ID: 1126474198

View in Genome Browser
Species Human (GRCh38)
Location 15:49049172-49049194
Sequence TGAGCTTGTGTGAGTACTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126474198_1126474201 -7 Left 1126474198 15:49049172-49049194 CCTTTAGTACTCACACAAGCTCA No data
Right 1126474201 15:49049188-49049210 AAGCTCATCCCTTGGAATGAGGG No data
1126474198_1126474205 8 Left 1126474198 15:49049172-49049194 CCTTTAGTACTCACACAAGCTCA No data
Right 1126474205 15:49049203-49049225 AATGAGGGTTCAGAATGTGAGGG No data
1126474198_1126474200 -8 Left 1126474198 15:49049172-49049194 CCTTTAGTACTCACACAAGCTCA No data
Right 1126474200 15:49049187-49049209 CAAGCTCATCCCTTGGAATGAGG No data
1126474198_1126474204 7 Left 1126474198 15:49049172-49049194 CCTTTAGTACTCACACAAGCTCA No data
Right 1126474204 15:49049202-49049224 GAATGAGGGTTCAGAATGTGAGG No data
1126474198_1126474206 27 Left 1126474198 15:49049172-49049194 CCTTTAGTACTCACACAAGCTCA No data
Right 1126474206 15:49049222-49049244 AGGGATAATCCAATAGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126474198 Original CRISPR TGAGCTTGTGTGAGTACTAA AGG (reversed) Intergenic
No off target data available for this crispr