ID: 1126464615

View in Genome Browser
Species Human (GRCh38)
Location 15:48950609-48950631
Sequence CAGTGGGGATGGAGGGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 859
Summary {0: 1, 1: 0, 2: 14, 3: 98, 4: 746}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126464606_1126464615 -7 Left 1126464606 15:48950593-48950615 CCCACCTTAGAAACTGCAGTGGG 0: 1
1: 0
2: 3
3: 25
4: 149
Right 1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG 0: 1
1: 0
2: 14
3: 98
4: 746
1126464608_1126464615 -8 Left 1126464608 15:48950594-48950616 CCACCTTAGAAACTGCAGTGGGG 0: 1
1: 0
2: 0
3: 17
4: 164
Right 1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG 0: 1
1: 0
2: 14
3: 98
4: 746

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126464615 Original CRISPR CAGTGGGGATGGAGGGAAAT GGG Intronic
900315782 1:2055704-2055726 CAGTGGGGATGGTGGGAAAGAGG + Intronic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
900762554 1:4482755-4482777 CAGTGGGCACGGAGGGGTATGGG + Intergenic
901433320 1:9231652-9231674 AGGTGGGGAGGGAGGGAAACAGG - Intergenic
901706362 1:11076488-11076510 CAGTGGTGGTGGAGGAAAAACGG - Intronic
901800493 1:11705364-11705386 CAGTGTGGAGGGAGGGCACTGGG + Intronic
902688225 1:18092846-18092868 CAGTGGGGACAGAGGAGAATGGG - Intergenic
902699744 1:18163661-18163683 CAATGGGGTTGCAGGGAAGTTGG - Intronic
902700261 1:18167572-18167594 CGGTGGGAAAGGAGGGAACTTGG - Intronic
902864363 1:19268707-19268729 CAGTGGGGATGGTGGCACAGGGG + Intergenic
903549661 1:24149181-24149203 GTGTGGGGATGGAGGGAGGTGGG + Intergenic
903781223 1:25821031-25821053 CAGTGTGGCTGGAGGGCAAGGGG + Intronic
904229744 1:29058670-29058692 CTGAGGGGGTGGAGGGAAAGAGG - Intronic
904623415 1:31789040-31789062 CAGTTGGTATGGAGGGAAACGGG - Intergenic
904810320 1:33159605-33159627 CAGTGGGAGTGGAGGCAGATGGG - Intronic
905188475 1:36214411-36214433 CAGTGGGGATGAAGAAAAGTGGG - Intergenic
905207749 1:36352619-36352641 CAGGGGGAAGGGAGGGAAACAGG - Intronic
905913603 1:41670406-41670428 CAGGGGGGATGGAGGCACCTGGG - Intronic
906246628 1:44280365-44280387 CAGTGGAAATGTAGAGAAATGGG - Intronic
906713222 1:47948184-47948206 CAGTGGGGATAGAGAGACTTGGG + Intronic
907115688 1:51966470-51966492 CAGTTTGGATGGAAGGAAAGGGG + Intronic
907178402 1:52547385-52547407 TAGTGAGGATGTAGAGAAATTGG + Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907191843 1:52655930-52655952 CCTTGAGGATGGAGAGAAATGGG + Intronic
907273118 1:53302255-53302277 CAGTGCGTTTGGAAGGAAATGGG + Intronic
907325901 1:53638532-53638554 CAGTGGGGTTGGGGGGCAGTGGG - Intronic
907701037 1:56788608-56788630 AAGTGGGGAGGGAGTGAAAAGGG - Intronic
907853767 1:58281428-58281450 TAGTGGAGATGGAGAGATATAGG - Intronic
907861413 1:58357243-58357265 CAGTGAGAACAGAGGGAAATGGG + Intronic
908522227 1:64955515-64955537 CAGTGTAGAAGGAGAGAAATAGG + Intronic
908550697 1:65206150-65206172 CACTGGGGGTGGAGGGATAGGGG - Intronic
908611518 1:65865887-65865909 GAGTTGGGATGGAGGGAGAGAGG - Intronic
908669853 1:66533976-66533998 CGATGGGGGTGGAGGGGAATGGG + Intronic
908838852 1:68257684-68257706 CAGTGGAGATGAAGAGAAGTTGG - Intergenic
909314310 1:74196756-74196778 CAGTGGGAATGGTGAGAAGTTGG - Intronic
910442668 1:87268478-87268500 CAGTGGGAATGGTAGGAAATGGG + Intergenic
910589332 1:88912772-88912794 TAGTGAGGATGCAGGGAAAGGGG - Intergenic
910726438 1:90344835-90344857 TAGTGACGATGGAGGGAAGTGGG - Intergenic
911092643 1:94030119-94030141 GAGCAGGGAGGGAGGGAAATAGG - Intronic
911380101 1:97104035-97104057 CACTGGGCAGGGAGGGTAATCGG - Intronic
911688930 1:100809102-100809124 CAGTGGGGATGCAGAGCAGTGGG + Intergenic
912330473 1:108815817-108815839 CAGTGAGGATGGAGGGAAACTGG - Intergenic
912346154 1:108965137-108965159 CAGTGGAGATGTGGGGAAATTGG - Intergenic
912483394 1:110003498-110003520 GAGTGGGGATGGAGGGTAGGGGG + Intronic
912706651 1:111919918-111919940 CAGCCTGGATGGAGGGAGATGGG + Intronic
913174090 1:116257942-116257964 CAGTGAGGATGTGGAGAAATTGG + Intergenic
913274636 1:117124879-117124901 CAGTGGGGATGGAAAGAAATCGG - Intergenic
914221501 1:145686238-145686260 CAGTGGGGGTGGGGGGCACTGGG - Intronic
914355954 1:146884827-146884849 CACTGGGGATGGTGGAAAGTGGG - Intergenic
914474064 1:148009107-148009129 CAGTGGGGGTGGGGGGCACTGGG - Intergenic
914755995 1:150561913-150561935 GAGTGGGGAAGGAGGCAAAAGGG + Intergenic
915566360 1:156715604-156715626 AAGTGGGGAAGGAGAGAAGTGGG - Intergenic
915744994 1:158149186-158149208 CAGTGTGGATGGAGAAAAGTGGG + Intergenic
915780055 1:158538257-158538279 CAGTGAGGATGTGGGGAAATTGG - Intergenic
916001527 1:160621121-160621143 CAGTAAGGATGGTGGGAAAGTGG + Intronic
916473132 1:165143029-165143051 GAGTGGGGATGGTGGTAAAAGGG + Intergenic
916573695 1:166048970-166048992 CAGTGTGGCTGGAGTGGAATAGG - Intergenic
916635822 1:166667487-166667509 CAGAGAGGATGTAGAGAAATAGG + Intergenic
917172260 1:172190155-172190177 CGGTGGGGGTGCAGGGAAAAGGG - Intronic
917205191 1:172564208-172564230 CAGTGGGGATGCTGGGGATTGGG - Intronic
917261037 1:173169753-173169775 CAGTGGGGATGAAGAGAGGTTGG + Intergenic
917498644 1:175565549-175565571 GAGTGAGGGTGCAGGGAAATCGG + Intronic
918343200 1:183584006-183584028 TAGTGGGGATGGAGAGAAATAGG + Intronic
918691290 1:187483359-187483381 CAGTGGAGATGGAGGGGTTTGGG - Intergenic
919041380 1:192392609-192392631 AAGTGGGGAGGGAGGGACAGAGG + Intergenic
919196736 1:194296069-194296091 CAGTGGGGCAGGAGGGAAAGTGG + Intergenic
919666006 1:200293183-200293205 CAGTGGGGCAGAAGGAAAATGGG + Intergenic
920274032 1:204790574-204790596 CAGTGGGGATGAAGGGAACTAGG - Intergenic
920631726 1:207659273-207659295 CAGAGGGGAAGGAAGGGAATGGG - Intronic
920827465 1:209435255-209435277 CAGTGGGGAGTAAGGGAATTTGG - Intergenic
920980336 1:210828502-210828524 CGGTGGGGATGGGGTGGAATGGG - Intronic
921108510 1:212009176-212009198 GAGTGTGGGTGGAGGAAAATTGG - Intronic
921602883 1:217125149-217125171 CACTGGGGAGGGAGGGCAGTGGG + Intronic
922978067 1:229801562-229801584 CAGAGTGGATGGAGGGACAGTGG + Intergenic
923183630 1:231548534-231548556 CAGTGGGAATAGAGAGGAATGGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924484744 1:244470521-244470543 TCGTGGGGATGTAGAGAAATGGG + Intronic
924954439 1:248913190-248913212 CACAGGGGAGGGAGGGAAACTGG - Intronic
1062832729 10:616947-616969 CAGTGGGGATGGGGGGTGGTTGG - Intronic
1062955437 10:1537320-1537342 CAGTGAGGATGTGGAGAAATTGG + Intronic
1063497154 10:6520564-6520586 CAGGGAGGATGGAGTGAAACAGG - Intronic
1064115976 10:12577805-12577827 GGGTGGGGAAGGAGGAAAATGGG - Intronic
1064183829 10:13143006-13143028 CAGTGAGGAGAGAGGGACATGGG - Intergenic
1064291956 10:14043430-14043452 CAGTGGGCAGGGAGTGAAATTGG - Intronic
1066391203 10:34978591-34978613 TTGTAGGGATGGAGGGACATGGG + Intergenic
1067218505 10:44323709-44323731 CAGTGGTGGTGGAAGGAAAGAGG + Intergenic
1067549116 10:47221088-47221110 CAGTGTGGATTGATGGAAAGAGG - Intergenic
1067684061 10:48456820-48456842 CAGTGGGGAAGGAGGGAGGGAGG - Intronic
1067938129 10:50628431-50628453 CAGTGGGAATCTGGGGAAATAGG - Intergenic
1068064622 10:52113420-52113442 CAGAAGGGAGGGAGGGAAAGAGG + Intronic
1068381066 10:56254732-56254754 TAGGAGGGATGCAGGGAAATAGG - Intergenic
1068513683 10:57998912-57998934 CAGTTAGGATGGAGGGCAGTGGG - Intergenic
1069583951 10:69584575-69584597 CAATGGGAATGGAGTGAAGTGGG + Intergenic
1070567643 10:77615727-77615749 AAGTAGGGTTGGAGGAAAATGGG - Intronic
1071017484 10:81015070-81015092 CAGAGGGGAGGGAGGGAAGGAGG + Intergenic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1071331938 10:84569381-84569403 CATTGGGTATGGAGGGGCATGGG + Intergenic
1071514972 10:86291281-86291303 CAGTGGGGATGGAGGTCAATGGG - Intronic
1071583480 10:86795646-86795668 TAGTAGGGAGGGAGGGAATTAGG + Intronic
1072783490 10:98265856-98265878 CAGTGTGGGTGGAGGGAAAAGGG - Intronic
1072797190 10:98365102-98365124 CACTGGGGATGAAGAGAAAAAGG + Intergenic
1073170580 10:101504525-101504547 CAGTGGGGTTGGTGAGAGATGGG - Intronic
1073630290 10:105141404-105141426 CAGAGAGGGTGGAGGGAGATTGG + Intronic
1074120986 10:110494477-110494499 CAGTGGGGATGGGGGATAATGGG + Intergenic
1074554282 10:114474233-114474255 CAGTAGAGAGGGAGAGAAATGGG - Intronic
1074622088 10:115136343-115136365 CATTGGGGCAGGAGGTAAATGGG - Intronic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1075399659 10:122151769-122151791 CCGTGGGGATGGAGGGGACCTGG + Intronic
1075970725 10:126649977-126649999 GAGTGGGGAGGGAGGAAAACAGG + Intronic
1075995681 10:126874294-126874316 AAGTGGGGAGGGAGGCAAAGAGG - Intergenic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1077358241 11:2128413-2128435 CTGTGGGGATGGAGGGACAGGGG - Intergenic
1077457966 11:2692291-2692313 CAATAGGGATGGAGGGAAGCAGG - Intronic
1077670899 11:4156737-4156759 CAGTGAGGTTGGAGAGAAAAAGG - Intergenic
1077826536 11:5815584-5815606 CAGTGAGAATGTAGAGAAATTGG + Intronic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1077977962 11:7269210-7269232 CAGTTGGGGGGGTGGGAAATGGG + Intronic
1078064728 11:8070949-8070971 CAGGGGGGCTGGAGGGAAAGGGG + Intronic
1078131742 11:8619334-8619356 TCCTGGGGATGCAGGGAAATAGG + Intronic
1078259489 11:9691367-9691389 CAGTGAGGATGCAGAGACATTGG + Intronic
1078416772 11:11172458-11172480 CAGTGGAGAAGGAGAGAAGTGGG + Intergenic
1078689261 11:13562612-13562634 CAGTGGGGAAGTAGGGAAGTGGG - Intergenic
1078715335 11:13834197-13834219 CAGAGGGGAAGAAGGGAATTGGG - Intergenic
1079161831 11:18002223-18002245 CAGTTGGGATGGAGAGTAAGAGG - Intronic
1079869145 11:25774280-25774302 CGGTGAGGATGTAGAGAAATTGG - Intergenic
1080217500 11:29861996-29862018 CTGTGGGGTTTGAGGGAAACAGG + Intergenic
1080360499 11:31507667-31507689 CAGGGGGGATGGGGAGAATTTGG + Intronic
1081012690 11:37834994-37835016 GAGTGAGGAAGGAGGGAAGTGGG - Intergenic
1081477508 11:43449002-43449024 CAATGGGGATGGAGAAAAGTAGG - Intronic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1083250079 11:61460747-61460769 CAGTGGGGGTGGATGGATCTTGG - Intronic
1084704180 11:70806371-70806393 AAGTAGGGTTGGAGGGAAGTTGG - Intronic
1085004619 11:73074929-73074951 CAGTGGGGAGGGAGGGAGGCAGG + Intronic
1085305325 11:75482517-75482539 CTGTGGGGATGGCGAGAAAAGGG - Intronic
1085314672 11:75537287-75537309 CAGTGGGGCTAGAGGGCAGTGGG + Intergenic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1085933516 11:81115159-81115181 CAGCAGGGATGCATGGAAATTGG - Intergenic
1086170647 11:83832604-83832626 GAGTGGGGAGGGAAGGAAAAGGG + Intronic
1086288681 11:85279344-85279366 GAGAGGGGAGGGAAGGAAATAGG + Intronic
1086509965 11:87545481-87545503 CAGTGAGGATGTGGGGAAAAAGG - Intergenic
1087008270 11:93489794-93489816 CATTGGGGATGGAGGGGGAGAGG - Intronic
1087229864 11:95648443-95648465 CAGTGGGCATTTGGGGAAATAGG - Intergenic
1087439842 11:98169541-98169563 TAGTGAGGATGCAGGGAAAAGGG + Intergenic
1088076727 11:105858643-105858665 TAGTGAGGGAGGAGGGAAATGGG - Intronic
1088763898 11:112958469-112958491 CAGTGGGAAAGGAGGCAAAAAGG - Intergenic
1089016920 11:115172909-115172931 CTGAGGGGATGGTGGGAAAAGGG + Exonic
1089387765 11:118079316-118079338 CTGTGGGGATGGAAGGAGGTAGG - Intronic
1089760697 11:120720866-120720888 GGGTGAGGATGGAGGGAAAAGGG + Intronic
1089791363 11:120946970-120946992 AAGTTGGTATGGAGGGAAAATGG - Intronic
1090746663 11:129710829-129710851 CAATAAGGAAGGAGGGAAATGGG - Intergenic
1090855161 11:130604597-130604619 GAGTGGAGAGGGAGGGACATGGG + Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091204503 11:133810418-133810440 GAGTGGGGAGGGAAGGAAATGGG + Intergenic
1091259268 11:134221519-134221541 AAGGGGGGATGGAGGGATAGGGG - Intronic
1091303527 11:134523105-134523127 GAGTGGGGATGGAAGGAAGGTGG + Intergenic
1091389616 12:118009-118031 AAGTGGGGAGGGAGGGAGCTGGG + Intronic
1091402366 12:188862-188884 GGGTGGGGATGGAGGGAACGGGG - Intergenic
1091666747 12:2424353-2424375 CAAGGGGGAGGGAGGGAAAACGG + Intronic
1092095842 12:5841311-5841333 CAGGTGGGGTGGAGGGGAATGGG - Intronic
1094361349 12:29634558-29634580 CAGTAGTGATGGAGTGAAATCGG + Intronic
1095791234 12:46169575-46169597 CTGAGGGGAGGGAGGGAAATGGG + Intergenic
1096229818 12:49890626-49890648 GAGTGGGGATGGAGGAAGAAGGG - Intronic
1096297678 12:50397641-50397663 CAGTGGGGAAGGAAGGAACCAGG - Intronic
1096521608 12:52187711-52187733 CAGTAGGGATGGAGGTCAAGAGG + Intronic
1096696947 12:53355331-53355353 CAGTGGGGAGGGAGGGAGAAAGG + Intergenic
1096717175 12:53498700-53498722 CAGAGGAGATGGAGAGAAAGAGG + Intronic
1096747894 12:53740127-53740149 CAGTGGAGGTGGAGGGAGAGCGG - Intergenic
1096777707 12:53974132-53974154 GGGTGGGGAGGGAGGGAAAAGGG + Intronic
1096806910 12:54146567-54146589 CAGTGGGGGTGGGGGGAGAGTGG - Intergenic
1096869693 12:54585552-54585574 CAGTGGGGAGGGAAGGCAAATGG + Intronic
1096933310 12:55240874-55240896 CAGTAAGCATGGAGGAAAATTGG - Intergenic
1097097773 12:56563356-56563378 CAGTGGGGATGGAAGAAAGTGGG + Intronic
1097298148 12:57989414-57989436 ATGTGGGGATTGAGGGAAAGAGG + Intergenic
1097733183 12:63151896-63151918 CAGCGGGGATGGCGGAAATTTGG + Intergenic
1097926951 12:65139324-65139346 CAGTGTGGCTAGAGAGAAATGGG - Intergenic
1098048125 12:66423433-66423455 CAATGAGGATAGAGGCAAATGGG - Intronic
1098386264 12:69922041-69922063 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1098718388 12:73861658-73861680 GTGTGGGGATGGCGCGAAATGGG + Intergenic
1099265868 12:80447040-80447062 CAGTGTGGATGCAGAGAAAAGGG - Intronic
1099458463 12:82893942-82893964 CAGAGGAGATGGAGAGAAAAAGG + Intronic
1099693789 12:85993530-85993552 CAGTGGGGCTGGAGGGGCCTTGG + Intronic
1099790550 12:87329196-87329218 CTGTTGGGATGGAGGGAGAGGGG + Intergenic
1100272202 12:93037230-93037252 TAGTGAGGATGTAGAGAAATTGG - Intergenic
1100292110 12:93225744-93225766 CTCTGGGGAAGGAGAGAAATGGG - Intergenic
1100497405 12:95138633-95138655 CAGTGTGGTGGGAGAGAAATGGG - Intronic
1100671541 12:96818653-96818675 GAGTGGGGCAGAAGGGAAATGGG - Intronic
1101143179 12:101817056-101817078 CAGTGGGGATGAAGAGTGATTGG + Intronic
1102099399 12:110266842-110266864 CAGTGGGGAGGGAAGGTAAAGGG - Intergenic
1102728262 12:115084913-115084935 CTGGGGGGAGGGAGGGAAAAGGG + Intergenic
1102776553 12:115524744-115524766 CAGTGGGGATTCAGGGCCATGGG + Intergenic
1103605050 12:122079762-122079784 TTGTGGGGATGGAGTGAGATAGG + Intronic
1103948822 12:124540938-124540960 GAGTGGAGATGGAGGGGGATGGG + Intronic
1103948899 12:124541173-124541195 GAGTGGAGATGGAGGGGGATGGG + Intronic
1103948913 12:124541218-124541240 AGGTGGAGATGGAGGGAGATGGG + Intronic
1103949091 12:124541748-124541770 GAGTGGAGATGGAGGGGGATGGG + Intronic
1103949120 12:124541815-124541837 GAGTGGAGATGGAGGGGGATGGG + Intronic
1104084671 12:125463331-125463353 CAATAGGGATGGATGGCAATGGG + Intronic
1104420671 12:128631987-128632009 GAGTGGGGATGGGGGGAAGGGGG + Intronic
1104546069 12:129714057-129714079 CAGTGTGGTTGGAGGGAGGTAGG - Intronic
1105070403 12:133231134-133231156 CAGTGGAGATGGAGGGCAGGTGG - Intronic
1105370128 13:19794919-19794941 CAGTGGGGAGGTAGGCAAGTGGG + Intergenic
1105619848 13:22056172-22056194 CCATGGGGGTGGAGAGAAATGGG + Intergenic
1106153288 13:27126925-27126947 TAGTTGGGATGGAGGAAGATGGG - Intronic
1106155536 13:27152011-27152033 CAATGGGGATGCAGAGAAATGGG + Intronic
1106349065 13:28910158-28910180 CGGGTGGGATGGAGGGAAATGGG - Intronic
1106356887 13:28991763-28991785 CAAAGGGGAAGGAGGGAAAAAGG - Intronic
1106388499 13:29312044-29312066 CAGTGGGGTTGGAGGGATGTGGG - Intronic
1106588080 13:31074389-31074411 CAGTGGGGAGGGAGGATAAGTGG - Intergenic
1107124265 13:36829281-36829303 TAATGGGAAAGGAGGGAAATGGG + Intergenic
1107131507 13:36901308-36901330 CAGTGAGGATGTAGAGAAATTGG - Intronic
1107563790 13:41581541-41581563 AATTGGGGATGGAGGGCAATGGG + Intronic
1107777521 13:43862036-43862058 GAGTGGGGAGGAACGGAAATAGG - Intronic
1107897042 13:44975534-44975556 TTGTGGGGATGGAGAGAACTAGG - Intronic
1108411439 13:50151655-50151677 TAGTGAGGATGGGGAGAAATTGG - Intronic
1108998721 13:56767771-56767793 CAGAGAGGATGTAGAGAAATAGG - Intergenic
1109177958 13:59178582-59178604 AACTGGGGAAGGAGGGAAATGGG - Intergenic
1109889617 13:68591633-68591655 TAGTAGGGATGCAGAGAAATAGG - Intergenic
1110252968 13:73401517-73401539 CAAAGGGGATGGAGTGAAATGGG - Intergenic
1110270580 13:73585099-73585121 CAGTGGGGATGGTGAGAAGTGGG + Intergenic
1110287866 13:73771016-73771038 AAGTGGGGATGGTGGGAGATAGG - Intronic
1111247737 13:85562946-85562968 AGTTGGGGATGGAGAGAAATGGG + Intergenic
1111292961 13:86191134-86191156 CAGTGGAGGTTGGGGGAAATGGG + Intergenic
1111930512 13:94508468-94508490 GAGTAGGCATGGAGGGAAAGAGG + Intergenic
1111937108 13:94568952-94568974 CAATGAGGATGTAGAGAAATTGG - Intergenic
1112461100 13:99604543-99604565 GAGTGGGGCTGGAGATAAATTGG + Intergenic
1112666986 13:101586174-101586196 AAGAGGGGTTGGAGGGGAATAGG - Intronic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1113599300 13:111557437-111557459 GAGTGGTGATGGAGAGAAAATGG + Intergenic
1113817858 13:113187454-113187476 CAGTGAGGATGCAGGGAGACTGG - Intronic
1114211663 14:20621064-20621086 CAGTAGGGAGGGAGGAAACTTGG - Intergenic
1114260215 14:21031193-21031215 CAATGGGGATTTAGGGAAGTAGG - Intronic
1114361019 14:21972801-21972823 CGGTGAGGATGTAGAGAAATAGG + Intergenic
1114592506 14:23879967-23879989 CAGTGAGGATGTGGGGAAAGGGG + Intergenic
1114630570 14:24157040-24157062 CAGTAGGGATGAAGGAAAAGGGG + Intronic
1114756845 14:25269360-25269382 CTGTGGGGATGGAGGGATTGTGG + Intergenic
1115013408 14:28578782-28578804 CACTGGGGAGGGTGGGAAAAGGG - Intergenic
1115658638 14:35468093-35468115 CAGTGGGGGTGGGGGGGAGTGGG + Intergenic
1115814849 14:37152975-37152997 AAGTGGGGAAGGAGGAAAAGAGG + Intronic
1115886425 14:37976679-37976701 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1116183752 14:41569570-41569592 TTTTGGGGATGCAGGGAAATAGG + Intergenic
1117091817 14:52258714-52258736 GAGTGGGGGTGGGGGGCAATTGG + Intergenic
1117201685 14:53396228-53396250 CAGAGGAGAGGGAGAGAAATGGG - Intergenic
1117473206 14:56067552-56067574 AAGTGGGGATGGAGAGAACTGGG + Intergenic
1117679858 14:58192855-58192877 CAGTAGGAATGGAGTAAAATAGG + Intronic
1117870279 14:60193433-60193455 CAGTGAGGATGTAGGGAAAATGG - Intergenic
1118057741 14:62099318-62099340 CACTGGGGATGGAAAGAAGTGGG + Intronic
1118227956 14:63920714-63920736 CCGTGGAGATGGAGAGAAATAGG + Intronic
1119068163 14:71551748-71551770 CAGTGTGGCTGGAGGGGAAAGGG - Intronic
1121394696 14:93610185-93610207 GAATTGGGATGGAAGGAAATGGG + Intronic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121638186 14:95467741-95467763 CAGTGGGCAAGGAGGGTAAATGG + Intronic
1121859048 14:97299340-97299362 CAATGGGGATGGAGAGAGAAGGG - Intergenic
1122412952 14:101535235-101535257 CAGTGGGGATGGAGGGGACCCGG - Intergenic
1123509361 15:20981081-20981103 CAGTGGGGATGGGGAGATATTGG - Intergenic
1123566583 15:21554821-21554843 CAGTGGGGATGGGGAGATATTGG - Intergenic
1123602844 15:21992114-21992136 CAGTGGGGATGGGGAGATATTGG - Intergenic
1124166532 15:27331099-27331121 CAGTGGGGATGTGGGGCAACAGG + Intronic
1124504456 15:30261279-30261301 AAGAGGGGACGGAGGGAAACAGG - Intergenic
1124739095 15:32277356-32277378 AAGAGGGGACGGAGGGAAACAGG + Intergenic
1125228609 15:37426106-37426128 TAGTGAGGATGCAGGGAAAAGGG + Intergenic
1125312887 15:38399876-38399898 GGGTGGGGGTGGCGGGAAATGGG - Intergenic
1125365192 15:38905972-38905994 AAGTGGGGATTAAGGGAAAGAGG - Intergenic
1125820700 15:42627580-42627602 CAGTGGCGGTAGAGGGAAAGGGG - Intronic
1125831296 15:42718731-42718753 CCCTGGGGACAGAGGGAAATGGG - Exonic
1125841503 15:42805608-42805630 TAATAGAGATGGAGGGAAATGGG - Intronic
1125890681 15:43264142-43264164 TAGTGGGAATGCAGAGAAATTGG + Intronic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1126929889 15:53635687-53635709 TGGGGGGGATGGAGGGAGATGGG + Intronic
1127697994 15:61470581-61470603 CAGTGGAAATGGAGTGGAATTGG - Intergenic
1128037887 15:64542750-64542772 AAGTGGGGATGGAGAGAAGGAGG - Intronic
1128153041 15:65375414-65375436 AAGGGGAGATGGAAGGAAATAGG + Intronic
1128427381 15:67555623-67555645 TGATGGGGTTGGAGGGAAATGGG - Intronic
1129383753 15:75184381-75184403 AAGAGGGGATGAAGGGAACTGGG + Intergenic
1129503687 15:76063410-76063432 CAGTGTGGATGGAGCAGAATAGG - Intronic
1129714612 15:77839866-77839888 TAGTGGGGTTGGAGAGAAATGGG - Intergenic
1129898792 15:79129745-79129767 CAGTGGGTTTGGAGGGGCATAGG - Intergenic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1130854276 15:87827111-87827133 CAGTGGGGTTGGATGGGAATTGG + Intergenic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131074054 15:89483831-89483853 CAGGGAGGATGGAGGCAAAGGGG + Intronic
1131449318 15:92525987-92526009 AAGGAGGGATGGAGGGAAAAAGG - Intergenic
1131470907 15:92696048-92696070 CAGTGGGTTTTGAGGGAAAAGGG + Intronic
1131836050 15:96392286-96392308 CTGTGAGGATGGAGTGAACTTGG + Intergenic
1131878774 15:96839702-96839724 CAGTGAGGATGTGGAGAAATTGG + Intergenic
1132357324 15:101181580-101181602 CAGTGGGGCTGGAGAGAGAAGGG - Intronic
1132435720 15:101800210-101800232 GAGTGGGGATGGAGAGAACAGGG + Intergenic
1202974944 15_KI270727v1_random:281916-281938 CAGTGGGGATGGGGAGATATTGG - Intergenic
1132715219 16:1286675-1286697 CAGTGTGGTTGGAAGGAAAGCGG + Intergenic
1132975064 16:2706911-2706933 CAGTGGGCATGGAGGAACAGAGG + Intronic
1133148374 16:3807807-3807829 CAGAGGGGCTGGTGGGAAAGTGG - Intronic
1133866532 16:9649135-9649157 CAGGAGGGATGAAGAGAAATTGG + Intergenic
1133966784 16:10537514-10537536 CAGTGGGGCTGGAGTGCAGTGGG - Intronic
1135046880 16:19163204-19163226 CTGTGGGCATGGCTGGAAATAGG - Intronic
1135141401 16:19925191-19925213 CAGTGAGGATGTTGAGAAATAGG - Intergenic
1135159429 16:20080593-20080615 GTGTGGGGATGGAGGGCATTTGG - Intergenic
1135191501 16:20358238-20358260 CAGTGGAGATGAAGGGAAGTGGG + Intergenic
1135262948 16:20997237-20997259 TGCTGGGGATGGAGGGAAAGAGG + Intronic
1136021768 16:27445098-27445120 GGGTGGGCATGGTGGGAAATGGG - Intronic
1136173457 16:28502285-28502307 CAGTGGAGATGGAAGGAATGGGG - Intronic
1136220372 16:28823999-28824021 CAATGGGGAGGGAGGGACTTGGG + Intronic
1136240268 16:28939003-28939025 AAGCGGGGAGGGAGGGAGATAGG + Intronic
1136549625 16:30976006-30976028 CGGTGGGGAGGCAGGGAGATGGG + Intronic
1137420045 16:48325393-48325415 TAGTGGGGATGGGGAGAGATTGG - Intronic
1138219192 16:55236619-55236641 CAGCAGGGATGGAGTGAAAAAGG + Intergenic
1138221401 16:55254759-55254781 CTATGGGGGAGGAGGGAAATGGG - Intergenic
1138540303 16:57683824-57683846 CAGTGGGGGTGGAGAGCCATAGG + Intronic
1138634692 16:58328376-58328398 GGGTGGGGATGGGGAGAAATGGG - Intronic
1138795434 16:59962664-59962686 CAGTTGGAAGGGAGGGACATCGG + Intergenic
1139579244 16:67862495-67862517 AAGTGGTGGTGGAAGGAAATGGG - Intronic
1139978062 16:70830634-70830656 CACTGGGGATGGTGGAAAGTGGG + Intronic
1141011429 16:80404012-80404034 CAGTGGGGAGGGAGTGAACAAGG - Intergenic
1141028876 16:80570936-80570958 GAGTGTGGATGGAGGGAGAGTGG - Intergenic
1141756782 16:85996746-85996768 AAGGAGGGATGGAGGGAAAGAGG + Intergenic
1141892109 16:86933199-86933221 AAGAAGGGAAGGAGGGAAATGGG + Intergenic
1142591710 17:1009170-1009192 CAGTGGGGATGGACAGCAGTGGG - Intronic
1142612436 17:1116666-1116688 CAGTTGGGAAGGAGGTAAGTCGG - Intronic
1142683255 17:1562384-1562406 CAGCGGGGATGGAGGGGATCCGG - Intronic
1142806881 17:2376000-2376022 CTGTGGGGATGCTGAGAAATGGG - Intronic
1143223809 17:5282845-5282867 CCGTGGGGGAGGATGGAAATCGG + Intronic
1143374974 17:6462012-6462034 GAGTAGGGGTGGAGGGAAAGAGG - Intronic
1143465348 17:7132765-7132787 CAGTGGAGACGGAGGGACAGTGG - Intergenic
1143580620 17:7823695-7823717 GAGAGGGGATGGAGGACAATGGG - Intronic
1143725803 17:8844814-8844836 GAATGGGGAGGGAGGGAAAGGGG - Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144204683 17:12971760-12971782 CACCAGGGATGGAGGGAAAGGGG - Intronic
1144620889 17:16817933-16817955 GAGTGGGGATGGGGAGAAAGTGG - Intergenic
1144754226 17:17669692-17669714 GAGTGGGGATGGGGGTGAATGGG - Intergenic
1144967292 17:19085628-19085650 CCCTGGGGATGGAAAGAAATGGG + Intergenic
1144980628 17:19166438-19166460 CCCTGGGGATGGAAAGAAATGGG - Intergenic
1144987594 17:19211795-19211817 CCCTGGGGATGGAAAGAAATGGG + Intergenic
1145055885 17:19703839-19703861 GAGTGGGGATGGGGAGAAAGTGG + Intronic
1145352606 17:22098843-22098865 CAGAAGGGCTGGAGGGAATTAGG + Intergenic
1145888783 17:28400328-28400350 AAATGGGAATGGAGGGAAATAGG + Exonic
1146371770 17:32268938-32268960 CAGTGAGGATGGACGGGAAGAGG + Intronic
1146506484 17:33410042-33410064 CATTGAGGATGTATGGAAATTGG + Intronic
1146700980 17:34960079-34960101 CAGTGGAGATGGAGAGAAGGTGG - Intronic
1147062013 17:37887596-37887618 TAGTGGAGATGGAGAGAGATAGG - Intergenic
1147117548 17:38312936-38312958 CAGTGAGGATGTAGAGAAACTGG - Intronic
1147484628 17:40800777-40800799 CAGTGGGGATGCAGAGAAGATGG + Intergenic
1147907438 17:43832492-43832514 CAGAGAGGAGGGGGGGAAATGGG + Intronic
1148109111 17:45134898-45134920 TACTGGGGAGGGGGGGAAATGGG - Intronic
1148231943 17:45941631-45941653 AAGGGGGGAAGGAGGGAAAGAGG - Intronic
1148412139 17:47476654-47476676 CAGTGAGGATGTAGAGAAACTGG + Intergenic
1148712090 17:49689365-49689387 CAGTGGAGATGGAAGGAAGTAGG - Intergenic
1149272182 17:54991934-54991956 CAGTGGTGGGGGAGGGATATGGG - Intronic
1150203773 17:63384599-63384621 CACTGGGGAGGGAGGAGAATGGG - Intronic
1150250909 17:63704040-63704062 CACTGGGCCTGGAGGGAAAGGGG + Exonic
1150317740 17:64183735-64183757 TAGTGAGGATGTAGAGAAATTGG - Intronic
1150895514 17:69205776-69205798 CAGTGGGGCTGGGGGAATATTGG + Intronic
1151027845 17:70700051-70700073 CAGATGTGATGGAGGGAAAATGG - Intergenic
1151201171 17:72469115-72469137 CAGTGGGGATCAGGGGACATGGG - Intergenic
1151251459 17:72838928-72838950 CAGTGGGGATGGCAGGGAATGGG - Intronic
1151512709 17:74571059-74571081 CAGTGGGGAGGGAAGAAAGTGGG - Intergenic
1151629489 17:75300869-75300891 CAGCGGGGATGGCGAGAAACTGG - Intergenic
1151664161 17:75535907-75535929 CAGTGAGGAGGGAAGGAAACAGG + Intronic
1151698608 17:75730885-75730907 CAGTGAGGAGACAGGGAAATAGG - Exonic
1151803384 17:76390839-76390861 CAGTGGGGACAGAGGGGCATGGG + Exonic
1152204546 17:78967556-78967578 CCGTGTGGATGGAGGGAAGCCGG + Intergenic
1152542248 17:80982227-80982249 TAGTGGGGAGGGAGGGAAGGTGG - Intergenic
1153030771 18:711421-711443 CAGTAGGGAGGGAAGGAAATGGG - Intronic
1155114397 18:22750324-22750346 CAGTGATAATGGAGGAAAATAGG - Intergenic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1155627100 18:27846905-27846927 CAGTGGTGATGGACAGAAGTGGG - Intergenic
1155872462 18:31044322-31044344 AAGTGGTGAGGGAGGGAGATTGG - Intergenic
1155937660 18:31770937-31770959 GAGTGGGGAGGTAGGGAGATAGG + Intergenic
1155968538 18:32058758-32058780 TAGTGGGGATTGGGGGAAGTGGG - Intronic
1156060873 18:33074623-33074645 CAGTGAGGTGGGAGGAAAATAGG + Intronic
1156504749 18:37582717-37582739 TGATGGGGATGGAGGGAAAATGG - Intergenic
1156920985 18:42522116-42522138 CAGTGGAGATGAAGAGTAATAGG - Intergenic
1157478410 18:48037616-48037638 GAGTGGGGAAGAAGGGAGATGGG + Intronic
1157490535 18:48120703-48120725 CACTGGGGGAGGAGGGAAAGTGG + Intronic
1157828162 18:50831282-50831304 CAGAGGGCATGGAGAGAGATTGG - Intergenic
1158551810 18:58442560-58442582 CAGTGGGGCTGGAAGGAAGCTGG - Intergenic
1158661550 18:59393051-59393073 GAGAAGAGATGGAGGGAAATGGG - Intergenic
1159310633 18:66703051-66703073 CAGTGGGGCGGGAGTCAAATAGG - Intergenic
1159375312 18:67585366-67585388 GAGAGGGGAAAGAGGGAAATAGG - Intergenic
1159425105 18:68275152-68275174 CAATGGGGACGGAGAGACATCGG - Intergenic
1159633431 18:70777073-70777095 AAGTAGAGTTGGAGGGAAATTGG + Intergenic
1160888875 19:1366453-1366475 GCGTGGGGATGGAGGGACAGAGG + Intronic
1161237290 19:3204380-3204402 CAGTGGGTAAGGAGGGACAAGGG - Intronic
1161267565 19:3371723-3371745 CAGAGGGAAGGGAGGGAAACTGG - Intronic
1161675667 19:5647182-5647204 GAGTTGGGTTAGAGGGAAATAGG + Intronic
1162157889 19:8692119-8692141 CAGTGTGGCTGGAGGTAAAGGGG + Intergenic
1162378394 19:10318059-10318081 CAGAGTGGATGGAGGACAATAGG + Intronic
1162400791 19:10445386-10445408 CAGTGGGGATGGATGCACACCGG + Intronic
1163480551 19:17553583-17553605 AGGTGGGGTTGGAGGGAAATAGG - Exonic
1163644536 19:18481113-18481135 AAGTGGGGATGCAGGAAATTGGG - Intronic
1163699557 19:18780564-18780586 CAGGAGGGATGGATGGACATGGG - Exonic
1164976184 19:32574427-32574449 ATGAGGGGAGGGAGGGAAATTGG - Intergenic
1164986384 19:32651784-32651806 CAGTGGGGATGCAGTGAATGGGG - Intronic
1165158174 19:33800560-33800582 CACTGGGGAAGAAGGGAAAGAGG - Intronic
1165774194 19:38395337-38395359 AAGTGGGGATTGAGGGACCTTGG + Intronic
1165900488 19:39167215-39167237 CAGTGGGGAGGGAGCGGGATGGG + Intronic
1165996646 19:39848564-39848586 CAGAGGGGTAGGAGGGCAATGGG + Intergenic
1167087749 19:47321877-47321899 GTGTGGGGGTGGAGGGAAGTGGG - Exonic
1167322470 19:48805636-48805658 CAGGGGGGATGGCGGGAGAGGGG - Intronic
1167615370 19:50530099-50530121 CTGTGGGGATGGAGAGGAAATGG - Intronic
1167748136 19:51364761-51364783 CAGGGGGCATTGAGGGAGATGGG + Intronic
1168057747 19:53872865-53872887 CCTTGGGGAGGGAGGGAAAGAGG + Intronic
1168470747 19:56638760-56638782 CAATGGGGATGGAGAGCAGTGGG - Intergenic
1168655728 19:58126157-58126179 AAGTGTGGATGGAGGGGCATTGG - Intergenic
926278416 2:11424390-11424412 TAGTGAGGATGCAGGGAAACTGG - Intergenic
926328585 2:11806193-11806215 CAGTGGTGATGGTAGGGAATGGG + Intronic
926604640 2:14885251-14885273 GAGTAGAGATGGAGAGAAATGGG + Intergenic
927204558 2:20599001-20599023 CAGTGGGGAGTGGGGGGAATGGG + Intronic
927500470 2:23579577-23579599 AAGTGGGACTGGAGGGAAAAGGG - Intronic
927624526 2:24700596-24700618 CATTGAGATTGGAGGGAAATGGG + Intronic
927712224 2:25332970-25332992 CAGTGGGCAGGGAGGGAAAGAGG + Intronic
927801491 2:26104215-26104237 TAGTGAGGATGTAGAGAAATTGG - Intronic
927871027 2:26623813-26623835 CACTGGGGATGGCTGGAAACAGG - Intronic
927948991 2:27154897-27154919 TCCTGGGGATGAAGGGAAATTGG + Exonic
928083307 2:28328702-28328724 CACTGGGGTTGGAGTGACATTGG + Intronic
928232079 2:29506882-29506904 CAGTGAGGATGTAGAGACATTGG + Intronic
929166782 2:38890379-38890401 GATTAGGGATGGAGGGAGATTGG + Intronic
929246432 2:39708247-39708269 CAGTGGGGCTGGAGGGAGTGAGG + Intronic
929592206 2:43154700-43154722 GAGTGGGGATGGATGGAGGTTGG + Intergenic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
930875780 2:56213997-56214019 CAGTGAGGCTGGAGAGACATTGG + Intronic
931092053 2:58896704-58896726 GTGTGGGTGTGGAGGGAAATGGG - Intergenic
931160054 2:59679583-59679605 AAGTGGGGATGGTGGGAAGATGG - Intergenic
931241700 2:60460320-60460342 GAGTGGGGCTGGAGGGCGATGGG + Exonic
931908782 2:66871453-66871475 GAATTGGGATGGAGAGAAATGGG + Intergenic
932278562 2:70470175-70470197 AAGAGGGGAGGGAGGGAAACAGG + Intronic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
934851208 2:97702368-97702390 CAAGGGGCATGGAGGGAAAATGG - Intergenic
934856084 2:97731269-97731291 CAGTGAGGAGGGAGGGCTATTGG - Intronic
934870892 2:97864237-97864259 CAGCGGGGATGGGTAGAAATGGG + Intronic
934954455 2:98605934-98605956 CAGTGGGGCTGGAGGAAAGCAGG - Intronic
935182114 2:100700747-100700769 CTGGGGTGATGGAGGGACATCGG - Intergenic
935332727 2:101988803-101988825 GAGGGGGGTTGGAGGGAAAGTGG + Intergenic
935551186 2:104457113-104457135 CAGTGAGGATGCAGAGAAACTGG - Intergenic
936509928 2:113137179-113137201 CAGAGGGGAAGGAGGGCAAGAGG + Intergenic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
937239711 2:120452219-120452241 CAGTGGGGATGGAGTGAAAGTGG - Intergenic
937318150 2:120945062-120945084 CACTAGGGAGGGAGGGAAAGAGG + Intronic
937334946 2:121056486-121056508 CAGTGGGGATGGAGAGAGGATGG + Intergenic
937409962 2:121665911-121665933 CAGTGGGGAGGGAAGAAAATGGG - Intergenic
937769751 2:125706561-125706583 CAGTGAGGCTGAAGAGAAATAGG + Intergenic
937837256 2:126484186-126484208 CAGTGGGGAGGGTGGGACAAAGG - Intergenic
937862050 2:126718945-126718967 CAGTGAGGATGGATAGAGATGGG + Intergenic
938554137 2:132408595-132408617 CAGTGGGGAGGGAGGGAGAAAGG + Intergenic
939176898 2:138759494-138759516 CAGGTGGGAAGGTGGGAAATGGG + Intronic
940029145 2:149241939-149241961 CAGTGGGGATGGTTGGGGATGGG + Intergenic
940295110 2:152114516-152114538 CAGTGAGGATGTGGAGAAATTGG + Intergenic
941285395 2:163606395-163606417 CAGTTGGGAAGAAGGGAATTAGG + Exonic
941463590 2:165799738-165799760 CAGTTGGGCTGGAGGGGATTTGG - Intergenic
942293052 2:174490678-174490700 CAGCGGGACTTGAGGGAAATCGG - Intergenic
943901676 2:193446684-193446706 CAGTGAGGATGCAGAGAAAAAGG - Intergenic
943996070 2:194767011-194767033 CACCAGGGATGGAGGCAAATAGG + Intergenic
944091896 2:195921069-195921091 CAGTGTGGATGTAGTGAAAGGGG + Intronic
944689560 2:202147362-202147384 CAGAGGGGAGGCAGGGAATTTGG + Intronic
945183253 2:207113473-207113495 CAGTGGGGAGGGGAGGAAAAGGG - Intronic
946497747 2:220213034-220213056 ATGTGGGGATGGAGGGAGAGAGG + Intergenic
947971865 2:234331546-234331568 ACGTGGGGAGGGAGGGAAAGAGG - Intergenic
948106069 2:235414685-235414707 GAGTGGGTATGAAGGGAACTGGG + Intergenic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
948773436 2:240265426-240265448 GAGTGGGGAGAGAGGGAAAGAGG - Intergenic
1169220939 20:3822360-3822382 GAGTGGGGACGCAGAGAAATAGG + Intronic
1170036563 20:11995973-11995995 CAGTGGGGAAAGTGGAAAATTGG + Intergenic
1170441666 20:16385686-16385708 CAGTGGGGAAGGAGGGGCCTGGG + Intronic
1170531270 20:17294833-17294855 CAGAGGAGATGGAGGAAAACAGG - Intronic
1170588950 20:17756583-17756605 CAGTGGGGACAGAGGCAGATTGG + Intergenic
1171796246 20:29568704-29568726 CTGTGGGGATGCAGAGTAATAGG + Intergenic
1171816777 20:29792725-29792747 CAGTGAGGATGGATGGATTTTGG - Intergenic
1171851991 20:30315463-30315485 CTGTGGGGATGCAGAGTAATAGG - Intergenic
1172178697 20:32987636-32987658 CAGGGGGGATGGCGGGAGATGGG - Intronic
1172601446 20:36186374-36186396 TATTGAGGATGGAGGGAATTAGG + Intronic
1172773499 20:37394729-37394751 CAGAGGGGCTGGAGAGAAAGGGG - Intronic
1173448870 20:43144425-43144447 CAGTGGGGATAGAAGGGATTAGG - Intronic
1173573537 20:44094624-44094646 CTTGGGGGATGGAGGGATATTGG - Intergenic
1173756546 20:45521729-45521751 GGGTGGGGAGGGAGGGAAAGAGG - Intergenic
1174052865 20:47779418-47779440 CAATGGAGATGGAGTGAAATGGG - Intronic
1174507952 20:51029047-51029069 GAGGAGGGATGGAGGGAGATGGG - Intergenic
1174745744 20:53060464-53060486 CATTAGGGAGGCAGGGAAATTGG - Intronic
1175008855 20:55714124-55714146 CAGAGGGGATGCCAGGAAATGGG + Intergenic
1175041439 20:56055397-56055419 CAGAGAGGATGCAGAGAAATAGG + Intergenic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1175194568 20:57234068-57234090 GAGTGGGGGTGGGGGGACATGGG - Intronic
1175727699 20:61331160-61331182 CACTGGGCATGGAAGGAGATGGG - Intronic
1175905745 20:62378537-62378559 CAGTGGGAATGGCGGGATTTCGG - Intergenic
1175960760 20:62635177-62635199 CAGTGGGGAGGGAGGGACACAGG - Intergenic
1176902860 21:14464524-14464546 CAGTGGGGAGGAAGGGGAAGGGG + Intergenic
1177447023 21:21210871-21210893 GAGTTGGGAGGGTGGGAAATGGG + Intronic
1178104604 21:29303924-29303946 CAGTGGGCATGCAGTGAAATTGG + Intronic
1178354620 21:31900234-31900256 CAGTGGGGCTGGAAGGAGCTAGG - Intronic
1178492906 21:33064754-33064776 CAATGGGGAAGGAGTGAAACCGG + Intergenic
1181088330 22:20455268-20455290 CTGTGGAGCTGGAGGGAGATGGG - Intronic
1181498914 22:23304702-23304724 CGGTGAGGATGTAGAGAAATGGG - Intronic
1182201351 22:28573832-28573854 TAGTGGGGGTGGGGGGAAGTGGG - Intronic
1182868384 22:33624868-33624890 CAGTGGGGATGGAGAGAACGGGG + Intronic
1183354363 22:37350533-37350555 CGGTGGGGAGGCAGGGAAAGAGG - Intergenic
1183366926 22:37411784-37411806 TGGAGGGGATGGAGTGAAATAGG - Intronic
1183733486 22:39630970-39630992 CAGGGAGGATGGAGGGAGGTGGG + Intronic
1183944732 22:41318787-41318809 CAGTGGGGAGGGTGGTGAATAGG - Intronic
1184147015 22:42617706-42617728 CAGTGTGGCTGGAGGGGAGTGGG - Intergenic
1184730377 22:46368312-46368334 CAGAGGGGATGGAGTGAATCCGG + Intronic
949380557 3:3440793-3440815 TAGTGAGGATGTAGAGAAATTGG + Intergenic
949534190 3:4983179-4983201 CAGTGGCTATGGAGGAGAATCGG + Exonic
949837037 3:8280426-8280448 CACTGGGGATGGAGGCACACAGG - Intergenic
950011579 3:9727898-9727920 CAGTGGGGAGGGAGAGAAAGTGG + Intronic
950190257 3:10971700-10971722 ATGTTGGGATGGAGGGACATAGG - Intergenic
950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG + Intronic
950526863 3:13529348-13529370 CAGGAGGGATGGAGGGAAAAGGG - Intergenic
951214917 3:20014740-20014762 CACTGGGGATGGAGACAAGTGGG - Intergenic
951433330 3:22633633-22633655 CAGTGAGGATGTGGAGAAATTGG - Intergenic
951875273 3:27417854-27417876 CGGTGAGGATGCAGGGAAATAGG + Intronic
952307268 3:32157335-32157357 CAGAGGGGATGGAGTGAACCTGG - Intronic
952845125 3:37681815-37681837 GTGAGGAGATGGAGGGAAATGGG - Intronic
952869564 3:37886314-37886336 AAGTGGGTCGGGAGGGAAATGGG - Intronic
952901383 3:38114178-38114200 GAGTGGAGATGGCGGGAAGTGGG + Intronic
953045822 3:39293629-39293651 TAGTGAGGATGGAGGGGAAGGGG - Intergenic
953304563 3:41815647-41815669 CAGTGGGGTAGCAGGGAGATGGG + Intronic
953620893 3:44531889-44531911 CTGTGGAGATGGAAAGAAATGGG - Intergenic
954217560 3:49132969-49132991 CAGAGGGCCTGGAGGGAAACAGG - Exonic
954601677 3:51875265-51875287 CAGAGTGTATGGGGGGAAATAGG + Intronic
954763800 3:52896900-52896922 CACTGGGGATTGAGGGATGTGGG + Intronic
954849519 3:53588517-53588539 CAGAGGTTATGGAAGGAAATTGG + Intronic
955278024 3:57566597-57566619 TAATGAGGATGGAGGGAAACTGG - Exonic
955412703 3:58666486-58666508 AGGTGGGGAGGGTGGGAAATAGG - Intronic
955521236 3:59777552-59777574 TAGTGGAGGTGGAGAGAAATAGG - Intronic
955688788 3:61570044-61570066 GTGTGGTAATGGAGGGAAATAGG + Intronic
955711067 3:61779537-61779559 CAGTGAAGATGGAGGGATGTAGG + Intronic
955740662 3:62088094-62088116 AAGTGGGGAGGGAGGGAATGGGG + Intronic
955789537 3:62574078-62574100 CAGTGGGGATGGAATGAGATGGG - Intronic
956343822 3:68255781-68255803 AAGTGGGGATGGTTGGAGATGGG + Intronic
956388978 3:68751409-68751431 CAGTGGGGATGGAGAAAAGTGGG + Intronic
956758235 3:72411718-72411740 GAGTGGGGAGGGAGGGCATTTGG - Intronic
956963053 3:74425229-74425251 CAGTGGGGAGGAAGGGAGAGGGG - Intronic
957226612 3:77456922-77456944 AAATGGGGAGAGAGGGAAATTGG - Intronic
957481420 3:80801880-80801902 CAGTGAGGATGCAGAGAAAATGG + Intergenic
958073559 3:88646913-88646935 AAGATGGGATGGAGGGAAAGGGG + Intergenic
959107148 3:102077436-102077458 CAGTGGTCATGGAAAGAAATGGG + Intergenic
959578495 3:107960723-107960745 CAGTGGGGAGGGAGAGAGAAAGG + Intergenic
960004449 3:112767620-112767642 CAGGAGGGAGGGAGGGAAGTTGG - Intronic
960173335 3:114488594-114488616 TAGTGAGGATGCAGAGAAATGGG + Intronic
960461748 3:117943977-117943999 CAGTGGGGTTGGAGGATAAAAGG + Intergenic
960529100 3:118743298-118743320 CAGTGGGGGTGAAGGGATAGTGG - Intergenic
961319489 3:126063111-126063133 CAGTGGGAATGGAGGGTCACAGG - Intronic
962132754 3:132699223-132699245 CAGTGAGGATGGGGAGAAGTGGG - Intronic
962147017 3:132850218-132850240 TGGTGGGGATGCAGTGAAATGGG - Intergenic
962166590 3:133055660-133055682 CAGTGGGCATGGAAAGAAAAAGG - Intronic
962925028 3:139985028-139985050 CAGTGGAGATGGAGAGAAATGGG - Intronic
963024434 3:140904759-140904781 CAGTGGAGATGGTGAGAACTGGG + Intergenic
963087446 3:141451271-141451293 TAGTGGGGATGGTAAGAAATGGG + Intergenic
963638431 3:147828653-147828675 CAGTGGAGATGGAGACAAGTAGG + Intergenic
963649970 3:147966664-147966686 CAATGAGGATGTGGGGAAATGGG + Intergenic
965032318 3:163388018-163388040 GAGTGGGGAGGTGGGGAAATGGG + Intergenic
965291392 3:166886274-166886296 TAGTGGGGAGAGAGGGATATGGG + Intergenic
965612787 3:170562485-170562507 CAGTGGGGAGGGTGGGAAGGGGG + Intronic
965614224 3:170576706-170576728 CAGTGGGGGTGGAGTGCTATTGG + Intronic
965915248 3:173837826-173837848 CAGTGCAGTTGGAGGGAAGTGGG + Intronic
966007339 3:175031751-175031773 CAGTGAGGCTGGAGAGAAAAAGG - Intronic
966386170 3:179401038-179401060 AAGTGGGGGTGGAGGAAAAAAGG - Exonic
966431257 3:179833172-179833194 CAGTGGGAATGGAGAGGAAAGGG + Intronic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
967950505 3:194836760-194836782 CAGAGCGGTTGGAGGGATATAGG + Intergenic
968379724 4:80976-80998 CAGAGGGGGTGGGGGGCAATAGG - Intronic
968521476 4:1036520-1036542 CAGCGAGGATGGAGGGACAGGGG - Intergenic
968925752 4:3547176-3547198 CAGTGGGGATGAGGGGGACTTGG - Intergenic
969690209 4:8699989-8700011 CAGTGAGGAGGGAGGGAGACGGG - Intergenic
970566099 4:17334077-17334099 GAGGCAGGATGGAGGGAAATGGG - Intergenic
971256181 4:25015675-25015697 AAATGAGGATGGAGGGAAAATGG - Intronic
972276330 4:37561200-37561222 CAGAGAGGAAGGAGGGAATTGGG - Intronic
972296623 4:37745479-37745501 CAGTGGGGCTGGTGGGCAACTGG - Intergenic
972358455 4:38304062-38304084 GGGTGGAGAGGGAGGGAAATGGG + Intergenic
972723432 4:41723964-41723986 GGGTGAGGATGGAAGGAAATGGG - Intergenic
972766889 4:42159466-42159488 CAGTGACGATGGAAGGAAGTGGG + Intergenic
973702009 4:53546738-53546760 AACTGGGGAAGGAGGAAAATAGG + Intronic
974142762 4:57908701-57908723 AAGTGGGGATGGAGAGAAGCAGG + Intergenic
974191770 4:58513755-58513777 TACTGGGGATGGAAGGAAAGAGG - Intergenic
974429769 4:61780640-61780662 CAGTGGGAATGGATGGAAGAAGG - Intronic
975068021 4:70094237-70094259 CATTGGGGAGGGAGGGATATGGG - Intergenic
976028380 4:80720038-80720060 CAGTGAGGATGGAGGAAACCAGG + Intronic
976227012 4:82802333-82802355 CAGTGGGGATTTGGAGAAATTGG - Intergenic
977037164 4:91969054-91969076 CAGTAGGGGTGGGGGGAAAACGG - Intergenic
977155669 4:93569707-93569729 CAGTGCGGCTGAAGGAAAATGGG - Intronic
977411247 4:96668044-96668066 CAGTGGGTGTGTTGGGAAATGGG + Intergenic
977632109 4:99254570-99254592 CAAAGGAGATGGAGGAAAATAGG - Intergenic
978017734 4:103767975-103767997 CAGTGAGGATGTGGAGAAATTGG - Intergenic
978094661 4:104761404-104761426 CAGCAGGAATGAAGGGAAATGGG - Intergenic
980007134 4:127555518-127555540 CTGTGGAAATGGAGAGAAATTGG + Intergenic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
980807145 4:137828324-137828346 AAGTGGGGAAGGAGGGAAGGAGG + Intergenic
981186291 4:141807782-141807804 AAGTGGGCATACAGGGAAATGGG - Intergenic
981334198 4:143550573-143550595 CAGTGGGGGTGGGGGAAAGTGGG - Intronic
981658288 4:147137181-147137203 CAGTGGGGATGGAGAGAACTAGG - Intergenic
981674237 4:147322821-147322843 CAGGAGGGAGGGAGGGAAAGAGG + Intergenic
981729753 4:147885013-147885035 CAGTGGGGGTGGAGCCAAGTGGG + Intronic
981798431 4:148627146-148627168 GAATGGGGATGGGGAGAAATGGG + Intergenic
982209078 4:153020485-153020507 GAGTGGGGAAGGAGGGGAGTGGG - Intergenic
983343672 4:166500036-166500058 GAGATGGGAGGGAGGGAAATTGG - Intergenic
983489488 4:168371906-168371928 CCATGGGGGTTGAGGGAAATAGG + Intronic
983648118 4:170012219-170012241 CAGTGGGGAAGGAAAGAAGTTGG + Intronic
983673910 4:170269319-170269341 CACTGGGGATTGAGGGACACTGG - Intergenic
983991871 4:174129681-174129703 TAGTGGGAATGGAGAGAAGTGGG - Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
986755244 5:10829800-10829822 CAGAGGGGATAGAGGGATACAGG - Intergenic
987162420 5:15157829-15157851 AAGTGGGGAAGGAGGAAGATTGG + Intergenic
987695731 5:21328957-21328979 CAGTAAAGATGGAGAGAAATAGG + Intergenic
987960176 5:24796949-24796971 CAGGGGGGAAGGAGGGAAGGAGG - Intergenic
988361048 5:30237029-30237051 CAGTGGGGCTAGAATGAAATAGG + Intergenic
988399742 5:30747516-30747538 CTGTGGCAATAGAGGGAAATAGG - Intergenic
989151658 5:38305973-38305995 CAGTGGGGATGATGGGATACTGG + Intronic
989378402 5:40789631-40789653 AAGTGGGGCTGGAGGGGAAAAGG + Intronic
989380383 5:40804388-40804410 CATGGGGGATGGAGGGAACTTGG + Intergenic
989395425 5:40950840-40950862 CAGTGGAGATGGGGGGAAGGTGG + Intronic
989494024 5:42090493-42090515 CACTGAGGAAGGATGGAAATAGG - Intergenic
990200430 5:53366705-53366727 CATGGGGAATGGAGGAAAATGGG + Intergenic
990768564 5:59216426-59216448 TAGTAGGGATGGAAGGAAGTGGG - Intronic
990849695 5:60188594-60188616 GAGTGGAGATGGAGGGGAAATGG + Intronic
990871763 5:60439718-60439740 CAGTGGAGATGGAGAGAGGTGGG - Intronic
991021812 5:61987248-61987270 CTGTGGGGATTGAGGGAGATTGG + Intergenic
991445732 5:66698359-66698381 GAGTGGGGATGGGTGGAAAGGGG - Intronic
991744670 5:69723135-69723157 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991753033 5:69832098-69832120 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991796241 5:70302859-70302881 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991802651 5:70388825-70388847 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991824052 5:70598449-70598471 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991832353 5:70707217-70707239 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991888619 5:71302418-71302440 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991991479 5:72344144-72344166 CTGTGGGGTTGGAGGGAATGAGG + Intronic
993087837 5:83385769-83385791 CAGTGAGGATGGAGAAAAATTGG + Intergenic
993379000 5:87184041-87184063 CAGTAGGAATGAATGGAAATTGG - Intergenic
993724975 5:91356450-91356472 CAATGGTAATGGAGGGAAACGGG + Intergenic
994122479 5:96132175-96132197 CAGAAGGGAGGGAGGGAAAGAGG + Intergenic
994390729 5:99190060-99190082 TAGTGGGGGTGGGGGGAGATAGG - Intergenic
994430276 5:99650060-99650082 CAGTGGGGATGTGGTGAAAAGGG + Intergenic
995055097 5:107750429-107750451 ACGTGGGGGTGGAGGCAAATTGG - Intergenic
995183095 5:109247039-109247061 CAGTGGGGATGGAGTAAACTGGG + Intergenic
995385563 5:111585092-111585114 CTGTGAGAATGCAGGGAAATAGG + Intergenic
995390059 5:111630479-111630501 AAGGGGGGATGGAGAGAAAAAGG + Intergenic
995522885 5:113027485-113027507 AGGTGGGAATGAAGGGAAATTGG + Intronic
996201992 5:120686558-120686580 TAGTGGGAAAGGAGGGAGATGGG - Exonic
996209167 5:120783853-120783875 TAGTGGGAATGGGGGGAAAAAGG - Intergenic
996249129 5:121305298-121305320 TACTGGGCATGGATGGAAATGGG + Intergenic
996285328 5:121784287-121784309 CAGTGGAGATGGAGAGACGTGGG + Intergenic
996293219 5:121879352-121879374 TTCTGGGGATGGAGAGAAATGGG + Intergenic
996836897 5:127803684-127803706 CCGTTGGGATGGAGGTAAAGAGG - Intergenic
996906028 5:128601403-128601425 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
996906040 5:128601432-128601454 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
997123856 5:131205657-131205679 CAGTGAGGATGTGGGGAAATGGG - Intergenic
997459404 5:134041914-134041936 CAGAGGAGAGTGAGGGAAATGGG - Intergenic
997470262 5:134113533-134113555 CAGTTGGGATAGAGGGTATTTGG - Intergenic
997930583 5:138069489-138069511 GAGAGGGGATGCAGGGAAATGGG - Intergenic
998004167 5:138646354-138646376 CAGTGAGGATGGAGAGAGAGCGG - Intronic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
998925359 5:147117848-147117870 CAGTGAGAATGCAGAGAAATGGG - Intergenic
999275124 5:150325099-150325121 GAGTGGGGAGGGAGGGAGAAAGG + Intronic
999538883 5:152549977-152549999 CAGTGTGGCTGGAGTAAAATGGG - Intergenic
1000120488 5:158193364-158193386 AAGTGGGGAAGGAGGGAGCTGGG - Intergenic
1000393670 5:160750588-160750610 CAGTGATGGTGGAGGGAAAGAGG - Intronic
1000790205 5:165597381-165597403 CAGTCGGGATGTTGAGAAATGGG - Intergenic
1001528273 5:172444658-172444680 CAGTGGAGATGGAGGGAGAGAGG - Intronic
1001734622 5:173988660-173988682 CAGGGGAGATGGAGGGAAGTGGG - Intronic
1001923200 5:175616917-175616939 CAGTGGTGATGGAGGGACAAGGG + Intergenic
1001969443 5:175942608-175942630 CAGTGAGGATGTAGAGAAAAGGG + Intronic
1002247992 5:177901145-177901167 CAGTGAGGATGTAGAGAAAAGGG - Intergenic
1002774955 6:320704-320726 CAGTGGGGAGGGAGGGTGAGGGG + Intronic
1002782991 6:381014-381036 CAGGAGGGGTGGAGGGAAAGAGG + Intergenic
1002856829 6:1045317-1045339 CATAGGGGCTGGAGGAAAATGGG + Intergenic
1003146565 6:3514958-3514980 CAGGGATGATGGAGGGGAATTGG + Intergenic
1003719291 6:8682477-8682499 CAGTCAAGATGGAGGGAGATGGG - Intergenic
1003860669 6:10319389-10319411 CCGTGGGGATAGAGGGACGTGGG + Intergenic
1003860680 6:10319418-10319440 CCGTGGGGATGGAGGGATGTGGG + Intergenic
1003860690 6:10319449-10319471 CGGTGGGGATGGCGGGACGTGGG + Intergenic
1003860699 6:10319479-10319501 CCGTGGGGATGGCGGGACGTGGG + Intergenic
1003860708 6:10319509-10319531 CCGTGGGGATGGCGGGACGTGGG + Intergenic
1003860777 6:10319750-10319772 CCGTGGGGATGGAGGGACGTGGG + Intergenic
1003860787 6:10319780-10319802 CCGTGGGGATGGAGGGACGTGGG + Intergenic
1003972173 6:11310306-11310328 CAGTGGGCAGAGAGGGAAGTGGG - Intronic
1003983532 6:11412358-11412380 CAGGGGCAAAGGAGGGAAATGGG + Intergenic
1004201806 6:13555464-13555486 CTGTGGGGAGGGAAGAAAATGGG - Intergenic
1004331630 6:14727207-14727229 GTATGGGGGTGGAGGGAAATAGG + Intergenic
1004510050 6:16277884-16277906 CAGTGGGGAGGGAGGGGAGCAGG + Intronic
1005429872 6:25744290-25744312 CAGTGTGGATGGATTGCAATGGG + Intergenic
1005555054 6:26969109-26969131 CAGTAAAGATGGAGAGAAATAGG - Intergenic
1005587330 6:27289337-27289359 CAGTGTGGTTGGAGAGAAAGGGG - Intronic
1005602687 6:27443778-27443800 AAGTGGGGGTGGAGGGAGGTGGG - Intergenic
1005635991 6:27753526-27753548 AGGTGGGGGTGGAGGGAAAGGGG - Intergenic
1006390152 6:33753597-33753619 GAGTGGGGATGGAGGCAGATAGG + Intergenic
1006497134 6:34431870-34431892 CTGTGGTGATGGAGAGTAATGGG + Intergenic
1006880899 6:37338816-37338838 CAGAGAGGATGTAGAGAAATAGG - Intergenic
1007597871 6:43062736-43062758 CAGTGGAGGTAGTGGGAAATTGG + Intronic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1008654242 6:53595324-53595346 CAGTGGGCATTTAGGGACATGGG + Intronic
1008664007 6:53697894-53697916 CAGTGAGGATGGAGAGGAAGAGG + Intergenic
1008737063 6:54557913-54557935 TGGTGAGGATGCAGGGAAATAGG + Intergenic
1009600914 6:65797973-65797995 GTGTGGGGATGGAGCAAAATTGG + Intergenic
1009977723 6:70690852-70690874 CAGTGGGGAAGGGGGGAAGGGGG - Intronic
1012896045 6:104950727-104950749 AAGTGGGGGTGGGGGGAAAGGGG - Intergenic
1013004567 6:106060224-106060246 CAGTGAGGAAGGAGGAAAACAGG + Intergenic
1013299351 6:108789199-108789221 TGGTTGGGTTGGAGGGAAATTGG - Intergenic
1013708806 6:112873111-112873133 TAGTGAGGATGTAGAGAAATAGG + Intergenic
1013787177 6:113794957-113794979 CAGTGTGGATGGGGCCAAATGGG - Intergenic
1014265334 6:119270515-119270537 AAGAGGGGTTGGAGGGAAATGGG - Intronic
1015025880 6:128532001-128532023 AAGTGGGGGTGGGGGGAAAGTGG - Intergenic
1016446078 6:144133247-144133269 CAGTGTGAATGGAGGGAAAGTGG - Intergenic
1017073851 6:150600167-150600189 CAGTGGGGACGGAGGGCCTTGGG + Intronic
1018271193 6:162079659-162079681 AGGTGGGGAAGGAGGGAAGTGGG - Intronic
1018869618 6:167770869-167770891 CTGTCTGGATGGAGGGAAGTGGG - Intergenic
1019285791 7:222306-222328 CAGTGAGGATGGAGGGACTTGGG + Intronic
1020382820 7:7565670-7565692 GAGTGGGCATGGAGAGAAGTGGG - Intergenic
1021037768 7:15822035-15822057 CACAGGGGATCGAAGGAAATAGG - Intergenic
1021123147 7:16819717-16819739 GAGTGGGGAGGGAGGGAAGAGGG - Intronic
1021424547 7:20485079-20485101 AGGTGGGGATGGAGAGAAAAGGG + Intergenic
1021627645 7:22610081-22610103 TAGTGGAGATGGAGAGAAGTTGG - Intronic
1021925034 7:25526048-25526070 AACTGGGGCTGGAGGGAAAGGGG + Intergenic
1022922727 7:35032883-35032905 CTGTGGAGATGGAGAGAAATTGG - Intronic
1023765362 7:43505332-43505354 CAGTGGAGATGAAGTGAAGTGGG - Intronic
1023932087 7:44712253-44712275 CAGAGGTGTTGGAGGGAAATGGG + Intergenic
1024280768 7:47717688-47717710 CAGTGAGGAAGAAGAGAAATTGG + Intronic
1024337529 7:48224492-48224514 CAGTGGGGAAAGAGGGAAAGAGG - Intronic
1024454638 7:49589896-49589918 CAGTGGAGATGTAGAGAAATTGG + Intergenic
1024963565 7:55003248-55003270 CAGTGGGGGGGGGGGGGAATGGG - Intergenic
1025658888 7:63544614-63544636 CTTTGGATATGGAGGGAAATTGG - Intergenic
1027271291 7:76520548-76520570 CAGGGATGATGGAGAGAAATGGG - Intergenic
1027294163 7:76749906-76749928 CAGAGGAGAGGGAGGGAGATGGG - Intergenic
1027321055 7:77010483-77010505 CAGGGATGATGGAGAGAAATGGG - Intergenic
1027449269 7:78311275-78311297 CAGTGGGGAGGGTGGAAAAGAGG + Intronic
1027810120 7:82885671-82885693 GGGTAGGGATGAAGGGAAATGGG + Intronic
1028210079 7:88062849-88062871 CTGTGGAGAGGGAGGGAGATGGG + Intronic
1028600301 7:92593512-92593534 GAGTGGGAAGGGAGGGAAGTGGG - Intergenic
1029574664 7:101395558-101395580 CAGCGGGGCTGGAGGGAAAATGG + Intronic
1029676186 7:102070588-102070610 CTTTGGGTACGGAGGGAAATTGG + Intronic
1029676672 7:102074608-102074630 CAGTGGGAGTGGCGGGAATTTGG - Intronic
1029793701 7:102871907-102871929 CTGGGGGCAGGGAGGGAAATAGG - Intronic
1029876905 7:103763907-103763929 CAGTGGGCATGGAAAGAAAGGGG + Intronic
1030218120 7:107067332-107067354 AAGTGGAAATGGAGGGATATGGG + Intronic
1030230499 7:107203922-107203944 CAGTAGGGAAGCAGGGAAAAGGG - Intronic
1031026191 7:116682775-116682797 CAGTGGGCATGGCGAAAAATTGG - Intronic
1032169484 7:129572641-129572663 TAGTGGGGATGGAGAGATGTTGG + Intergenic
1032453095 7:132051592-132051614 TGGTGGGAATGAAGGGAAATAGG - Intergenic
1032549598 7:132772010-132772032 CCGTGGGGATGGGGGGAACTTGG + Intergenic
1032607533 7:133371867-133371889 CAGTAAGGATGCAGAGAAATTGG - Intronic
1032630160 7:133642423-133642445 CAAAGGGGATGGAGGGAAATAGG - Intronic
1032653457 7:133903411-133903433 CAGCAGAGATGGAGGGAACTGGG + Intronic
1033327611 7:140392474-140392496 CAGTGAGGATGGAGAGAAGAGGG - Intronic
1033422838 7:141218332-141218354 CAGTGGGGATGGAGGAAGGGAGG + Intronic
1035314301 7:157988642-157988664 CAGGGGGGCTGGAGGGAACCGGG + Intronic
1035582120 8:747009-747031 CAGTGGCTAGGAAGGGAAATGGG + Intergenic
1035605820 8:929222-929244 GAGTGGGAATGGCGGGGAATCGG - Intergenic
1035605871 8:929384-929406 GAGTGGGAATGGCGGGGAATCGG - Intergenic
1036693409 8:10959193-10959215 GAGTGGGGAGGGAGGGACACTGG - Intronic
1036778269 8:11628456-11628478 CAGTAGGGATGCAGGGAAGGGGG + Intergenic
1036988193 8:13560764-13560786 CTGTGGGGGGGGAGGGAAAAAGG + Intergenic
1037414414 8:18633897-18633919 CAGTGGGGCTGCAGAGAAAAGGG - Intronic
1037427281 8:18770111-18770133 CTGTGAGGTTGGAGGGAAACTGG - Intronic
1037659783 8:20916616-20916638 CAGTGGGTATGGGGGGAAACTGG + Intergenic
1038256751 8:25957478-25957500 CAGTGGGGATGGGAGGCAGTGGG - Intronic
1038914390 8:32004245-32004267 CAGTGGATGGGGAGGGAAATGGG + Intronic
1039103747 8:33967925-33967947 CAGTGGGGATGGAGCCAAGATGG - Intergenic
1039485356 8:37905481-37905503 CAGTGGGAAGGGAAGGAAAGGGG - Intergenic
1040756911 8:50787353-50787375 TAGTGAGGATGTAGAGAAATTGG + Intronic
1041090961 8:54300301-54300323 GGGTGGGGATGGGGGGAAACCGG + Intergenic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1042915379 8:73869991-73870013 CACTGGGGAAAGGGGGAAATAGG + Intronic
1043254472 8:78116591-78116613 CACTGGGGATTATGGGAAATAGG + Intergenic
1043387095 8:79759161-79759183 TAGTGGGAATGTAGGGATATTGG - Intergenic
1043814212 8:84781693-84781715 CAGTGGGAATTGAGGGAGGTGGG + Intronic
1044094977 8:88052412-88052434 CAGTGGAGATGGAGCAAAGTGGG - Intronic
1044604819 8:94039433-94039455 CAGTGGAGATGGAGAGAGATGGG + Intergenic
1044613675 8:94118758-94118780 CTGAGGGGATGGAGAAAAATGGG + Intergenic
1044624528 8:94223787-94223809 GAGGGGGGATGGAGGGAAAATGG + Intergenic
1045322199 8:101090801-101090823 CAGTGGGGATGGAGAGAATTGGG + Intergenic
1046164903 8:110419815-110419837 CAGGGAGGAAAGAGGGAAATTGG + Intergenic
1046167551 8:110457048-110457070 AACTGGGGATGAAGAGAAATGGG + Intergenic
1046437581 8:114212228-114212250 GAATGGGGGTGGAGGGAAAGAGG + Intergenic
1046816954 8:118595792-118595814 CTGTGGGGAAGGAGGAAAAGAGG - Intronic
1047096984 8:121636440-121636462 CAGTGGGACTGGAGAGAAAAAGG - Intronic
1047182296 8:122600630-122600652 GAATGGGGAGAGAGGGAAATGGG + Intergenic
1047212980 8:122854545-122854567 CAGGGTGGAAGGAGGGAAAGAGG - Intronic
1047217598 8:122889360-122889382 TGGTGAGGATGCAGGGAAATGGG - Intronic
1047346873 8:124037475-124037497 CAGTGGGGACAGAGGGACAGTGG + Intronic
1048001992 8:130386205-130386227 CAGTGGTGATGCAGAGAAAAGGG + Intronic
1048065140 8:130960114-130960136 CAGTGGAGATGGAGAAACATGGG + Intronic
1048235582 8:132686658-132686680 CAGTGGTGATAGAGGGAAGTGGG + Intronic
1048251705 8:132871501-132871523 CAGAGGGGATGGAGGTGTATGGG + Exonic
1048275551 8:133063106-133063128 CACTGGAGATGGTGGCAAATGGG - Intronic
1048377257 8:133833654-133833676 GTGTGGGTATGGAGGGAATTGGG - Intergenic
1048460379 8:134616384-134616406 AAGTGAGGATATAGGGAAATTGG - Intronic
1048550422 8:135428244-135428266 CACTGGGGCTGGAGGGACAAGGG - Intergenic
1048798407 8:138172865-138172887 GAGTGGGCAGGGAGGGGAATGGG - Intronic
1048872808 8:138812899-138812921 CAGAGAGGATGGGAGGAAATGGG - Intronic
1049776476 8:144408184-144408206 TGGTGGGGATGGAGGGAGGTAGG - Intronic
1050614423 9:7387434-7387456 CAGTGGGTATGGTGTGAGATAGG - Intergenic
1052316731 9:27123179-27123201 AAGTGGGAAGGGAGGGAGATGGG + Intronic
1052323155 9:27190166-27190188 CAGTGGGACTGGAGGGTACTAGG + Intronic
1052335475 9:27315083-27315105 CAGAGGGGCTGGAGGGAAAGGGG + Intergenic
1052916204 9:33925950-33925972 CTGTGGGGACAGAGGGGAATAGG - Intronic
1053789774 9:41678717-41678739 CTGTGGGGATGCAGAGTAATAGG - Intergenic
1053800636 9:41762353-41762375 CAGTGGGGATGAGGGGGACTTGG - Intergenic
1054144557 9:61552482-61552504 CAGTGGGGATGAGGGGGACTTGG + Intergenic
1054155367 9:61636036-61636058 CTGTGGGGATGCAGAGTAATAGG + Intergenic
1054178114 9:61890407-61890429 CTGTGGGGATGCAGAGTAATAGG - Intergenic
1054189067 9:61974505-61974527 CAGTGGGGATGAGGGGGACTTGG - Intergenic
1054464245 9:65483441-65483463 CAGTGGGGATGAGGGGGACTTGG + Intergenic
1054475153 9:65567147-65567169 CTGTGGGGATGCAGAGTAATAGG + Intergenic
1054649453 9:67614112-67614134 CAGTGGGGATGAGGGGGACTTGG + Intergenic
1054659415 9:67690417-67690439 CTGTGGGGATGCAGAGTAATAGG + Intergenic
1054752981 9:68927404-68927426 CAGTGAGGATGTAGAGAAACTGG - Intronic
1055156739 9:73072041-73072063 TAGTGGGGATGCAGTGAAAAGGG + Intronic
1055343336 9:75308702-75308724 CAGTGGGGAGGGATGGAACAGGG + Intergenic
1056181969 9:84093620-84093642 CAGTGGGGAAGAAGGTAATTTGG + Intergenic
1057778798 9:98033430-98033452 GGGTGGGGCTGGAGGGAAGTGGG + Intergenic
1057787319 9:98096709-98096731 CAGTGGGGATGGGGAGAAACAGG - Intronic
1057884982 9:98823185-98823207 CACTGGGGATGGAGTGACAAAGG - Intronic
1058061968 9:100507014-100507036 CAGTGGGGAGAGAGGGAGAAAGG - Intronic
1058266482 9:102905238-102905260 CGGTGAGGATGCAGAGAAATAGG + Intergenic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059177153 9:112177554-112177576 CAGTGGGGATGAAGTGGTATAGG - Intergenic
1059975814 9:119715762-119715784 AGGTGGGGAGGGAGGGAAAGGGG + Intergenic
1060960364 9:127676474-127676496 CAGAGTGGCTGGAGGGGAATCGG + Intronic
1061459489 9:130725235-130725257 AAGTGGGGAAAGAGGGAAATGGG - Intronic
1062318198 9:135978380-135978402 CAGGGGGGATGGTGGGGGATGGG - Intergenic
1062675123 9:137738413-137738435 CAGTGAGGATGCGGAGAAATGGG + Intronic
1186137003 X:6532715-6532737 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186163865 X:6806070-6806092 CAGTGGGAATGGATGGAGATAGG + Intergenic
1186267282 X:7844583-7844605 ATGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186297707 X:8169068-8169090 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186325152 X:8467403-8467425 GTGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186376413 X:9006799-9006821 GAGGTGGGATGGAGGGAAGTGGG - Intergenic
1187464997 X:19519207-19519229 CAGTGGGGCTGGGGGGAGGTAGG - Intergenic
1187654883 X:21460674-21460696 CAGTGGGGGTGGAGGAGAAGTGG - Intronic
1187715888 X:22102201-22102223 CAGAGGGGAAGGAGGGAAGGAGG - Intronic
1187747849 X:22429134-22429156 CAGTAGGGATCTAGGGAAATGGG - Intergenic
1189331809 X:40148770-40148792 CATTGGCAAAGGAGGGAAATGGG + Intronic
1189338681 X:40187487-40187509 CAGAGTGGATGGAGGGAAATGGG + Intergenic
1189351117 X:40276545-40276567 CAGTGGGGGTGGGAGGAATTAGG + Intergenic
1189372380 X:40439031-40439053 AAGTGGAGAGGGAGGGAAAGGGG + Intergenic
1189780208 X:44506763-44506785 CGCTGGGGAAGGAGGGAAAGGGG + Intergenic
1189809954 X:44772713-44772735 TAGTGGTGATGGAGAGAAAAAGG - Intergenic
1190583211 X:51908853-51908875 CACTGGGGATGCGGAGAAATTGG - Intergenic
1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG + Intronic
1191754729 X:64581329-64581351 CAGTTGGGATGGGGTGGAATTGG - Intergenic
1191960767 X:66699342-66699364 CAGTGGGAAAGGATGGAAATGGG - Intergenic
1192602897 X:72483459-72483481 CAGTCGTGATGGAGGGCAAAGGG - Intronic
1192658500 X:73017974-73017996 CAGTGAGGATGCAGAGAAAAGGG - Intergenic
1193644263 X:84047597-84047619 CAGTGGGCTTGGAGGGGAGTGGG - Intergenic
1193671466 X:84391583-84391605 TAGTGAGGATGCAGAGAAATAGG - Intronic
1194634478 X:96327611-96327633 GGGTAGGGATGGAGGGGAATTGG - Intergenic
1195405233 X:104505457-104505479 CACTGAGGCTGGAGTGAAATGGG + Intergenic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195522308 X:105845395-105845417 AAGTGGGGAAAGAGAGAAATAGG + Intronic
1195808080 X:108798051-108798073 TAGTGGGGATTGAGGGAGCTTGG - Intergenic
1195958537 X:110360810-110360832 CAGTGGGAATGGAAGGAAAATGG + Intronic
1196903224 X:120407134-120407156 AAGTGGGGATGGATAGAAATGGG - Intergenic
1196997914 X:121404264-121404286 CAGTGGGGATAGAGGGGATGGGG - Intergenic
1197215188 X:123860326-123860348 GAGAGGGGAAGGAGGGAAAGCGG - Intronic
1197254318 X:124246660-124246682 TGTTGGGGATGTAGGGAAATGGG - Intronic
1197973460 X:132139438-132139460 CAGTGAGGATGCAGAGAAAAGGG - Intergenic
1198134673 X:133736718-133736740 CAGGGGAGATGGAGAGTAATAGG + Intronic
1198878885 X:141257303-141257325 CAGTGGGGTGGAAGGAAAATTGG + Intergenic
1199264872 X:145818178-145818200 CAGTGGGGATTGAGGGTAGAGGG - Exonic
1199282103 X:146013988-146014010 GAGGAGGGAGGGAGGGAAATGGG + Intergenic
1199852607 X:151736363-151736385 CCTTGGGGTTGGAGGGCAATGGG + Intergenic
1200271058 X:154683864-154683886 GTTTGGGGATGGAGAGAAATTGG + Intronic
1202370231 Y:24191255-24191277 CAGTGGTGCTGCAGAGAAATTGG + Intergenic
1202500553 Y:25478862-25478884 CAGTGGTGCTGCAGAGAAATTGG - Intergenic