ID: 1126467495

View in Genome Browser
Species Human (GRCh38)
Location 15:48974105-48974127
Sequence TGAAAAGCAAATGAAAGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126467495_1126467499 8 Left 1126467495 15:48974105-48974127 CCAAGACTTTCATTTGCTTTTCA No data
Right 1126467499 15:48974136-48974158 TTCTCTGGGTAGAATCACACTGG No data
1126467495_1126467500 13 Left 1126467495 15:48974105-48974127 CCAAGACTTTCATTTGCTTTTCA No data
Right 1126467500 15:48974141-48974163 TGGGTAGAATCACACTGGCAAGG No data
1126467495_1126467501 16 Left 1126467495 15:48974105-48974127 CCAAGACTTTCATTTGCTTTTCA No data
Right 1126467501 15:48974144-48974166 GTAGAATCACACTGGCAAGGTGG No data
1126467495_1126467502 27 Left 1126467495 15:48974105-48974127 CCAAGACTTTCATTTGCTTTTCA No data
Right 1126467502 15:48974155-48974177 CTGGCAAGGTGGTTAGACAGAGG No data
1126467495_1126467497 -7 Left 1126467495 15:48974105-48974127 CCAAGACTTTCATTTGCTTTTCA No data
Right 1126467497 15:48974121-48974143 CTTTTCAGTTAGGTTTTCTCTGG No data
1126467495_1126467498 -6 Left 1126467495 15:48974105-48974127 CCAAGACTTTCATTTGCTTTTCA No data
Right 1126467498 15:48974122-48974144 TTTTCAGTTAGGTTTTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126467495 Original CRISPR TGAAAAGCAAATGAAAGTCT TGG (reversed) Intergenic
No off target data available for this crispr