ID: 1126474200

View in Genome Browser
Species Human (GRCh38)
Location 15:49049187-49049209
Sequence CAAGCTCATCCCTTGGAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126474198_1126474200 -8 Left 1126474198 15:49049172-49049194 CCTTTAGTACTCACACAAGCTCA No data
Right 1126474200 15:49049187-49049209 CAAGCTCATCCCTTGGAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126474200 Original CRISPR CAAGCTCATCCCTTGGAATG AGG Intergenic
No off target data available for this crispr