ID: 1126474954

View in Genome Browser
Species Human (GRCh38)
Location 15:49055527-49055549
Sequence CCATGGACAAGTACCTGTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126474949_1126474954 -7 Left 1126474949 15:49055511-49055533 CCTGGTTCCTAACAGCCCATGGA No data
Right 1126474954 15:49055527-49055549 CCATGGACAAGTACCTGTTAGGG No data
1126474943_1126474954 19 Left 1126474943 15:49055485-49055507 CCCACTGCTCACCTCCTGCTGTA No data
Right 1126474954 15:49055527-49055549 CCATGGACAAGTACCTGTTAGGG No data
1126474947_1126474954 5 Left 1126474947 15:49055499-49055521 CCTGCTGTACAGCCTGGTTCCTA No data
Right 1126474954 15:49055527-49055549 CCATGGACAAGTACCTGTTAGGG No data
1126474946_1126474954 8 Left 1126474946 15:49055496-49055518 CCTCCTGCTGTACAGCCTGGTTC No data
Right 1126474954 15:49055527-49055549 CCATGGACAAGTACCTGTTAGGG No data
1126474944_1126474954 18 Left 1126474944 15:49055486-49055508 CCACTGCTCACCTCCTGCTGTAC No data
Right 1126474954 15:49055527-49055549 CCATGGACAAGTACCTGTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126474954 Original CRISPR CCATGGACAAGTACCTGTTA GGG Intergenic
No off target data available for this crispr