ID: 1126467702

View in Genome Browser
Species Human (GRCh38)
Location 15:48975958-48975980
Sequence TCTCGAGAAGCCCGGCCGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126467694_1126467702 -7 Left 1126467694 15:48975942-48975964 CCCCGGGCTGTGCCCTTCTCGAG No data
Right 1126467702 15:48975958-48975980 TCTCGAGAAGCCCGGCCGGGCGG No data
1126467692_1126467702 2 Left 1126467692 15:48975933-48975955 CCGCGGCCGCCCCGGGCTGTGCC No data
Right 1126467702 15:48975958-48975980 TCTCGAGAAGCCCGGCCGGGCGG No data
1126467693_1126467702 -4 Left 1126467693 15:48975939-48975961 CCGCCCCGGGCTGTGCCCTTCTC No data
Right 1126467702 15:48975958-48975980 TCTCGAGAAGCCCGGCCGGGCGG No data
1126467696_1126467702 -9 Left 1126467696 15:48975944-48975966 CCGGGCTGTGCCCTTCTCGAGAA No data
Right 1126467702 15:48975958-48975980 TCTCGAGAAGCCCGGCCGGGCGG No data
1126467688_1126467702 11 Left 1126467688 15:48975924-48975946 CCGCCAGCTCCGCGGCCGCCCCG No data
Right 1126467702 15:48975958-48975980 TCTCGAGAAGCCCGGCCGGGCGG No data
1126467695_1126467702 -8 Left 1126467695 15:48975943-48975965 CCCGGGCTGTGCCCTTCTCGAGA No data
Right 1126467702 15:48975958-48975980 TCTCGAGAAGCCCGGCCGGGCGG No data
1126467691_1126467702 8 Left 1126467691 15:48975927-48975949 CCAGCTCCGCGGCCGCCCCGGGC No data
Right 1126467702 15:48975958-48975980 TCTCGAGAAGCCCGGCCGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126467702 Original CRISPR TCTCGAGAAGCCCGGCCGGG CGG Intergenic
No off target data available for this crispr