ID: 1126467501

View in Genome Browser
Species Human (GRCh38)
Location 15:48974144-48974166
Sequence GTAGAATCACACTGGCAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126467495_1126467501 16 Left 1126467495 15:48974105-48974127 CCAAGACTTTCATTTGCTTTTCA No data
Right 1126467501 15:48974144-48974166 GTAGAATCACACTGGCAAGGTGG No data
1126467494_1126467501 26 Left 1126467494 15:48974095-48974117 CCAAGTGTAGCCAAGACTTTCAT No data
Right 1126467501 15:48974144-48974166 GTAGAATCACACTGGCAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126467501 Original CRISPR GTAGAATCACACTGGCAAGG TGG Intergenic
No off target data available for this crispr