ID: 1126467695

View in Genome Browser
Species Human (GRCh38)
Location 15:48975943-48975965
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126467695_1126467703 -5 Left 1126467695 15:48975943-48975965 CCCGGGCTGTGCCCTTCTCGAGA No data
Right 1126467703 15:48975961-48975983 CGAGAAGCCCGGCCGGGCGGCGG No data
1126467695_1126467710 25 Left 1126467695 15:48975943-48975965 CCCGGGCTGTGCCCTTCTCGAGA No data
Right 1126467710 15:48975991-48976013 GTCTGGTCCGCGCTTTCGCACGG No data
1126467695_1126467702 -8 Left 1126467695 15:48975943-48975965 CCCGGGCTGTGCCCTTCTCGAGA No data
Right 1126467702 15:48975958-48975980 TCTCGAGAAGCCCGGCCGGGCGG No data
1126467695_1126467704 -4 Left 1126467695 15:48975943-48975965 CCCGGGCTGTGCCCTTCTCGAGA No data
Right 1126467704 15:48975962-48975984 GAGAAGCCCGGCCGGGCGGCGGG No data
1126467695_1126467705 -3 Left 1126467695 15:48975943-48975965 CCCGGGCTGTGCCCTTCTCGAGA No data
Right 1126467705 15:48975963-48975985 AGAAGCCCGGCCGGGCGGCGGGG No data
1126467695_1126467709 8 Left 1126467695 15:48975943-48975965 CCCGGGCTGTGCCCTTCTCGAGA No data
Right 1126467709 15:48975974-48975996 CGGGCGGCGGGGAGAGCGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126467695 Original CRISPR TCTCGAGAAGGGCACAGCCC GGG (reversed) Intergenic
No off target data available for this crispr