ID: 1126475244

View in Genome Browser
Species Human (GRCh38)
Location 15:49058908-49058930
Sequence GCATCCTGCTTTAAAGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126475244_1126475246 -3 Left 1126475244 15:49058908-49058930 CCACCTTCTTTAAAGCAGGATGC No data
Right 1126475246 15:49058928-49058950 TGCAATACAGAGCGATCTAATGG No data
1126475244_1126475249 19 Left 1126475244 15:49058908-49058930 CCACCTTCTTTAAAGCAGGATGC No data
Right 1126475249 15:49058950-49058972 GACTATGGAGACTCAGAAGGAGG No data
1126475244_1126475248 16 Left 1126475244 15:49058908-49058930 CCACCTTCTTTAAAGCAGGATGC No data
Right 1126475248 15:49058947-49058969 ATGGACTATGGAGACTCAGAAGG 0: 15
1: 57
2: 231
3: 611
4: 1083
1126475244_1126475250 23 Left 1126475244 15:49058908-49058930 CCACCTTCTTTAAAGCAGGATGC No data
Right 1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG No data
1126475244_1126475247 4 Left 1126475244 15:49058908-49058930 CCACCTTCTTTAAAGCAGGATGC No data
Right 1126475247 15:49058935-49058957 CAGAGCGATCTAATGGACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126475244 Original CRISPR GCATCCTGCTTTAAAGAAGG TGG (reversed) Intergenic
No off target data available for this crispr