ID: 1126475250

View in Genome Browser
Species Human (GRCh38)
Location 15:49058954-49058976
Sequence ATGGAGACTCAGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126475245_1126475250 20 Left 1126475245 15:49058911-49058933 CCTTCTTTAAAGCAGGATGCAAT No data
Right 1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG No data
1126475244_1126475250 23 Left 1126475244 15:49058908-49058930 CCACCTTCTTTAAAGCAGGATGC No data
Right 1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126475250 Original CRISPR ATGGAGACTCAGAAGGAGGA AGG Intergenic
No off target data available for this crispr