74597012 AAATGTCCATTAATGGATAAAGG - Intronic
1086675447 11:89601377-89601399 AAGTGTCCACTGATGATTAATGG - Intergenic
1088141497 11:106622179-106622201 ATCTATCTAATGATGGATAAAGG + Intergenic
1089676038 11:120090394-120090416 CAGTATCCAAGGATGGGTAATGG + Intergenic
1090429434 11:126633778-126633800 AAACATACACTGATGGATGATGG - Intronic
1094651553 12:32382845-32382867 AATTATTCAATGATAGATAATGG + Intronic
1095621990 12:44267890-44267912 AAATGTCCACTGATGAATAATGG - Intronic
1099039036 12:77627778-77627800 AAGTATCCATTAATGGATGAAGG + Intergenic
1099745787 12:86702869-86702891 GAGAATCCACTGATAGATCAAGG + Intronic
1099977494 12:89561222-89561244 ATGTATCCACTCCTGGAGAAAGG - Intergenic
1100351818 12:93791269-93791291 AAGTGTCCATTAATGGATGAAGG + Intronic
1102698693 12:114820010-114820032 ACGTGTCCATTGATGGATAATGG - Intergenic
1102744336 12:115237133-115237155 CAGAATCCATTGATGGAGAACGG + Intergenic
1104176523 12:126338341-126338363 CTGTATCCACTGATGGTTATCGG + Intergenic
1108935893 13:55879381-55879403 AAATAGCCAGAGATGGATAAAGG - Intergenic
1109458268 13:62622899-62622921 AAGTGTCCATCCATGGATAAAGG + Intergenic
1110120789 13:71879094-71879116 AAATATCCTCTGTTGTATAAAGG + Intergenic
1113290787 13:108903415-108903437 ATGTATCCACTGAAGGTAAAGGG + Intronic
1116031721 14:39581014-39581036 AAGTAACTACTGATTGTTAATGG + Intergenic
1117381784 14:55171715-55171737 AAGTGTCCACTGACAGACAAAGG + Intronic
1118226018 14:63900028-63900050 CAGTATCCACTGCTGTAGAATGG - Intronic
1119739789 14:77006907-77006929 TAGTATCCACTGATGGGTGCTGG + Intergenic
1119791381 14:77353128-77353150 AAGTAGCATCTGATGGTTAAGGG - Intronic
1120120251 14:80670327-80670349 AATCATCCATTGATGGATACAGG - Intronic
1121136726 14:91505841-91505863 AATTATCCTATGATGGAGAATGG + Intronic
1124428454 15:29584394-29584416 AATCATCCATTGATGGATGAAGG + Intergenic
1126463936 15:48943491-48943513 AAGTATCCACTGATGGATAAAGG - Intronic
1126630907 15:50734244-50734266 AAGTGTCCACCAGTGGATAAAGG + Intronic
1127193275 15:56555728-56555750 AAATGTCCATGGATGGATAAAGG - Intergenic
1127316128 15:57795757-57795779 TAGAAACCTCTGATGGATAAAGG - Intergenic
1127503313 15:59574891-59574913 ACGTAGCCCCTGGTGGATAAAGG - Intergenic
1128714192 15:69895119-69895141 AACCATCCACTGATAGATGATGG + Intergenic
1129609752 15:77043840-77043862 AAGTACCCACTGAGGTATTAGGG + Exonic
1130074138 15:80674272-80674294 AAGTAGCTCCTGAAGGATAAAGG + Intergenic
1130548643 15:84874852-84874874 AAGTATCCAGTGATGTACAAAGG + Intergenic
1131018912 15:89081381-89081403 AAATGTCCATTGATGGATGAAGG - Intergenic
1133440520 16:5817340-5817362 AAGCAGGTACTGATGGATAACGG + Intergenic
1133466924 16:6036273-6036295 AAGTAACTTCTGATGTATAAAGG + Intronic
1134467042 16:14488407-14488429 AAGTGTCTTCTGATGGACAAAGG - Intronic
1137700203 16:50492169-50492191 AAGTGGCCACCAATGGATAATGG - Intergenic
1138114046 16:54346087-54346109 GAGTAACCACTGATGGATATGGG - Intergenic
1150527718 17:65940487-65940509 ATGTATCCATTGAAGGATAAAGG + Intronic
1154282723 18:13020468-13020490 AAGTGTCCACAGAAGGATGAGGG - Intronic
1155992546 18:32294200-32294222 AAATATACACTGATGTATTAAGG + Intronic
1158664246 18:59418193-59418215 TAGTATCTACTGTGGGATAAGGG - Intergenic
1160625105 18:80198735-80198757 AAGTATTCACATATGGAGAATGG + Intronic
1161911288 19:7196257-7196279 AAATATCCACTGAAGAATTAAGG + Intronic
1161987798 19:7666870-7666892 AAGTGTCCATCGATGGATGAAGG + Intergenic
1165680782 19:37773030-37773052 AAGTATTAAGTGATGGAAAATGG - Intronic
1165703381 19:37955796-37955818 AAGTATCCATTAACGAATAATGG - Intronic
926219189 2:10923914-10923936 AAGTACCCAGTGTTGGAGAAAGG + Intergenic
927336882 2:21935383-21935405 GAGTATTCACTCAAGGATAAGGG - Intergenic
928135480 2:28684609-28684631 AAGCAGCCACTGATGGTTGAGGG - Intergenic
928548035 2:32346294-32346316 AAGTATCCATCGATGGCTGATGG - Intergenic
929063945 2:37953581-37953603 AATTGTCCACTGGTGGATAAAGG - Intronic
929278675 2:40053975-40053997 CATTATCCATTGATGGACAATGG - Intergenic
929571241 2:43024431-43024453 AAGTGTCCACTGATAGAACAGGG + Intergenic
929701720 2:44168644-44168666 AAGTAGCCACTGATGCCCAATGG + Intronic
931989731 2:67777911-67777933 AAGAATCCACCGAAGGATCATGG + Intergenic
932791898 2:74661105-74661127 AAGTATCAAATGGTGCATAAGGG + Intronic
932995676 2:76849076-76849098 AAGTGTCCCCTGAAGTATAATGG + Intronic
935976977 2:108587720-108587742 AAGTTTCCACTGGAGAATAAAGG - Intronic
936434254 2:112489980-112490002 CAGTATTCACTGATGGAGAAGGG - Intronic
938548285 2:132354166-132354188 TAGTATCCTTTGATGCATAAAGG + Intergenic
938867416 2:135437411-135437433 AAGTATCCAATGATGTACAAAGG + Intronic
939052706 2:137327599-137327621 AAATATTTAATGATGGATAAAGG - Intronic
941435590 2:165467250-165467272 AAGCATTCATTGATGGACAAGGG - Intergenic
941618109 2:167745793-167745815 ATGCATCCACAGATAGATAATGG - Intergenic
942170122 2:173282027-173282049 AAGTTGCCACTGATGGCTGAGGG + Intergenic
942308397 2:174631217-174631239 AAATGTCCACTGATGAATGAAGG + Intronic
943245683 2:185448015-185448037 TATTATCCATTGATGGATACTGG + Intergenic
944887519 2:204078973-204078995 AATTATCAACTGCTGGATCAAGG - Intergenic
946251616 2:218417586-218417608 ATGTATCCCCCGTTGGATAAGGG + Intergenic
946767826 2:223056419-223056441 AAGTACCAACTGATGGATCAGGG - Intronic
946942473 2:224784114-224784136 AAGTCTCCAGAGATGGAGAAAGG - Intronic
1169764009 20:9129062-9129084 AAGTGTCCATTGATGGATGAGGG - Intronic
1171877161 20:30586942-30586964 TAGTATCCTTTGATGCATAAAGG + Intergenic
1174026113 20:47577106-47577128 TACTATCCACTGATGAACAATGG - Intronic
1174163332 20:48567252-48567274 ATGTATCCCCTGGTGGATAAGGG + Intergenic
1177146076 21:17408414-17408436 AAGTATCCATTAATAGAAAATGG + Intergenic
1177279208 21:18957571-18957593 AAGCATCCTCTGATGGACACAGG + Intergenic
1179279439 21:39921876-39921898 AAGTATCTGCTGATGGACTATGG + Intronic
1180354953 22:11830516-11830538 TAGTATCCTTTGATGCATAAAGG + Intergenic
1180383298 22:12161815-12161837 TAGTATCCTTTGATGCATAAAGG - Intergenic
1180984108 22:19894015-19894037 AAGTGTCCACTGACAGATAATGG + Intronic
1181014166 22:20059276-20059298 AAGTGTCCATTAATGGATAAAGG - Intronic
1181798836 22:25330724-25330746 GAGTAACCACTAATGGATACAGG - Intergenic
1183705582 22:39473340-39473362 AAGTATCCACACATGGAGACGGG + Intronic
1183814702 22:40289982-40290004 AAGGATCCGCTTTTGGATAAAGG - Intronic
950615452 3:14154399-14154421 AAGTGCCCATTGATGGATGAAGG + Intronic
951060056 3:18195396-18195418 AAGTGTCCACTGAGGAATGAAGG - Intronic
951218607 3:20046654-20046676 AAGCATCCTCTGTTGGCTAAGGG + Intronic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
955917919 3:63925236-63925258 AAGTATCCAGTCAAGGATACAGG + Intronic
956651041 3:71505073-71505095 TAGTATTCACTGGTGGTTAAGGG - Intronic
957369037 3:79267063-79267085 AAATATCCACATATGGATAGTGG - Intronic
958754354 3:98233168-98233190 TAGTATTCACTGAAGGAAAAAGG - Intergenic
959641940 3:108648707-108648729 AAATAATCACTGATGAATAAAGG - Intronic
960908465 3:122624824-122624846 AAGTATACAATTATGTATAATGG - Intronic
960996077 3:123341219-123341241 AAGTGTCCATTGATGGACACTGG - Intronic
961610035 3:128129623-128129645 AAGCATCCATTGACAGATAATGG + Intronic
963016340 3:140827888-140827910 ATGTCTCCACTGATAGTTAAAGG + Intergenic
963822682 3:149915597-149915619 AAGTGTACATTGATGGATGAAGG + Intronic
964192452 3:154019265-154019287 TAGGATCCACTGATGGATTCAGG - Intergenic
964901847 3:161669617-161669639 AAGTATCCAGTTATTTATAAAGG - Intergenic
973373209 4:49270115-49270137 TAGTATCCTTTGATGCATAAAGG - Intergenic
973708818 4:53605812-53605834 AAGTGTCCATTGATAGATGATGG - Intronic
976729371 4:88246337-88246359 AAGGATACACTGATGAACAAAGG - Intergenic
979374962 4:119935590-119935612 AAGTTTCCACTGATTTCTAAAGG - Intergenic
982882272 4:160734535-160734557 AAGTTTCCACTGAGGGTGAATGG - Intergenic
985624028 5:975278-975300 ATTTTTCCACTGATGGAGAAGGG - Intergenic
986185735 5:5435504-5435526 AAGTATTTAGTGATGGAAAAAGG + Intronic
986696759 5:10363964-10363986 AAGTATCCACTAATAGTTACAGG + Intronic
988037485 5:25846458-25846480 AAGTGGCCACTGAGGGATAAAGG + Intergenic
988875639 5:35443221-35443243 ATTTATCCATTGAGGGATAATGG - Intergenic
988919019 5:35923498-35923520 AAATGTCCACCTATGGATAAAGG + Intronic
989214124 5:38885951-38885973 GAGTATGCCCTGAGGGATAAGGG + Intronic
992192482 5:74307138-74307160 AAGTTTCCACTCATGGCAAAAGG - Intergenic
993914358 5:93724677-93724699 AGGCATCCACTGGGGGATAAGGG - Intronic
998847105 5:146321437-146321459 ATGATTCCTCTGATGGATAAGGG + Intronic
998904014 5:146884329-146884351 AATTTTCCTCTGATGGATATGGG - Intronic
1000616549 5:163434086-163434108 AAGTAACCACTGCTATATAAAGG - Intergenic
1001171230 5:169420783-169420805 AAGTGTCCAGTGAGGGATGACGG + Intergenic
1001330223 5:170756747-170756769 AAGTTGTCACTGATGGAGAAAGG - Intergenic
1004532857 6:16470081-16470103 AAGTGCCCACTGATAGATGAAGG + Intronic
1008174502 6:48250784-48250806 AAGTTTCCAATGATGGATCAGGG + Intergenic
1009913893 6:69968152-69968174 AAGTAACCACTGAAGGCAAAAGG - Intronic
1010655275 6:78504411-78504433 AAGGCTCCACAAATGGATAATGG + Intergenic
1012449475 6:99339576-99339598 AAATATCCTCCAATGGATAAAGG + Intronic
1015968743 6:138722101-138722123 AAATACCCACAGATGGATATTGG - Intergenic
1017612304 6:156201566-156201588 AAACATCCACTGATGGATAAAGG + Intergenic
1018964212 6:168471479-168471501 AAGTATCCACGGACAGATGAAGG - Intronic
1022177218 7:27883072-27883094 AAGTGTGCACTGATGGATGTTGG + Intronic
1022180189 7:27911579-27911601 AAGTAGCCACATATGGCTAAGGG + Intronic
1023349956 7:39310592-39310614 AAGTACACACTGATGCGTAATGG - Intronic
1023616791 7:42028433-42028455 AAGCATTCACAGACGGATAAGGG + Intronic
1024713222 7:52041867-52041889 CAGTAATCACTGATAGATAAGGG - Intergenic
1026361485 7:69604833-69604855 ACCTCTCCACTAATGGATAAAGG - Intronic
1028473765 7:91232101-91232123 AAGTATCCACTGAAGTAGATAGG - Intergenic
1029260431 7:99298910-99298932 AAGTATCCGTTGAAGCATAAAGG + Intergenic
1029937385 7:104441468-104441490 AAATATCCATTAATGGATAATGG - Intronic
1030728486 7:112955564-112955586 AAGTATATACTGCTAGATAATGG - Intergenic
1031057515 7:117009810-117009832 AAGTAACCACAGCTGGAAAAAGG - Intronic
1032288439 7:130563003-130563025 AAATAGCCACTGGTGGCTAATGG + Intronic
1033668930 7:143471305-143471327 AACTATCCACTGATGAAAATAGG + Intergenic
1041914062 8:63121860-63121882 AGGTATCCAATCTTGGATAAAGG + Intergenic
1043815504 8:84796013-84796035 AAGTAGCCACAGCTGGAGAAGGG + Intronic
1044332371 8:90936253-90936275 AAGCATTCACTAATGGAAAAGGG - Intronic
1045449965 8:102312867-102312889 CAGTAGCCACTTATGGCTAATGG - Intronic
1047033017 8:120904117-120904139 GAGTATACACAGATGAATAAGGG + Intergenic
1048030130 8:130623375-130623397 AAGTATATATTGAAGGATAATGG - Intergenic
1051305449 9:15703645-15703667 AAGTGTCCATCAATGGATAAAGG - Intronic
1053593486 9:39535011-39535033 AAGTAGCAACTGCTGGAAAAAGG - Intergenic
1053752598 9:41272519-41272541 TAGTATCCTTTGATGCATAAAGG - Intergenic
1053851220 9:42289719-42289741 AAGTAGCAACTGCTGGAAAAAGG - Intergenic
1054258126 9:62836871-62836893 TAGTATCCTTTGATGCATAAAGG - Intergenic
1054351675 9:64021924-64021946 TAGTATCCTTTGATGCATAAAGG + Intergenic
1056542012 9:87579896-87579918 AAGTAACCACTTGTGGATCAAGG + Intronic
1056995728 9:91456154-91456176 ATGTATCCATTGATGGACATAGG + Intergenic
1058758959 9:108111011-108111033 GAGTCTCCACTGATGGTCAAGGG - Intergenic
1059010330 9:110450902-110450924 AAGTGTCCAGTGAAGGAAAAAGG - Intronic
1059029743 9:110678347-110678369 AAGGATCCACTGAAGGATCCAGG - Intronic
1059850577 9:118334174-118334196 AAGTCACCAATGGTGGATAAGGG - Intergenic
1061251569 9:129429324-129429346 GAGTCTCCACTGATGGATAGTGG + Intergenic
1062674888 9:137736386-137736408 CAGTATCCACTTATCAATAATGG + Intronic
1202800653 9_KI270719v1_random:171505-171527 TAGTATCCTTTGATGCATAAAGG + Intergenic
1203696921 Un_GL000214v1:108119-108141 TAGTATCCTTTGATGCATAAAGG - Intergenic
1203552294 Un_KI270743v1:172911-172933 TAGTATCCTTTGATGCATAAAGG + Intergenic
1186136594 X:6528123-6528145 AAGGATCCACTGTAGGACAATGG + Intergenic
1186264730 X:7819892-7819914 AAGTGTCCAACAATGGATAAAGG - Intergenic
1186267747 X:7850306-7850328 AAGGATCCACTGTAGGACAATGG - Intergenic
1186682030 X:11885126-11885148 ATTTATCCACTGATGGACACTGG - Intergenic
1188047645 X:25446108-25446130 AAGTGTCCACTGACAGATATTGG + Intergenic
1188294003 X:28423666-28423688 AATTATCCATTGATGGACACAGG - Intergenic
1188335415 X:28926066-28926088 AAGTAGCCACAGGTGGCTAATGG - Intronic
1188655627 X:32691757-32691779 CAGTGTCCACTGATGGATGAGGG + Intronic
1189573091 X:42320624-42320646 AAGTTTCCAGAGATGAATAAAGG + Intergenic
1191647762 X:63501656-63501678 AAGTATCTATTGATGAATAAAGG + Intergenic
1193416060 X:81225649-81225671 AATCATCCACTGATGGACACGGG + Intronic
1195958769 X:110363426-110363448 AAGTATTTACTGATAGATAAGGG + Intronic
1197100557 X:122648794-122648816 AAGTTAGCACTGATGGAAAATGG + Intergenic
1197557907 X:127978643-127978665 AAGTATCTCCTGAAAGATAAAGG - Intergenic
1198878909 X:141257585-141257607 TAGTATCCTCTGATAGACAAAGG + Intergenic
1201153573 Y:11108483-11108505 TAGTATCCTTTGATGCATAAAGG + Intergenic
1201266033 Y:12207615-12207637 CAGTGTCCACTGATGGATGATGG - Intergenic