ID: 1126467319

View in Genome Browser
Species Human (GRCh38)
Location 15:48972950-48972972
Sequence CAGCTCGGACAGCTTAGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 5, 3: 18, 4: 68}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126467319_1126467330 18 Left 1126467319 15:48972950-48972972 CCAAGACTAAGCTGTCCGAGCTG 0: 1
1: 0
2: 5
3: 18
4: 68
Right 1126467330 15:48972991-48973013 GCCAAGCAGGACATGGCACATGG 0: 1
1: 0
2: 1
3: 12
4: 217
1126467319_1126467324 -4 Left 1126467319 15:48972950-48972972 CCAAGACTAAGCTGTCCGAGCTG 0: 1
1: 0
2: 5
3: 18
4: 68
Right 1126467324 15:48972969-48972991 GCTGGAGGCCGCCCAGCAGCGGG 0: 1
1: 13
2: 19
3: 53
4: 381
1126467319_1126467332 23 Left 1126467319 15:48972950-48972972 CCAAGACTAAGCTGTCCGAGCTG 0: 1
1: 0
2: 5
3: 18
4: 68
Right 1126467332 15:48972996-48973018 GCAGGACATGGCACATGGCACGG 0: 1
1: 0
2: 5
3: 39
4: 368
1126467319_1126467329 11 Left 1126467319 15:48972950-48972972 CCAAGACTAAGCTGTCCGAGCTG 0: 1
1: 0
2: 5
3: 18
4: 68
Right 1126467329 15:48972984-48973006 GCAGCGGGCCAAGCAGGACATGG 0: 13
1: 9
2: 21
3: 34
4: 222
1126467319_1126467323 -5 Left 1126467319 15:48972950-48972972 CCAAGACTAAGCTGTCCGAGCTG 0: 1
1: 0
2: 5
3: 18
4: 68
Right 1126467323 15:48972968-48972990 AGCTGGAGGCCGCCCAGCAGCGG 0: 1
1: 14
2: 14
3: 33
4: 254
1126467319_1126467326 5 Left 1126467319 15:48972950-48972972 CCAAGACTAAGCTGTCCGAGCTG 0: 1
1: 0
2: 5
3: 18
4: 68
Right 1126467326 15:48972978-48973000 CGCCCAGCAGCGGGCCAAGCAGG 0: 1
1: 9
2: 13
3: 27
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126467319 Original CRISPR CAGCTCGGACAGCTTAGTCT TGG (reversed) Intergenic
904878815 1:33678662-33678684 CAGCTCGGTCAGCTTAGAGGGGG - Intronic
905706547 1:40064222-40064244 CAAATCGGAAAGCTTATTCTAGG - Exonic
906004485 1:42456858-42456880 CAGAGCGGACAGCCAAGTCTGGG - Exonic
906223701 1:44103709-44103731 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
909232283 1:73105878-73105900 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
915619812 1:157074298-157074320 CAGCTCGGACAACTTGGCGTTGG - Intergenic
920715413 1:208335831-208335853 CAGCTAGGAAAGCTTTGTTTTGG - Intergenic
923066006 1:230517987-230518009 CAGCTCAGCCAGCTTAGTCCAGG - Intergenic
1063714539 10:8514070-8514092 CAGCTCAGACACCTTGGTGTTGG + Intergenic
1065962206 10:30742811-30742833 CATCTCTGACTGCTCAGTCTGGG + Intergenic
1067210343 10:44255770-44255792 AAGCTTTGAAAGCTTAGTCTAGG - Intergenic
1068939848 10:62670122-62670144 CAGCTGGGCCAGCCCAGTCTTGG + Intronic
1071427324 10:85571952-85571974 AAGCTCAGACAGCTTAAACTGGG + Intergenic
1073135436 10:101217654-101217676 CAGCCTGGAGAGCCTAGTCTGGG - Intergenic
1073303966 10:102488335-102488357 CAGCTTGCACTGCTTAGTCTTGG - Intronic
1077730330 11:4723118-4723140 CAGCTCGGACAGCTTGGAGTTGG + Intronic
1082825000 11:57571104-57571126 CAGCTGGCAGAGCTCAGTCTTGG - Intergenic
1084091691 11:66883028-66883050 GAGCCCGGACAGCTGAGCCTCGG - Intronic
1084263230 11:67991840-67991862 CAGCACCGCCAGCTTAGCCTGGG + Exonic
1084810172 11:71607287-71607309 CAGCACCGCCAGCTTAGCCTGGG - Intergenic
1095986996 12:48005298-48005320 CAGCTTGCACCGTTTAGTCTCGG - Intergenic
1096518728 12:52172332-52172354 CAGCTGGGCCAGCTTGGTCTTGG + Exonic
1096569957 12:52516771-52516793 CAGCTCGGCCAGCTTGTTCCTGG + Exonic
1096626435 12:52898813-52898835 CAGCTCGGACAACTTGGCGTTGG + Exonic
1097615571 12:61880368-61880390 CAGCTCCAACAGCTTGGTGTTGG - Intronic
1098264703 12:68706675-68706697 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1107470601 13:40687930-40687952 CAGAACAGCCAGCTTAGTCTTGG + Intergenic
1113734067 13:112664563-112664585 CATCCCAGACAGCTTAGACTTGG + Intronic
1115951625 14:38728077-38728099 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
1116326902 14:43541259-43541281 CAGCTCGGACAGCTTGGCCTTGG + Intergenic
1118697394 14:68398131-68398153 CAGCTGGGACAGCTAAAGCTGGG + Intronic
1125841030 15:42801347-42801369 CAGCTCAGACAGCTTGGCATTGG + Intronic
1126467319 15:48972950-48972972 CAGCTCGGACAGCTTAGTCTTGG - Intergenic
1128842243 15:70859758-70859780 CAGCTCGGACAGCTTGGCGTTGG - Intronic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1135605446 16:23820371-23820393 CAGCTAGGACTGCATGGTCTAGG - Intergenic
1137410302 16:48222570-48222592 CAGCTGGGACTGCCTATTCTGGG - Intronic
1140569301 16:76084556-76084578 CAGCTCTGAAAGCTCTGTCTTGG + Intergenic
1140753718 16:78048831-78048853 CAGCTTGGACAGCTTGGCGTTGG + Intronic
1144090731 17:11853998-11854020 CAGCTCTGTCAGGTTGGTCTGGG - Exonic
1144339238 17:14298680-14298702 GAGCTCCCACAGCTAAGTCTCGG - Intergenic
1146429692 17:32780124-32780146 CAGCTCTGAAAGCTTATTTTTGG + Intronic
1157063555 18:44321169-44321191 CAGCTCGGACAGCTTGGTGTTGG + Intergenic
1157292051 18:46416708-46416730 CAGCTGGGACAGATGGGTCTAGG + Intronic
1167234168 19:48303696-48303718 CAGCTGGGACAGTTTATTCAGGG + Exonic
939169793 2:138681597-138681619 CAGCTCATTCAGCTTAGTCCTGG - Intronic
942558646 2:177198147-177198169 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
943969563 2:194386163-194386185 CCTCTCTGACAGCTGAGTCTGGG - Intergenic
944763445 2:202840715-202840737 CAGCTCGGAGAGCTTGGCATTGG + Intronic
946320879 2:218953774-218953796 CAGCTCAGACAGCTTGGTGTTGG + Intergenic
1170207780 20:13817924-13817946 AAGCTCAGACAGCTTAGGATAGG + Exonic
1170747119 20:19109732-19109754 CAGCCATGACAGCTTAGTCTCGG - Intergenic
1173511306 20:43630983-43631005 CAGCTGGGATAGCTGAGGCTAGG + Intronic
1175069221 20:56317635-56317657 CAGCTTGGAAAGCATATTCTGGG + Intergenic
1183168893 22:36169979-36170001 AAGCTCGGAGAGCACAGTCTTGG + Intergenic
950904336 3:16524203-16524225 CAGCTCAGAAAGCCAAGTCTTGG - Intergenic
952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
954426588 3:50446605-50446627 CAGCGGGGTCAGCTGAGTCTCGG + Intronic
955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
957966175 3:87324309-87324331 CAGCTCATACAGCTTGGTGTTGG - Intergenic
962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG + Intronic
969732118 4:8963665-8963687 CAGCACCGCCAGCTTAGCCTGGG - Intergenic
969791713 4:9497750-9497772 CAGCACCGCCAGCTTAGCCTGGG - Intergenic
972281155 4:37603289-37603311 CAGCTGGGACTTCTTTGTCTTGG - Intronic
977928671 4:102729106-102729128 CAGCTTGGACAGCTTGGCGTTGG + Intronic
983008479 4:162515894-162515916 TAGCTGGGAGATCTTAGTCTGGG - Intergenic
990900488 5:60743939-60743961 CAGCTCAGACAGCTTGGCGTTGG + Intergenic
993791362 5:92215522-92215544 CAGCTTGCACAGCCTATTCTGGG + Intergenic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
998887174 5:146706559-146706581 CAGCTCGGACAGCTTAGCGTTGG + Intronic
1005315506 6:24599398-24599420 CAGCTTGGACAGCTTGGCATTGG - Intronic
1015496621 6:133889729-133889751 CAGCTTGGAGAGCTTGGTGTCGG - Exonic
1015539190 6:134297356-134297378 CAGCTCAGACAGCTTGGCGTTGG + Intronic
1018317263 6:162569322-162569344 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1020309168 7:6855780-6855802 CAGCACCGCCAGCTTAGCCTGGG + Intergenic
1021859853 7:24895568-24895590 CACCTGGGATACCTTAGTCTTGG - Intronic
1022189116 7:27999798-27999820 CAGCTCAGACAGCTCTGCCTTGG + Intronic
1023289658 7:38656239-38656261 CAGCTCAGACAGCTTGGCTTTGG - Intergenic
1035944418 8:3944855-3944877 CAGCTCTGACAGTTGATTCTGGG + Intronic
1036696363 8:10977576-10977598 CAGCCAGGACAGCTGAGGCTGGG + Intronic
1041781144 8:61579265-61579287 CAGCTCGGACAACTTGGCGTTGG - Intronic
1042271541 8:66961502-66961524 CAGCTTGGACAGCTTGGTGTCGG + Exonic
1042561760 8:70077099-70077121 ATGCTCAGACAGATTAGTCTTGG - Intergenic
1042722867 8:71843741-71843763 CAGCTTGGAGAGCTTAGTGTCGG + Exonic
1043344141 8:79279423-79279445 CAGTTCAGATAGCTTTGTCTTGG + Intergenic
1048415557 8:134224255-134224277 CAGCTCCCACAGCTATGTCTGGG + Intergenic
1052843165 9:33311036-33311058 CAGCTGGGACAGCTTTGTTCGGG + Intronic
1057943653 9:99306205-99306227 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
1187063889 X:15814252-15814274 CAGCCTGGTCAGCTTAGCCTTGG + Intronic
1188145065 X:26602039-26602061 CAGATCTGAAAGCTCAGTCTCGG - Intergenic
1189893782 X:45632671-45632693 CAGCTCGGACAACTTGGCCTTGG + Intergenic
1199406159 X:147463176-147463198 CAGCTCTGACAGCTGAGTGGAGG - Intergenic