ID: 1126465334

View in Genome Browser
Species Human (GRCh38)
Location 15:48956477-48956499
Sequence TGGACTTGGTGTCCAACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 111}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126465334_1126465337 -8 Left 1126465334 15:48956477-48956499 CCTCCTGTTGGACACCAAGTCCA 0: 1
1: 0
2: 0
3: 9
4: 111
Right 1126465337 15:48956492-48956514 CAAGTCCAGTCAGACCTAGCTGG 0: 1
1: 0
2: 0
3: 5
4: 114
1126465334_1126465340 6 Left 1126465334 15:48956477-48956499 CCTCCTGTTGGACACCAAGTCCA 0: 1
1: 0
2: 0
3: 9
4: 111
Right 1126465340 15:48956506-48956528 CCTAGCTGGCCAGACACATGAGG 0: 1
1: 0
2: 1
3: 8
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126465334 Original CRISPR TGGACTTGGTGTCCAACAGG AGG (reversed) Intronic
900322744 1:2093214-2093236 TGCACCTGGTGTCCACCAGGAGG - Intronic
906344141 1:45004704-45004726 TGTACTGAGTGACCAACAGGTGG - Exonic
908797956 1:67850219-67850241 TTGGCTGGGTGTCCACCAGGTGG + Intergenic
911215214 1:95185551-95185573 TGGACTTGCTGTCGCAAAGGTGG - Intronic
917417514 1:174826003-174826025 TGAGCTTGGTGCGCAACAGGTGG + Intronic
919300812 1:195763340-195763362 TGGACCAGGTGTACCACAGGCGG - Intergenic
919314697 1:195956174-195956196 TGGTCTTGGTGTCCCAGGGGTGG + Intergenic
920633989 1:207680974-207680996 TGGAGTTGGTGTCTTCCAGGTGG + Intronic
924177242 1:241403791-241403813 GAGACTTGGTGTCCAACATATGG - Intergenic
924910111 1:248500801-248500823 TGGTCTTGGTGCCCAACACTAGG - Intergenic
924913990 1:248547246-248547268 TGGTCTTGGTGCCCAACACTAGG + Intergenic
1062983067 10:1741898-1741920 TGAACTTGGTGTAAAGCAGGCGG + Intergenic
1064244239 10:13656738-13656760 TGGAGCTGGTGTGCGACAGGCGG + Exonic
1067155850 10:43780564-43780586 TGGCCTTGGTGTCCAGCTGGGGG - Intergenic
1071747291 10:88436426-88436448 TGGATTTGCTGTGGAACAGGGGG - Intronic
1077539049 11:3138151-3138173 TGGGCCTGGTGTCCATCAGGAGG - Intronic
1085205282 11:74728023-74728045 TGGAATTGGTGTTCAACCTGTGG + Intronic
1085337361 11:75706392-75706414 TGGACTTGGTGCCCAGCGTGGGG - Intergenic
1088356313 11:108947649-108947671 TGGAAATGGTGTCCAAAAGTTGG - Intergenic
1088693967 11:112350415-112350437 TGGACCTGGAGTCGGACAGGTGG + Intergenic
1088904565 11:114144581-114144603 TGGGCATGGTGTCCCACAGCAGG - Intronic
1090315189 11:125780119-125780141 TGGACTTGCTGCCCACCTGGAGG + Intergenic
1090785991 11:130047991-130048013 TGGCCTAGGTGTCAAACAGCAGG + Intergenic
1092108870 12:5945153-5945175 TGGTCCTGGTCTCCTACAGGTGG - Intronic
1093525747 12:20102229-20102251 TGGGCATGGTGGACAACAGGAGG - Intergenic
1098092146 12:66915116-66915138 TGGACTTTCTGTCCAATATGTGG - Intergenic
1103523017 12:121548951-121548973 TGGACTGGGTGGACAACATGTGG - Exonic
1104045375 12:125158913-125158935 TGAACTTCCTGCCCAACAGGAGG + Intergenic
1104635613 12:130436546-130436568 TGGCCTTGGTGTGCGACAAGGGG - Intronic
1108498010 13:51044179-51044201 TGGCCTTTTTGTTCAACAGGTGG - Intergenic
1112992334 13:105528959-105528981 TTGACTTCTTGTCCAACAGAAGG - Intergenic
1115946874 14:38671882-38671904 TGATCTTGGTGACCTACAGGTGG - Intergenic
1120422303 14:84303223-84303245 TGGACCAGGTGTACCACAGGTGG - Intergenic
1120536382 14:85701161-85701183 TGGAATTGGTGTGGAACCGGGGG - Intergenic
1121268747 14:92623526-92623548 TGAAATTGGAGTCCCACAGGGGG - Intronic
1121568317 14:94927130-94927152 AGGACTTGGAGTCCAATAGAAGG - Intergenic
1123454140 15:20401712-20401734 TGGACCTGGTGCCCATCAGTCGG + Intergenic
1125736760 15:41932499-41932521 TCGATTTGGATTCCAACAGGAGG + Intronic
1126054631 15:44718523-44718545 TAGATTTGGTGTCCAAGAAGGGG - Exonic
1126465334 15:48956477-48956499 TGGACTTGGTGTCCAACAGGAGG - Intronic
1126705380 15:51400908-51400930 TGGGCTCTCTGTCCAACAGGTGG - Intronic
1128479112 15:68022199-68022221 TGTACTTGGAGTCAGACAGGAGG + Intergenic
1129001526 15:72339205-72339227 TGTATTTGGTGTCCGAGAGGAGG + Intronic
1132023843 15:98387845-98387867 TGGACTTGGAATCCAAAAGTAGG + Intergenic
1132558977 16:584851-584873 TGGACTTGGTGGGCAGCTGGAGG - Intergenic
1134062498 16:11207608-11207630 TGGACTTGGGGTGCAGCAGAGGG + Intergenic
1135920115 16:26642252-26642274 GGGACTTGGCTTCCAAGAGGTGG - Intergenic
1139965659 16:70744060-70744082 CGGTCTTGGGGTCTAACAGGTGG - Intronic
1143457152 17:7075742-7075764 TGGAGTTGATGACCACCAGGTGG + Exonic
1147847714 17:43416713-43416735 TGGACATGGTGACCAGCATGGGG - Intergenic
1150006140 17:61470140-61470162 TCATCTTGGGGTCCAACAGGTGG + Intronic
1152252431 17:79219019-79219041 TGGACTGTGGGTCCAGCAGGGGG - Intronic
1153608283 18:6855811-6855833 TGGACCAGGTGTACCACAGGTGG - Intronic
1153845114 18:9042548-9042570 TGGGATAGGTGTCCAAAAGGAGG - Intergenic
1155409013 18:25521563-25521585 TAGCCTAAGTGTCCAACAGGAGG - Intergenic
1156156941 18:34314414-34314436 TGGACTTGGTGATCAAGAAGTGG - Intergenic
1157926869 18:51776252-51776274 TGGTCTTGCTGTCCCAGAGGGGG + Intergenic
1160249810 18:77192364-77192386 TGGACAAAGTCTCCAACAGGTGG + Intergenic
1162029439 19:7911102-7911124 TGGCTTTGGAGTCCACCAGGCGG - Exonic
925406031 2:3605906-3605928 TCCACTTGGTTTCCAACAGCAGG - Intronic
927921727 2:26977704-26977726 TGGACCTGGTGTGGCACAGGGGG - Intronic
929026400 2:37607557-37607579 TGGTCTTGGTGTCTTAGAGGTGG + Intergenic
932775843 2:74527936-74527958 TGCACTCCGTGTACAACAGGTGG - Exonic
935368640 2:102321274-102321296 TGGAATTCATGTCCTACAGGAGG - Intronic
936978527 2:118242568-118242590 TGGACATGCTGTCCAGCTGGGGG + Intergenic
937263309 2:120600295-120600317 TGGGCTTGCTGGCCAACAGGTGG - Intergenic
948533543 2:238629648-238629670 TGGACTTCATGTCCACCTGGAGG + Intergenic
1170644582 20:18186129-18186151 TGTCCTTGGTGCCCAACATGAGG + Intronic
1172903799 20:38354338-38354360 AGGACTCGCTGCCCAACAGGAGG - Exonic
1174177987 20:48657044-48657066 TGGCCTTCGTGGCCACCAGGAGG + Exonic
1175295309 20:57904253-57904275 TGGTCTTGCTGTCCCAGAGGTGG - Intergenic
1175392310 20:58635211-58635233 TGGACTTGGTGGCCCATAAGAGG - Intergenic
1176948352 21:15012167-15012189 TGGACTGTGTCTCCAAAAGGAGG - Intronic
1184149189 22:42628655-42628677 GGGACTGAGTGTCCACCAGGAGG - Intronic
1184390697 22:44201495-44201517 TGGACTTGGTTCCCAAGAGCTGG + Intronic
1184785650 22:46670459-46670481 AGGCCTAGGGGTCCAACAGGAGG - Intronic
1185045247 22:48525407-48525429 TGGAATCGGAGTCCAGCAGGCGG - Intronic
949103087 3:169428-169450 TGGTCTTGGTGTCGCAGAGGTGG + Intergenic
952488430 3:33840350-33840372 TGGTCTTGCTGTCTTACAGGTGG + Intronic
954130027 3:48556199-48556221 TGGGCTAGTTTTCCAACAGGAGG - Intronic
956037083 3:65105364-65105386 TGGGCTTGGTGTACAAGAGAAGG - Intergenic
956259394 3:67321718-67321740 TGGCCTTGGAGTCCAAGATGAGG - Intergenic
964562505 3:158013207-158013229 TGGCCTTGGTGCCTAAAAGGAGG + Intergenic
965323409 3:167273823-167273845 TGCAATTGGAGTCCCACAGGGGG + Intronic
966866429 3:184261180-184261202 AGGAGTTGGTGTCCTGCAGGCGG + Exonic
966926199 3:184646139-184646161 TGGGCTTGGGGTGCAGCAGGCGG + Intronic
969667883 4:8572511-8572533 AGGGCTTGGAGTCCAACAGTGGG + Intronic
969693965 4:8724597-8724619 TGGAGGTGGTGTCCACCAGCAGG + Intergenic
973990372 4:56400142-56400164 TGGACTTGCTGTCCCAGGGGTGG - Intronic
986676710 5:10191817-10191839 TGGAATTGATGTCCAAGAGTGGG + Intergenic
990294071 5:54382425-54382447 TGGACTTGGCTTCCCACAGTAGG - Intergenic
991435690 5:66596003-66596025 TGGACTTTGTCTCCAAAAAGTGG - Intergenic
996106395 5:119509371-119509393 TGGTCTTGGTGTCCCAGGGGTGG - Intronic
999672215 5:153967760-153967782 TGGTCTTGCTGTCTAAGAGGTGG + Intergenic
1002372119 5:178763178-178763200 TGAACTTCTTGCCCAACAGGAGG - Intergenic
1004913482 6:20308996-20309018 TGGAGTGGGAGTCCAATAGGAGG + Intergenic
1004954690 6:20716409-20716431 TGTACTTTCTGTCCAACAGCAGG - Intronic
1007175369 6:39892706-39892728 TGGCCCTGGTGTCCAGCAGGGGG - Intronic
1009810193 6:68652442-68652464 CTGTCTTGATGTCCAACAGGGGG - Intronic
1013108168 6:107043691-107043713 TGGACTTGCTGTCTCAGAGGTGG + Intronic
1019700298 7:2471563-2471585 TGGCCTTTGTGTCCACCGGGAGG - Intergenic
1024048253 7:45599974-45599996 TGGAGGTGGTGGCCAACATGTGG + Intronic
1029111500 7:98215020-98215042 TGGCCTTGGGGTCCAAGAGGAGG - Exonic
1034385183 7:150735074-150735096 TGAATTTGGTGTCAAACAGAAGG + Intronic
1036387883 8:8297570-8297592 TGGACGTGGGGTCTAACGGGAGG + Intergenic
1036411251 8:8503729-8503751 TAGACTTGGAATCCTACAGGAGG + Intergenic
1040062696 8:43117468-43117490 TGGTCTTGGTATCCAAGGGGTGG + Intronic
1045996404 8:108367113-108367135 TGGACATGGTGTCCAACCTCAGG - Intronic
1049696965 8:143988988-143989010 TGGACTGGTTGTCCAGCTGGGGG + Intronic
1051978713 9:22986749-22986771 TGCACTTGGTGTCCACTAGGAGG - Intergenic
1053397035 9:37784795-37784817 CGCACTTGGTGACCAGCAGGCGG + Exonic
1057197182 9:93121646-93121668 TGGGCTTGGTGGCCATCAAGAGG - Exonic
1057605047 9:96493034-96493056 TGGACTTGCTGATCAACAGAAGG - Intronic
1057705673 9:97393338-97393360 TGGACTGGGTATTCAATAGGTGG - Intergenic
1061679920 9:132237930-132237952 AGGACTAGGTGGCCCACAGGTGG + Intronic
1061948486 9:133922057-133922079 TGGGCTTGGGGTCCAGCAGGCGG - Intronic
1190929450 X:54935233-54935255 TGGACTGGGTGTCCTGCAGGAGG + Intronic
1195242178 X:102963081-102963103 TGGACCTGGTGACAAATAGGTGG + Intergenic
1195296730 X:103485883-103485905 TGAACCTGGTGACCAAAAGGTGG + Intergenic
1196082783 X:111650324-111650346 TGGTCTTGGTGTCTCAGAGGTGG + Intergenic
1201494708 Y:14580430-14580452 TGGAAATGGTTTCCAACAGTTGG + Intronic