ID: 1126482444

View in Genome Browser
Species Human (GRCh38)
Location 15:49140964-49140986
Sequence AAGAAAACAGCAGAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 991
Summary {0: 1, 1: 0, 2: 8, 3: 121, 4: 861}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126482441_1126482444 -3 Left 1126482441 15:49140944-49140966 CCAAGAATTGAATTACAATAAAG 0: 1
1: 0
2: 1
3: 27
4: 319
Right 1126482444 15:49140964-49140986 AAGAAAACAGCAGAGGTGGATGG 0: 1
1: 0
2: 8
3: 121
4: 861
1126482440_1126482444 2 Left 1126482440 15:49140939-49140961 CCTAACCAAGAATTGAATTACAA 0: 1
1: 0
2: 2
3: 20
4: 218
Right 1126482444 15:49140964-49140986 AAGAAAACAGCAGAGGTGGATGG 0: 1
1: 0
2: 8
3: 121
4: 861
1126482439_1126482444 9 Left 1126482439 15:49140932-49140954 CCTGAAACCTAACCAAGAATTGA 0: 1
1: 0
2: 0
3: 11
4: 134
Right 1126482444 15:49140964-49140986 AAGAAAACAGCAGAGGTGGATGG 0: 1
1: 0
2: 8
3: 121
4: 861
1126482438_1126482444 10 Left 1126482438 15:49140931-49140953 CCCTGAAACCTAACCAAGAATTG 0: 1
1: 0
2: 0
3: 14
4: 137
Right 1126482444 15:49140964-49140986 AAGAAAACAGCAGAGGTGGATGG 0: 1
1: 0
2: 8
3: 121
4: 861

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126482444 Original CRISPR AAGAAAACAGCAGAGGTGGA TGG Intronic
901434432 1:9238045-9238067 AATAAAGCAGGAGAGGAGGATGG + Intronic
901756193 1:11443006-11443028 GAGAAAAAGGGAGAGGTGGAGGG + Intergenic
902153759 1:14466334-14466356 AACAAAAAAGGAGACGTGGATGG + Intergenic
902535577 1:17117895-17117917 AAGAACACAGCAGTGGAGGGTGG - Intronic
902594120 1:17496354-17496376 GAGAAAACAGCAGAAGCAGATGG + Intergenic
903399641 1:23032043-23032065 AAGAAAAGAGCACAGGGTGAAGG - Intronic
903613783 1:24637142-24637164 AACACAAAAGCAGAAGTGGAAGG + Intronic
903751559 1:25624752-25624774 AAGAAGATGGCAGAGGTGGAAGG - Intronic
904049572 1:27631185-27631207 GAGAACACAGCAGTGGGGGAGGG - Intronic
905093682 1:35450431-35450453 ACGAGCACAGCAGAGCTGGATGG - Exonic
905501064 1:38437307-38437329 AAGAAAACTCCAGACCTGGATGG - Intergenic
905908574 1:41638441-41638463 AAGAGAAAAGAAGAGATGGATGG + Intronic
906308482 1:44736674-44736696 AAGAAAACAAAAGAGTTGGGGGG - Intergenic
906702248 1:47868332-47868354 AGGAAGACAGCAAAGGAGGAAGG + Intronic
907096539 1:51786502-51786524 TAGAAAACAATAGAGGTGGATGG - Intronic
907335636 1:53697603-53697625 AACTACACAGCAGAGGAGGAAGG + Intronic
907348512 1:53804853-53804875 AAGAAAACTTCAGAGAGGGATGG - Intronic
907407060 1:54260202-54260224 ATGAAAAGAACAGAGGAGGAAGG + Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
908108790 1:60874466-60874488 AAGAAAAGATCAGACGTGAATGG - Intronic
908148535 1:61274181-61274203 CATAAAACTGCATAGGTGGATGG + Intronic
908572178 1:65421022-65421044 AAAAACTCAGGAGAGGTGGAGGG - Intronic
908717659 1:67087517-67087539 CAGCAAACAGAAGTGGTGGACGG - Intergenic
908791425 1:67786497-67786519 AAGAAAACTGTAGAGGAAGAGGG + Intronic
909122650 1:71623708-71623730 AAGAAATCAGAAGATGTGGGAGG + Intronic
909212758 1:72845359-72845381 AGGGAGACAGCAGAGGTGCAAGG + Intergenic
909280470 1:73745163-73745185 AAGAAAATAGCTGAAATGGAAGG + Intergenic
910797963 1:91117574-91117596 GAGAAAACAGCAGAAGCAGAAGG + Intergenic
911490516 1:98559811-98559833 AAGAAAAGAGCAGCAGTGAATGG + Intergenic
911591290 1:99751087-99751109 AATAAAAAAGCAGAGGAAGAGGG + Intronic
912444166 1:109721790-109721812 ATGAGAAGGGCAGAGGTGGAGGG - Intronic
912563794 1:110570439-110570461 CACAGAACAGCAGAGCTGGAAGG - Intergenic
913288091 1:117245902-117245924 AAAAAAAAAGCAGAGATGGGAGG - Intergenic
913305387 1:117425066-117425088 GACAAAACAGGAGAGGGGGAAGG + Intronic
913329025 1:117652214-117652236 AAGAACACTGCAAAGGTGGTAGG - Intergenic
913599278 1:120407335-120407357 AAGAAAAAAGCAGTGGGAGAAGG - Intergenic
914088101 1:144472285-144472307 AAGAAAAAAGCAGTGGGAGAAGG + Intergenic
914310513 1:146461924-146461946 AAGAAAAAAGCAGTGGGAGAAGG - Intergenic
914314666 1:146498828-146498850 AAGAAAAAAGCAGTGGGAGAAGG + Intergenic
914499685 1:148234560-148234582 AAGAAAAAAGCAGTGGGAGAAGG - Intergenic
914591597 1:149111217-149111239 AAGAAAAAAGCAGTGGGAGAAGG + Intergenic
914941052 1:152023350-152023372 AAGAAAAGAAAACAGGTGGAAGG - Intergenic
915356650 1:155259153-155259175 AAAAAAAAAGCTGAGGTGGGAGG - Intronic
915601667 1:156926568-156926590 AAAAAAAAAGAAGAGGTGGGGGG - Intronic
916961565 1:169894249-169894271 TAGCAAACAGTAGAGGTGCAGGG + Intronic
917196090 1:172467210-172467232 GGGAACACAGCACAGGTGGAAGG - Intronic
917389772 1:174522524-174522546 AAGAAAAAAGAAGAGGGGGAAGG + Intronic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
918245210 1:182653337-182653359 AATAAGACAGCATAGCTGGAAGG + Intronic
918374498 1:183895595-183895617 ATGAGAACAGCAGAGGAGGCAGG + Intronic
918923269 1:190744280-190744302 AAGAAAGTAGCAGTGGAGGAGGG - Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
919227884 1:194731205-194731227 AAGAGAAGAGCATTGGTGGAGGG + Intergenic
919297456 1:195720981-195721003 AAGGAAAAAGGAGAGGAGGAGGG + Intergenic
919415577 1:197304550-197304572 TAGAAAACCACATAGGTGGAGGG - Intronic
919874083 1:201848739-201848761 AAAAAAACAATAGAGCTGGAGGG - Intronic
919918642 1:202154697-202154719 AAGAAAGCAGCAGGGGAGGAAGG - Intronic
920047167 1:203140772-203140794 AAGGAGACAGCAGAGTTGGGGGG + Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
920809316 1:209267544-209267566 AAGAAAACAGCAGTGATGCCAGG - Intergenic
920846076 1:209594017-209594039 AATAAAACACCAAAGCTGGAAGG - Intronic
922517864 1:226222184-226222206 AAGAAAGGAGAAGGGGTGGAAGG + Intergenic
922723172 1:227909418-227909440 AAGAAAACAGAGGTGGGGGAAGG + Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
923089827 1:230731537-230731559 AAGAAGTCAGCACAGCTGGAAGG - Intergenic
923566947 1:235083469-235083491 AAGAAAATAGCAGTGGGAGAAGG - Intergenic
924330355 1:242935303-242935325 GAGAAAAGATCAGAGGAGGAAGG + Intergenic
1063429453 10:5976810-5976832 AGGAAACCAGCAGAGGCGGTCGG - Intronic
1063695708 10:8332988-8333010 AAGAGAAGAGAAGAGGGGGAGGG - Intergenic
1063781325 10:9328417-9328439 AGGAAAAATGCAAAGGTGGAAGG - Intergenic
1063845692 10:10124701-10124723 ATCAATACAGCAGAGGTGGCTGG - Intergenic
1063894270 10:10662712-10662734 AACAAACCAGCAATGGTGGAGGG + Intergenic
1063908445 10:10804705-10804727 ATGAAAACAGCACACGTTGATGG + Intergenic
1064346438 10:14536984-14537006 TAGAAAATGGCAGAGGAGGAGGG + Intronic
1064455825 10:15486774-15486796 AAGAAACCAAAAGAGTTGGAAGG - Intergenic
1064855870 10:19766695-19766717 AGGGAAACAGCAGAGGTACAAGG + Intronic
1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG + Intronic
1065222798 10:23513377-23513399 AGGCAAACAGCAGTAGTGGACGG + Intergenic
1065853112 10:29807250-29807272 GAGAAAAGAGAAGAGGTAGAAGG + Intergenic
1065963379 10:30752265-30752287 AAGAAAACTGCAGGGCGGGAAGG + Intergenic
1066063529 10:31745226-31745248 AAGGAAACACCACAGGAGGAGGG - Intergenic
1066153652 10:32651354-32651376 CAGAAAACACCAAATGTGGATGG - Intronic
1066409780 10:35156233-35156255 AAGAAAAGAAAAGAGGTGGCCGG - Intronic
1066652958 10:37677122-37677144 AAGGAACCACCAGAAGTGGAGGG - Intergenic
1067571390 10:47373920-47373942 AATAAAACAGTGTAGGTGGATGG - Intronic
1067678689 10:48411765-48411787 AAGAAAAAAGAAGAGAAGGAAGG - Intronic
1068040471 10:51817838-51817860 AAGAAAAGAGAAGAAGAGGAAGG - Intronic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068988851 10:63131015-63131037 CAGCAAACAGCGGTGGTGGACGG + Intergenic
1069037966 10:63665000-63665022 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1069285859 10:66714587-66714609 CTCAAAAAAGCAGAGGTGGATGG - Intronic
1070602364 10:77874835-77874857 AATTGAACAGCAGAGTTGGAAGG - Intronic
1070755356 10:78988709-78988731 ATGAAAAGAGCAAAGGGGGAGGG + Intergenic
1070782348 10:79145042-79145064 AAGAAAACAGAAGGGGAAGAAGG - Intronic
1070944982 10:80383158-80383180 AAAAAAACAGTAGAGGTGGCAGG - Intergenic
1070960721 10:80498426-80498448 AAGAAAACAGCAGAGAGTGGAGG - Intronic
1071082706 10:81831312-81831334 CAGCAAATAGCAGTGGTGGACGG + Intergenic
1071184342 10:83023602-83023624 AAGTAGCCAGGAGAGGTGGAGGG - Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071363371 10:84874434-84874456 AAGAAAACTGTAAAGGTGGAGGG - Intergenic
1071593224 10:86896173-86896195 AAAAAAAAAGCTGAGGTGGGAGG + Intronic
1072299033 10:94041255-94041277 AAGGAGACAGCAGAAGTGGGTGG - Intronic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072606461 10:96987730-96987752 AAGAAAACAGCAAAACTTGAGGG + Intergenic
1073007153 10:100333259-100333281 GAGAAAACAGAGGAGGGGGAAGG + Intergenic
1073025610 10:100485323-100485345 AAGAGCACACAAGAGGTGGAAGG - Intergenic
1073185932 10:101615031-101615053 AAGAAAAGAGCCCAGGAGGAGGG - Intronic
1073592324 10:104769068-104769090 ATGAAAACAGGAGAGGTGGAAGG - Intronic
1073611263 10:104946329-104946351 GGGACAACAGCAGAGGAGGAGGG - Intronic
1073847592 10:107576331-107576353 AAGGAGACAGCGGGGGTGGAGGG + Intergenic
1074194164 10:111166006-111166028 AAGAAACAAGCAAAGGTGGAAGG - Intergenic
1074765454 10:116696784-116696806 AAGAAAGCAGTTGAGGTGGAAGG - Intronic
1074860368 10:117505377-117505399 AAGAAAACAGTACAGGTGAGAGG + Intergenic
1075159800 10:120012905-120012927 AAGAAAGCAGCAGAGCTGGATGG - Intergenic
1075540806 10:123312190-123312212 AAGGACACAGCGGAGGTGAAGGG - Intergenic
1075610907 10:123853951-123853973 GAGAAAAAAGGAGAGGAGGAGGG - Intronic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1076546898 10:131251342-131251364 AAGGAAGCAGCAGAGGGAGAGGG - Intronic
1076648454 10:131970660-131970682 GAGAGAGCAGCAGAGATGGAAGG + Exonic
1077726977 11:4684518-4684540 AAGAAAAGAGCAGGCATGGAGGG + Intronic
1077974384 11:7232438-7232460 TAGAATACAGCAGAGGTGATGGG + Intergenic
1078071868 11:8118569-8118591 AAGAAAACAGCAGATTGGGCTGG + Intronic
1078255626 11:9656101-9656123 AAGAAAAAGGAAAAGGTGGAGGG + Intergenic
1078727511 11:13944842-13944864 AAAAAAACAGAAGAGTTAGAGGG + Intergenic
1078766559 11:14303949-14303971 ATGGAAACCCCAGAGGTGGAGGG - Intronic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1079757816 11:24287656-24287678 AAGAAAACAGGAGGTATGGATGG - Intergenic
1080007897 11:27429093-27429115 ATTAAAACTGCAGAAGTGGATGG + Intronic
1080271291 11:30453296-30453318 AAGGAAACTGCAGATGTGGATGG + Intronic
1080316167 11:30951455-30951477 AAGAAAGTAGCCCAGGTGGAAGG + Intronic
1080606732 11:33870046-33870068 AAGAAAAAAGGGGAGGTGGGGGG - Intronic
1080881486 11:36325361-36325383 TAGCAAACGGCAGTGGTGGACGG + Intronic
1081069741 11:38595865-38595887 CAGCAAATAGCAGTGGTGGATGG + Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1083169695 11:60915713-60915735 AAGGAAAGAGAAGAGGAGGAAGG + Intronic
1083259184 11:61514022-61514044 AAGAAAACACCAGAGGGCGGTGG + Intergenic
1083434128 11:62631050-62631072 CGGAAAACATCAGAGATGGAGGG + Exonic
1083630122 11:64091036-64091058 AAGAAGACAGAGGAGGAGGAGGG + Intronic
1083695313 11:64438628-64438650 CAGAAAACAACAAAGGTGGCCGG - Intergenic
1083833225 11:65246864-65246886 AAGAAAGCAGAAGAGGGAGAAGG - Intergenic
1083854012 11:65383260-65383282 GAGAAAGCAGCAGGGGTGGGTGG - Intronic
1084366261 11:68702294-68702316 AAGAAAAGAACAAAGTTGGAAGG + Intergenic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085451933 11:76639389-76639411 AAGAAGCCAGCAAAGGTTGATGG - Intergenic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1085739448 11:79066288-79066310 TAGAAGGCAGAAGAGGTGGATGG + Intronic
1086064362 11:82731297-82731319 CAGAAACCAACAGAGGTGGAAGG + Exonic
1086257767 11:84899543-84899565 AAGCAGATAGCAGAGGTGGCGGG - Intronic
1086527354 11:87743593-87743615 AAGAAATCTGCAGAAGTGTATGG + Intergenic
1087890366 11:103531175-103531197 AAGAAAACAGGAGAGGATGTGGG + Intergenic
1088154238 11:106784155-106784177 AGGAAAGCAGCGGAGGTGGTGGG - Intronic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088245839 11:107817305-107817327 AAGAAAAGAAAAGAGCTGGACGG + Intronic
1088268620 11:108010742-108010764 AAGAGAAAAGCAGAGTGGGATGG - Intronic
1088731198 11:112684568-112684590 AAGAAAACATAGGAGGTGGCTGG - Intergenic
1088819107 11:113442087-113442109 ATGAAAACAGCATGGGTGTAGGG + Intronic
1089083812 11:115799941-115799963 AATAAAACACAAGAGCTGGAAGG + Intergenic
1089446306 11:118555356-118555378 CAGAGAAGAGCAGAGGTGGCAGG + Intronic
1089872203 11:121685601-121685623 CAGAGAACATCAGAGGTGGAAGG + Intergenic
1089961638 11:122622148-122622170 AAGAAAACAGCAGTGGGGAGAGG + Intergenic
1090799549 11:130161711-130161733 ATGAAAATGGCAGAGGGGGAAGG - Intronic
1090855452 11:130606667-130606689 AAGCAAAGAGCAGAGGTGAAGGG - Intergenic
1091106094 11:132921081-132921103 AAGAAAACAGCCATGGTAGAAGG - Intronic
1091603231 12:1930305-1930327 AAGAGAAAAGGAGAAGTGGAAGG - Intergenic
1091884486 12:4006061-4006083 AAGAAAACAAAACAGGTGGCCGG - Intergenic
1092330519 12:7583162-7583184 GAGAAAACACCAAATGTGGATGG + Intergenic
1092737246 12:11594142-11594164 AAGACAAGAGCAGAAGTGGAGGG - Intergenic
1092994340 12:13934052-13934074 CAGAAAACAGCAGAAATAGAAGG - Intronic
1093098502 12:14999223-14999245 AAGAAAACAGCAGGGATGGGGGG - Intergenic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1093508370 12:19896595-19896617 AAGAAGAAAGAAGAGGAGGAAGG - Intergenic
1093815439 12:23540216-23540238 AATAAAAAAGCAGAGAAGGAGGG + Intronic
1094347123 12:29483090-29483112 AAGAAGACTGAAGAGGAGGAGGG - Intronic
1094625666 12:32121625-32121647 AATAAAAGCGCTGAGGTGGAAGG + Intronic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1094755643 12:33465053-33465075 AAAAAAAAAGCAGGGGTTGAGGG + Intergenic
1095201078 12:39385045-39385067 TAGAAAACAGCAAAGGTGATGGG - Intronic
1095410898 12:41921195-41921217 ACGTAGACAGCAGAGGTGTAAGG - Intergenic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096352553 12:50912232-50912254 TGGAAAACAGCAGTGATGGACGG + Intergenic
1096439250 12:51625616-51625638 AAAAAAACAAAAGAGGGGGAGGG - Intronic
1096585128 12:52614976-52614998 CAGAAACTAGCAGAGTTGGAAGG + Intronic
1096943721 12:55380168-55380190 TTGAAAACAGCAGAGGAAGATGG + Intergenic
1097376748 12:58852228-58852250 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097377757 12:58859357-58859379 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097421571 12:59387421-59387443 AAGAAAACATTAGACATGGATGG + Intergenic
1097507038 12:60486514-60486536 AAGAGTACAGCAAAGGTGCAAGG + Intergenic
1098639878 12:72825637-72825659 CAGCAAACAGCAGTGGTAGACGG + Intergenic
1098911513 12:76213938-76213960 AAGAGAAGAGAAGAGGAGGAGGG - Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1099128773 12:78799990-78800012 AAGAATACAGTAGAAGAGGAGGG + Intergenic
1099271570 12:80517265-80517287 AAAAAATCAGCAGAGTTGAATGG + Intronic
1099292613 12:80790072-80790094 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1099533315 12:83815157-83815179 AAGAAAACTACATAGCTGGATGG - Intergenic
1099802714 12:87476907-87476929 AGGAAAGAAGCAGAGATGGAGGG - Intergenic
1099951691 12:89310993-89311015 AAGAAAAAAACAAAGGTTGATGG - Intergenic
1101608280 12:106267002-106267024 AAGAAAATAGAAGAGGTGCATGG + Intronic
1102159284 12:110755609-110755631 AAGAAAACAGGAAAGCTGGATGG - Intergenic
1102717463 12:114986571-114986593 AAGAAAAGAGAAGAGAAGGAAGG - Intergenic
1104050856 12:125192719-125192741 GTGGAAACAGCAGATGTGGAAGG + Intronic
1104292407 12:127482444-127482466 AAGAGATCGGCAGAGGTGAAGGG - Intergenic
1104657203 12:130582126-130582148 ATGGAGACAGCAGAGGAGGAGGG - Intronic
1104710587 12:130982902-130982924 AAGGGAAGGGCAGAGGTGGAGGG + Intronic
1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG + Intergenic
1105334227 13:19449903-19449925 AAGGAAAGAGGAGAGGAGGAAGG - Intronic
1105348289 13:19593722-19593744 AAGGAAGCAGAAGAGGGGGAGGG - Intergenic
1105365580 13:19761279-19761301 AAGAAAACAGTAAAGAAGGAGGG - Intronic
1105584334 13:21730175-21730197 AAGAACACGGCAGAAGAGGAAGG - Intergenic
1105860697 13:24409451-24409473 AAGGAAAGAGGAGAGGAGGAAGG + Intergenic
1106001637 13:25729073-25729095 AAAAAAACAGTGGAGGAGGAAGG - Intronic
1106118256 13:26835912-26835934 ATGAAAAGAGCAGAGATGCAAGG + Intergenic
1106246828 13:27957485-27957507 AAGAAGACAGCAGATGAGGCCGG + Intergenic
1106344282 13:28860666-28860688 AGGGAAACATCTGAGGTGGATGG - Intronic
1106346230 13:28881625-28881647 AAAAAAACAGCAGATATTGAAGG - Intronic
1106683109 13:32028536-32028558 AAGATAACAGGAAAAGTGGAAGG - Intergenic
1106781999 13:33068394-33068416 AAAAAAAAAGCAGAGGTCGGGGG - Intergenic
1107156430 13:37172407-37172429 CAGCAAACAGCAGTGGCGGAGGG + Intergenic
1107182210 13:37473920-37473942 AAGAAAACAGCAAAGGCAGGAGG - Intergenic
1107310269 13:39069918-39069940 AAGGAAAAAGGAGAGGTTGAGGG - Intergenic
1107488374 13:40854488-40854510 AAGGAAAGAGGAGAGGAGGAAGG - Intergenic
1107490972 13:40879665-40879687 AGGAGATCAGCAGAGGTGAAGGG + Intergenic
1107642179 13:42454617-42454639 AAGAAGACCTCAGAGGTGAATGG - Intergenic
1107647949 13:42514938-42514960 AAGAAGACCTCAGAGGTGAAAGG + Intergenic
1107758489 13:43651246-43651268 AAGAAAAAGGAAGAGGGGGAGGG + Intronic
1107793495 13:44026570-44026592 AAGCCAACAGGAGAGGGGGAAGG + Intergenic
1108156283 13:47588495-47588517 AAGAAAAGAGATGAGTTGGAAGG + Intergenic
1108314951 13:49227779-49227801 AAGATCAAAGCAGAGGTGCAGGG + Intergenic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109243043 13:59914622-59914644 AAAAAAACAATAGAGTTGGACGG + Intronic
1109253802 13:60052715-60052737 AAGAAAAGAGCAAAGGCGGGCGG + Intronic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1109931290 13:69221993-69222015 CAGCAAACAGTAGTGGTGGACGG - Intergenic
1110072357 13:71192529-71192551 ATGAAAACACCAAAGGAGGAAGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1112049890 13:95634988-95635010 AAGGAAAAAAAAGAGGTGGAGGG - Intronic
1112193622 13:97203004-97203026 AAGAGAAGCTCAGAGGTGGAAGG - Intergenic
1112635184 13:101209185-101209207 AAGAAAAATGGAGAGATGGATGG - Intronic
1112740521 13:102467847-102467869 AGGAAGAGAGCAGAGGTTGATGG + Intergenic
1112991056 13:105514484-105514506 AGGAGAACAGCTGAGGTTGAGGG - Intergenic
1113067805 13:106389742-106389764 AAGGAGACAGCTGAGGAGGAAGG - Intergenic
1113252036 13:108464060-108464082 AAGAAATCTTCAGAGGAGGAAGG + Intergenic
1113272218 13:108686053-108686075 AAGAAAGCAGCAGACCTGGTAGG + Intronic
1113431735 13:110256384-110256406 GTGAAGACAGCAGAGGAGGATGG + Intronic
1113741411 13:112714571-112714593 AAGAAGGCAGCAGAGGGGGCTGG - Intronic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1114896256 14:26994545-26994567 CAGAAAACAACAGAGGTGGCTGG + Intergenic
1114975275 14:28088965-28088987 AAGAAGACAGAAGAGTTGGTGGG - Intergenic
1115067022 14:29275747-29275769 AATAAAACAGCAGAAGTGGAGGG - Intergenic
1115296261 14:31830784-31830806 AAGGGAACAGCAGATGTGGATGG - Intronic
1115451240 14:33550150-33550172 AAGAAAACAACAGTGGTGCTTGG - Intronic
1115453412 14:33574566-33574588 AAGAAAGGAGGTGAGGTGGATGG + Intronic
1115835561 14:37398035-37398057 AAGAAAACACCACAGGGAGAAGG - Intronic
1116992356 14:51289862-51289884 AAGAAAGCAGTAGTGGTGGCTGG - Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1117878897 14:60287680-60287702 AAGAGAAAAGGAGAGCTGGAAGG - Intronic
1118040395 14:61910156-61910178 AAAAAAATAACAGAGTTGGAGGG - Intergenic
1118160754 14:63287722-63287744 AAGAAAAAAGTAGAGATTGAGGG - Intronic
1118272736 14:64358927-64358949 AAGAAAAGATCAGAGCTGTATGG + Intergenic
1118933920 14:70268751-70268773 AGGAAAACAGAAGAGGTCAAGGG + Intergenic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119167917 14:72511222-72511244 AAGAAAACAGCACTGGAAGATGG - Intronic
1119198246 14:72733276-72733298 CAGAAAACAGGAGAGATGAATGG + Intronic
1119446126 14:74664753-74664775 AAGAAAAAAGTAGAGGAGGCCGG - Intronic
1119828705 14:77681246-77681268 AAGTAAACAGCAGACTTTGAGGG + Intronic
1120010921 14:79413351-79413373 AACCAAACAGCACAGATGGAAGG - Intronic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120382646 14:83800845-83800867 AAGAAAACATCACAGGGAGAAGG - Intergenic
1120397381 14:83985581-83985603 GCGCAAACAGCAGTGGTGGATGG - Intergenic
1121250389 14:92495449-92495471 AAGAAATCAGCAAAGAGGGAAGG + Exonic
1122055301 14:99094050-99094072 AAGAAAACAGCAGGGGAGCCTGG + Intergenic
1122311996 14:100803312-100803334 GAGAAAACAGCAGAGTTTGCTGG + Intergenic
1122375668 14:101255442-101255464 GAGAAAGCAACAGAGGTGGTTGG - Intergenic
1122535593 14:102459809-102459831 AAGAAAACACCAGGGCTGAAGGG - Intronic
1122701129 14:103589919-103589941 AAAAAAACACCAAAGGAGGATGG + Intronic
1122776950 14:104121600-104121622 AAGAAAACTCCAGGGGTGGGAGG - Intergenic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1124015816 15:25874291-25874313 AGCAAAACAACAGAGATGGAGGG + Intergenic
1124163194 15:27293705-27293727 AACAAAACTGGAGAGCTGGAAGG + Intronic
1124801036 15:32833051-32833073 AAGAGCAGAGCAGAGGAGGAGGG - Intronic
1125998822 15:44189972-44189994 AAGAAAACCACTGAGGTGGTTGG + Intronic
1126153889 15:45547395-45547417 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1126303811 15:47231124-47231146 AAGAGGAAAGCAGAGGAGGAAGG - Intronic
1126482444 15:49140964-49140986 AAGAAAACAGCAGAGGTGGATGG + Intronic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1127052391 15:55098246-55098268 TAGAGAAAAGCAGAAGTGGAGGG - Intergenic
1127466405 15:59248702-59248724 AAGTAAACAGCAGAGATGGGGGG + Intronic
1127843350 15:62848707-62848729 AAGAAGACAGCTGTGGTGGGTGG - Intergenic
1128147855 15:65342584-65342606 GAGAAGGCAGCAGAGGAGGAAGG - Intronic
1128290559 15:66475469-66475491 AAAGAAAGAGAAGAGGTGGAAGG - Intronic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1128382600 15:67124354-67124376 GTGTAAACTGCAGAGGTGGATGG - Intronic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1130053899 15:80506428-80506450 AAGGAAACATCAGAGGTTGGGGG + Intronic
1130113754 15:80988695-80988717 AACAAAACATCAGTGTTGGAAGG + Intronic
1130196131 15:81781943-81781965 CAGAAAGAAGCAGAGATGGATGG + Intergenic
1130647240 15:85739664-85739686 AAGAAAAAAAAAGAGCTGGAAGG - Intronic
1131244116 15:90775134-90775156 GTGGAAACAGCAGAAGTGGAAGG + Intronic
1131420109 15:92298265-92298287 CAGCAAATAGCAGTGGTGGACGG - Intergenic
1131588305 15:93719818-93719840 AAGACAAAAGCACATGTGGAAGG - Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1131809601 15:96158938-96158960 AAAAAAGCAGCAGAGCTGAAAGG + Intergenic
1132762381 16:1516172-1516194 AAAAAAACACCAGAAATGGATGG + Intronic
1132770939 16:1562946-1562968 AGGAAACCAGAAGAGGTGAAGGG + Intronic
1133055426 16:3143341-3143363 AAGGAACCAGCATGGGTGGAAGG - Intergenic
1133130543 16:3673816-3673838 AGGAAACCAGGGGAGGTGGAGGG + Intronic
1133507004 16:6422216-6422238 AAAAAAAAAGGAGAGGTGGTCGG - Intronic
1133668785 16:7997321-7997343 AAGAAAGAAGCAGAGGTGGTTGG + Intergenic
1134391362 16:13823256-13823278 AACATAACAGCAGTGGTAGAAGG + Intergenic
1134840065 16:17394627-17394649 GAGAAAACAACAGAGGAGGGTGG + Intronic
1135667173 16:24345711-24345733 AAAAAGACAGCAAATGTGGACGG + Intronic
1136050974 16:27649758-27649780 AAGAAAACAGAAGAGAAAGATGG + Intronic
1136387028 16:29934670-29934692 AAGAAAAAGGCTGAGGTGGGAGG - Intergenic
1136670745 16:31854882-31854904 CAGATGACAGCAGTGGTGGATGG - Intergenic
1136873080 16:33825354-33825376 AAGAACACTGCAGCTGTGGAAGG - Intergenic
1137041467 16:35616600-35616622 CAGAAAACAGCAAAGGTGATTGG - Intergenic
1137309254 16:47237079-47237101 AAGAAAGCAGCAGTGGCAGAAGG - Intronic
1137373022 16:47926345-47926367 CATAAAACAGTAGAGCTGGAGGG - Intergenic
1137792518 16:51186870-51186892 AAGAGACCATCAGAGGAGGAAGG + Intergenic
1138153693 16:54683454-54683476 AAGAAAGGAGCAGAGTGGGAAGG - Intergenic
1138153921 16:54685673-54685695 AAGAAGACAGCAGTGGTGCAGGG - Intergenic
1138362184 16:56440607-56440629 AAGAAAACTACAGAGGTAAAAGG + Intronic
1139042926 16:63019958-63019980 AATAAATCAGAAGAGATGGAAGG - Intergenic
1139649012 16:68352432-68352454 GAGAAAAAAGCAGAGGAGGCGGG + Intronic
1140129053 16:72142713-72142735 AAGAATGCAGAAGAGGTGAAGGG + Intronic
1140468388 16:75200362-75200384 AAAAAAAAAGCAGAGGCGGGTGG - Intergenic
1141298453 16:82791595-82791617 CAGCAAACAACAGTGGTGGATGG - Intronic
1141649238 16:85384366-85384388 CAGTAAACAGCAGAGGTGGGAGG - Intergenic
1141728621 16:85807591-85807613 AAGAAAACTGCAGGGAGGGAGGG - Intergenic
1142015681 16:87745541-87745563 CAGAAGCCAGAAGAGGTGGATGG - Intronic
1142329148 16:89439710-89439732 AAGAATAGATCTGAGGTGGATGG - Intronic
1142381156 16:89732960-89732982 GCGAACACAGCAGAGGGGGAGGG - Intronic
1142393097 16:89815777-89815799 AAGAAAACACCCGAGGCGGCGGG - Intronic
1203099092 16_KI270728v1_random:1290701-1290723 AAGAACACTGCAGCTGTGGAAGG + Intergenic
1142905687 17:3040201-3040223 ACAGTAACAGCAGAGGTGGATGG + Intergenic
1142951741 17:3487334-3487356 AATAAAACAGCAAAGTTGGAAGG + Intronic
1143133571 17:4696652-4696674 AAGCAAACAGATGAGGTAGAAGG + Intronic
1143200521 17:5110186-5110208 ATGAAAAAAGAAGAGGAGGACGG - Intronic
1143805159 17:9420273-9420295 AAGAGAACTGCAGAGGTTCAGGG - Intronic
1144115463 17:12085576-12085598 AATGAAACAGTAGAGGTGAAAGG - Intronic
1144225425 17:13140273-13140295 AAGAAAGAAACAGAGATGGATGG + Intergenic
1144273464 17:13642294-13642316 TAGAAAGGAGCAGGGGTGGAAGG + Intergenic
1144932543 17:18871433-18871455 AAGAAAACGGAAGAGGTGAGGGG - Intronic
1145354191 17:22123307-22123329 AAGAAAATATCAGAGCTGGAAGG + Intergenic
1145771574 17:27497004-27497026 TAGAAAACACCAGAGCAGGAAGG - Intronic
1146510288 17:33441571-33441593 GAGAAAACAGCAGAAGGAGAAGG + Intronic
1146702714 17:34975362-34975384 AAGAAGAAAGCAGAGGAGGGTGG - Intronic
1147256742 17:39186212-39186234 AAGAAAGAAGAAGAGGTGAATGG + Intronic
1147290751 17:39440890-39440912 ATGAAAACAGGAGAGGAGAAAGG - Intronic
1147607193 17:41780721-41780743 AAGAAAAGAGAAGAGGAGAAGGG + Intronic
1147710496 17:42460129-42460151 CAGAAAGCTGCAGAGGTGGAAGG + Intronic
1148118443 17:45192425-45192447 AAGAAAAAAGAAAAGGAGGAAGG - Intergenic
1148367618 17:47068578-47068600 AAAAAAACAAAAGAGATGGACGG - Intergenic
1148679911 17:49467647-49467669 CATAAAACATCAGAGCTGGAAGG + Intronic
1148826730 17:50399327-50399349 CAGCAAACAGCAGTAGTGGACGG + Intergenic
1148924210 17:51067968-51067990 CAGAAGACAACAGAGATGGAAGG - Intronic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1149285052 17:55153256-55153278 GAGAAAACTGTAGAGGTTGATGG + Intronic
1149333955 17:55615730-55615752 AAGGAAAAAACAGAGTTGGAAGG - Intergenic
1149373534 17:56020687-56020709 ATGAACATAGCAGGGGTGGATGG - Intergenic
1150624580 17:66833546-66833568 AAGAAAACCTCAGAGGTGGCTGG - Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1151310489 17:73289708-73289730 AAGAAAACAGGAAGGGAGGAAGG + Intronic
1151720494 17:75852749-75852771 AAGAAAATAGAAGAGTTGGCCGG - Intronic
1152162652 17:78678606-78678628 AAGAAAACAGCAGTGTTGTGGGG - Intronic
1152369511 17:79877694-79877716 AAGGAGAACGCAGAGGTGGATGG - Intergenic
1152673009 17:81620091-81620113 AAGAAAAGGGAAGAGATGGAAGG + Intronic
1152686782 17:81697723-81697745 AAGACAACAGCAGAATTAGAAGG - Intronic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1154318422 18:13324837-13324859 AAGAAAACAGCAGAGGTAGGTGG + Intronic
1155732910 18:29183915-29183937 AAGAAACCTGCAGAGATGGATGG - Intergenic
1155872937 18:31049673-31049695 TAGAATTCAGCAGAGGTGAAAGG - Intergenic
1156088409 18:33437406-33437428 AATAAAATAGCAAAGGTGGAGGG - Intronic
1156334034 18:36152305-36152327 AAGAAAACAGGAAAGGTAAAAGG - Intronic
1156360829 18:36383130-36383152 CAGAACACAGCAGGGCTGGAAGG - Intronic
1156445202 18:37231565-37231587 AAGAAAGTAGAAGAGGTGGTTGG + Intronic
1156987291 18:43362794-43362816 AAGGAAACAGCACAGGAGAAAGG - Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158094079 18:53750126-53750148 TAGAATACAGCAGAAGTGGCAGG + Intergenic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158470799 18:57735192-57735214 AGCAAAACAGCAGTGGTGGACGG - Intronic
1158598811 18:58839490-58839512 AAGAAAACATCAGCAGGGGATGG - Intergenic
1158642157 18:59213084-59213106 AAGAGAACAAGAGAGATGGATGG + Intergenic
1159184818 18:64955846-64955868 AAACAAACACCAGAGGTGAATGG - Intergenic
1159431287 18:68356740-68356762 AAGAAAACAGCTTAAGTGCAGGG - Intergenic
1160243756 18:77141174-77141196 ATGAAAGCAGCAGAGCTGGAGGG - Intergenic
1160901279 19:1429938-1429960 AAGAGAACAGAAGAGGAGGTTGG - Intronic
1161020882 19:2010932-2010954 AAGAAAACAGCAGCTGAGGCCGG - Intronic
1161841095 19:6680901-6680923 AAAATAACAGAAGAGGTGGCAGG + Intronic
1162154406 19:8667172-8667194 AAGAAAACAGGAAAGAGGGAGGG + Intergenic
1162234644 19:9298452-9298474 AAAAAAAAAGGAGAGGTGGCAGG + Intronic
1162471586 19:10875403-10875425 AAAAGAACAGCTGAGGTGGGAGG - Intronic
1162875243 19:13616591-13616613 AAGAAAACGGTAGAGGAGGAGGG + Intronic
1163051195 19:14685396-14685418 AAGTCAACAGCAGAGAAGGAAGG + Intronic
1163097108 19:15067130-15067152 AAGAAGACTGCAGAGATGAAAGG - Intergenic
1163205672 19:15800843-15800865 AAGAAAACAGCAGAGGAGGTTGG + Intergenic
1163916548 19:20245353-20245375 AGGAGATCAGCAGAGGTGAAAGG - Intergenic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1164211940 19:23106207-23106229 AAGAAAAAAGAGGAGGAGGAAGG + Intronic
1164304739 19:23995936-23995958 AAAAAAAAAGCAGAGGAAGAAGG + Intergenic
1164386439 19:27774653-27774675 AAAAAAACAACAGAGGAAGAAGG - Intergenic
1164454260 19:28394104-28394126 AAGTAAACAACAGATGTGAAAGG + Intergenic
1164893873 19:31851850-31851872 AAGAAGACCACAGAGGTAGAGGG - Intergenic
1165043845 19:33088645-33088667 AAAAAAAAAGCAAAGGTGGCCGG - Intronic
1165445569 19:35855315-35855337 AGGAAAACAGCCAAGGTGGAGGG - Intronic
1165926091 19:39327208-39327230 AGGAAAACAGCACTAGTGGAGGG + Intergenic
1166027667 19:40103266-40103288 AAGAAAAGAACAGAGCTGGAGGG + Intergenic
1166212193 19:41313993-41314015 AAGAAAACAGGAAAGCTGGCTGG - Intronic
1166733080 19:45069491-45069513 AAAAAAACAGCAAAGGTGACTGG - Intronic
1167496863 19:49824594-49824616 AAAAAAAAAAAAGAGGTGGAAGG + Intronic
1167861427 19:52287129-52287151 AAGAAAACTGCAGAGCAGGTCGG - Intronic
1167861477 19:52287435-52287457 AAGAAAACAGCAGAGCAGGCTGG - Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1168167380 19:54559486-54559508 GAGAAAACAGCAGAGGAGATGGG + Intergenic
1168503160 19:56910470-56910492 AAGACAACATCAGACCTGGACGG + Intergenic
1168693958 19:58394798-58394820 CAGACAACAGCACAGGTGGCTGG - Exonic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
925207935 2:2023161-2023183 GAAAAAAGAGTAGAGGTGGAAGG + Intronic
925332391 2:3068667-3068689 AAGAGAAGAGAAGAGTTGGAGGG + Intergenic
925343787 2:3155384-3155406 AAGATAAAAGTAGAGGTTGAAGG - Intergenic
925627489 2:5855777-5855799 GAGAAAACATCAGAGGTGGTGGG - Intergenic
926258718 2:11236350-11236372 CAGAAAAGAGCAGAGGAGGTAGG + Intronic
926746541 2:16163196-16163218 AAGAAAAGCAGAGAGGTGGAAGG - Intergenic
926830860 2:16960267-16960289 AAGAAAGCTGCTGGGGTGGATGG - Intergenic
926876578 2:17487072-17487094 AAGAAGCCAGGGGAGGTGGAGGG + Intergenic
927038389 2:19204028-19204050 ATGAATAAAGAAGAGGTGGAGGG - Intergenic
928191122 2:29169293-29169315 ATGAAAACACCAGAGATAGAAGG - Intronic
929519300 2:42633281-42633303 AAAAAAAAAGCAGAGGTCCAGGG + Intronic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
929726793 2:44437960-44437982 AAAAAACCAGTAGAGGTGGCAGG - Intronic
929824043 2:45296187-45296209 AAGGAAAGGGCAGAGGTGGAAGG - Intergenic
929985894 2:46731985-46732007 AAGTTAACACCAGATGTGGATGG + Intronic
930476548 2:51889677-51889699 AATACACCAGCAGAGTTGGAAGG + Intergenic
930599840 2:53430258-53430280 GAGAAAACAGGAGAGATGAAAGG + Intergenic
930767350 2:55097548-55097570 AAGGAGACAGCAGTGGGGGAAGG + Intronic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931489471 2:62727879-62727901 AGGGAGACAGCAGAGGTGCAAGG + Intronic
931750899 2:65329081-65329103 TAGACAACACCTGAGGTGGATGG + Intronic
932214277 2:69956491-69956513 AAGAAGAAAGCAGAGGAGGAGGG + Intergenic
932399913 2:71473200-71473222 AAACAAAAAGCAGAGGTAGATGG - Intronic
932747158 2:74343425-74343447 TAGAAAAAACGAGAGGTGGATGG - Intronic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
933884806 2:86708629-86708651 ATGAAAACAACAGAGGAGGCCGG - Intronic
933911496 2:86944551-86944573 AACAAAACAGCAGGTGTGGTGGG - Intronic
933970550 2:87466564-87466586 GAGAGAACAGCAGAGAAGGATGG - Intergenic
934879243 2:97959150-97959172 AAGAAAACAGGAGAAGAGAAAGG + Intronic
935140571 2:100349679-100349701 AAGAACACAGCAGGGGTGAGTGG + Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
936263607 2:110982449-110982471 AAGAAATAGGCAGAGATGGAAGG - Intronic
937127669 2:119484637-119484659 AAGAAAAAAGAAGAGATTGATGG - Intronic
937310279 2:120898063-120898085 AAGAAAAGACCACAGGTGAAGGG - Intronic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939136065 2:138295781-138295803 AAGAAAAAGGAAGAGGAGGAGGG - Intergenic
939318337 2:140581740-140581762 AAGAGAACAGGAGAGAGGGAGGG - Intronic
939872311 2:147539172-147539194 AAGAAAACAGCTGAGTAGCAGGG + Intergenic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
940775610 2:157880454-157880476 AGAAAAACAGCAAAGGTTGAGGG + Intronic
941589248 2:167398391-167398413 AAGAAAACGGTAGAGATAGAGGG - Intergenic
941918775 2:170829051-170829073 GAGAGAACAGCAGAGGTAGGAGG - Intronic
942492255 2:176501162-176501184 AAAAAAAAAGCAGAGAGGGAGGG - Intergenic
942523792 2:176831636-176831658 AAGAAAACTCCAGAGGTTGCTGG + Intergenic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
942883060 2:180886282-180886304 AAGAAAAGACCAGAACTGGATGG + Intergenic
944154544 2:196595601-196595623 AAGAAAAGAAAAGAGGAGGAAGG + Intergenic
944177069 2:196842449-196842471 AAGCAAACAAGAGAAGTGGATGG - Intronic
944654555 2:201864695-201864717 AATAAAATAGCAGGGGTGGCCGG - Intronic
944734870 2:202553240-202553262 AAAAAAAAAGCAGAGGAAGAAGG - Intronic
944982480 2:205137358-205137380 AAGAAAACTGCAGAAAAGGAAGG + Intronic
945394995 2:209306584-209306606 AACAAACCAGCAGTGGTGGATGG - Intergenic
945991097 2:216395978-216396000 AATAAAACAGGAGAGGAGGTTGG + Intergenic
946167308 2:217872385-217872407 AAGGAAACAGAGGATGTGGATGG + Intronic
946232980 2:218304031-218304053 GAGATGGCAGCAGAGGTGGAGGG + Intronic
946801275 2:223418518-223418540 AAGAAAACAGGAGGGAAGGAAGG - Intergenic
947856501 2:233328000-233328022 AAAAAAACAGCACAGGGGGTGGG - Intronic
948029043 2:234801341-234801363 AAGATAACAGCAGAGCAGGGAGG + Intergenic
948033216 2:234836738-234836760 AAGAAAACCCCAGAGGGAGAGGG + Intergenic
948058987 2:235029947-235029969 AGGAACAATGCAGAGGTGGACGG + Intronic
948705124 2:239786206-239786228 AAGAAGAGAGGAGAGGAGGAAGG + Intronic
948995481 2:241576173-241576195 AAGAAAAGAGTAGAGCTGCAGGG - Intergenic
949007041 2:241655666-241655688 AACAAGCCTGCAGAGGTGGAAGG - Intronic
1169402176 20:5292015-5292037 AAGAAATCATCTGAGGGGGAGGG - Intergenic
1169548675 20:6678829-6678851 AAGTAACCAACATAGGTGGAAGG + Intergenic
1169772955 20:9221326-9221348 ATGAAGACAGCAGAGGTGCTTGG - Intronic
1169795164 20:9454470-9454492 AAGACATCAGCAGAGATTGAAGG - Intronic
1169905638 20:10600485-10600507 AAGGAGACAGCAGTGGTTGATGG + Intronic
1170341071 20:15327715-15327737 GAGAAAACAGCAGAAGTAGGGGG - Intronic
1170612643 20:17927300-17927322 TAGACAACAGAATAGGTGGAAGG + Intergenic
1170868137 20:20178680-20178702 AAGAAAACAGAAATGGTGGGGGG - Intronic
1170921782 20:20686132-20686154 AAGGCAACAGCAAAGGTTGAGGG + Intronic
1170946548 20:20896016-20896038 AGGAAAAGAGAAGAGGGGGAAGG + Intergenic
1171187892 20:23136614-23136636 CAGCAAGCCGCAGAGGTGGACGG + Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1171564453 20:26167447-26167469 GAGAAAATATCAGAGCTGGAAGG + Intergenic
1172013443 20:31859771-31859793 AAGACACCATCAGAGGTAGAAGG + Intronic
1172468180 20:35172476-35172498 AAGAAACCAGCAGAGAGGGTAGG + Intronic
1172553242 20:35818302-35818324 AAAAAATTAGCTGAGGTGGAAGG + Intronic
1172632507 20:36388482-36388504 GAGAAAAGAGTTGAGGTGGAGGG - Intronic
1172781662 20:37440101-37440123 AAGCAAACAGCAGAGGTGGCAGG - Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173031438 20:39364890-39364912 AACAAAATAGAAGAGGTGGAAGG + Intergenic
1173373974 20:42466339-42466361 AATTAAAAAGCATAGGTGGAAGG + Intronic
1174024688 20:47563914-47563936 AAGAAAAAGGCTGAGGTGGGAGG + Intronic
1174408133 20:50316210-50316232 AAGCAAATAGCAGAGGCTGAAGG - Intergenic
1174874159 20:54209035-54209057 AAGAAAATTGGAGAGGGGGAAGG + Intronic
1175280195 20:57798816-57798838 AAGTATACAGAAGAGTTGGAGGG + Intergenic
1175424300 20:58854331-58854353 GAGGAAGCAGCAGAGATGGAAGG + Exonic
1175608324 20:60329657-60329679 CAGAAAGCAGCAGAGCAGGAAGG + Intergenic
1175690469 20:61062081-61062103 AACAAAACAACAGAGCAGGAAGG + Intergenic
1176300620 21:5097310-5097332 GGGAGACCAGCAGAGGTGGAGGG - Intergenic
1176738831 21:10578756-10578778 AAGGAAAGAGGAGAGGAGGAAGG + Intronic
1176744240 21:10637219-10637241 AAGAAATCAGCACAATTGGAAGG + Intergenic
1176901014 21:14442124-14442146 AAGCATGCAGCAGAGATGGAGGG + Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177355214 21:19998505-19998527 AAGAAATCAGCAGAAGTGAAAGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177809800 21:25914067-25914089 TAGAAAACAGGAAAGGTGGAAGG - Intronic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178010748 21:28283488-28283510 AAGAAAACATTAGAGATGAAAGG - Intergenic
1178011641 21:28293758-28293780 GAGAATACAGCAGAAGTAGAAGG - Intergenic
1178624494 21:34203803-34203825 AAGAAAGCAGGAAAGGGGGATGG + Intergenic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179314381 21:40228628-40228650 AAAAAAAGAAAAGAGGTGGAGGG - Intronic
1179409536 21:41151951-41151973 AAGAAAACAGAAGAGGAAAATGG - Intergenic
1179481255 21:41680065-41680087 AAGCAAGCAGCTGAGGTGGGTGG - Intergenic
1179511016 21:41873596-41873618 AAGAAAACAGTAGGGCTGAAGGG - Intronic
1179856423 21:44164671-44164693 GGGAGACCAGCAGAGGTGGAGGG + Intergenic
1180522273 22:16220438-16220460 GAGAGAGCAGCAGAGATGGAAGG - Intergenic
1180632196 22:17237385-17237407 CAGAAAACAGGAGAGGAGGAGGG + Intergenic
1180739107 22:18040875-18040897 AAGAAAGTAGAAGAGGTGGCCGG - Intergenic
1181331038 22:22091365-22091387 ATGAAAACAGCAGCACTGGAAGG - Intergenic
1181567250 22:23746588-23746610 AATAAAAAAGAAGAGGTGTATGG - Intronic
1181626924 22:24128663-24128685 GAGGAAACAGGAGTGGTGGAGGG - Intronic
1181878300 22:25957161-25957183 AAGAAGACATCAGAGGAGAAAGG - Intronic
1181901407 22:26159371-26159393 AATAAAACAGCGCAGGAGGACGG + Intergenic
1181920217 22:26314835-26314857 GAGAAGGCAGCAGAGGTGCAGGG + Intronic
1182098563 22:27642154-27642176 AGGAACACAGCAGGGGTCGAGGG + Intergenic
1182121670 22:27791198-27791220 AAGAGCACAGCTGAGGTGGGTGG - Intronic
1182221360 22:28761554-28761576 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1183053897 22:35289160-35289182 AAGAAAAACGCAGTGGTGGCTGG + Intronic
1183237255 22:36628770-36628792 AAGAAAAAAGCAGTGGGGGTTGG - Intronic
1183246361 22:36696706-36696728 AATAAAACAGCAAAGGGGGATGG + Intronic
1184185911 22:42865295-42865317 AAGAAAACAGCACATGTGGCTGG + Intronic
1184285336 22:43467713-43467735 CAGAACACAGCAGAGGGGGATGG - Intronic
1184952984 22:47858855-47858877 CAGAATACAGCAAAGTTGGAGGG - Intergenic
1184970098 22:48013350-48013372 AAGAATTCAGCAGACTTGGAAGG - Intergenic
949182245 3:1146421-1146443 ATGAAAACAGCAGAGCTGTAGGG - Intronic
949237221 3:1823856-1823878 AAAAAAAAGGCAGAGGTGAAAGG - Intergenic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
949930974 3:9078159-9078181 GAAAAAGCAGCAGAGGGGGAAGG + Intronic
949943573 3:9172999-9173021 AGGCAAACAGGAGAGGTGGTGGG + Intronic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951027524 3:17845566-17845588 AAGAATACAGCAAAGGTAGTGGG - Intronic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
951740125 3:25912306-25912328 ATGGAAACAGCATATGTGGAAGG + Intergenic
952071591 3:29643527-29643549 CAGAATGCAGCAGAGGAGGAAGG + Intronic
952364494 3:32663043-32663065 AATGAAAGAGCAAAGGTGGAAGG + Intergenic
952433724 3:33250769-33250791 TAGAAAACAGCAGAAGTGATGGG - Intergenic
954288309 3:49635291-49635313 AAGAACCCAGCAAAGGTGGCTGG + Intronic
954656152 3:52195426-52195448 AAGAAAGAAGAAGAGGAGGAGGG + Intergenic
955040286 3:55310155-55310177 AAGAAAGCAGCAGATTTGAAGGG + Intergenic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
955512083 3:59691447-59691469 CAGAAAGCAGCAGAGGCAGATGG - Intergenic
955562481 3:60206655-60206677 AAGAATGCAAAAGAGGTGGACGG + Intronic
956318155 3:67962973-67962995 AAGAAAACACCAGATTTTGATGG + Intergenic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957255118 3:77826184-77826206 GAGAAAACACCAAACGTGGATGG - Intergenic
957356424 3:79093851-79093873 AAGAACAAAGCAGAGATGGAAGG + Intronic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
957687735 3:83524566-83524588 AAGAGCAAAGCAGAGGGGGATGG - Intergenic
957865168 3:86013532-86013554 AAAAACACAGCAGAGGCAGATGG + Intronic
958059332 3:88458565-88458587 AAGAAAACAGTAGAGATTAAAGG - Intergenic
958445942 3:94215243-94215265 AAGAAAACTGCCATGGTGGAAGG - Intergenic
958457051 3:94345318-94345340 CAGTGAACAGCAGTGGTGGACGG + Intergenic
958524345 3:95235657-95235679 CATAAAACAGTAGAGGAGGAGGG - Intergenic
959160231 3:102715260-102715282 AAAAAAACAGCAGTGGGGGATGG - Intergenic
959510361 3:107203747-107203769 AAGGAAACAGCAAAGGTGTGAGG - Intergenic
959858929 3:111194639-111194661 AATTACAGAGCAGAGGTGGAAGG + Intronic
959936584 3:112035776-112035798 AAGAAAATAAAAGAGGAGGAAGG + Intronic
959961021 3:112297960-112297982 AAGATTAGAGCAGATGTGGAGGG - Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960019266 3:112931636-112931658 GAGAAAGCAACAGAGATGGATGG - Intronic
960650171 3:119939162-119939184 AAAAATAGAGCAGGGGTGGAGGG + Intronic
961095882 3:124156195-124156217 GAGAGAGAAGCAGAGGTGGAGGG - Intronic
961239752 3:125400492-125400514 AAGAAAAGAGCAGGTGTGCAAGG + Intergenic
961735046 3:128996047-128996069 AAGAACAGGGCAGAGGTAGATGG - Intronic
961785688 3:129345210-129345232 AGGAAAAGTGCAGAGGAGGAAGG + Intergenic
961822734 3:129583525-129583547 AATGAAACAGCAGAGGCGGAGGG + Intronic
962323223 3:134408178-134408200 AATAGAACACCAGAGTTGGAAGG + Intergenic
962843924 3:139259009-139259031 CAGGGAACAGCAGAGCTGGAAGG - Intronic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963492266 3:146016733-146016755 CGCAAAACAGCAGTGGTGGAGGG - Intergenic
963532240 3:146485118-146485140 AAAAAAAAAGCAGGGGTTGAGGG + Intronic
963900887 3:150732473-150732495 AAGAAAGGAGAAGAGATGGAGGG + Intergenic
963930982 3:151004103-151004125 AGGAACACAGCATAGGTGGGGGG + Intergenic
964177059 3:153836622-153836644 AAGGAAGCAGCAAAGGAGGATGG + Intergenic
964640131 3:158900386-158900408 AGGAAAACAAAAGAGTTGGAGGG - Intergenic
965412215 3:168346220-168346242 AAAAAAAAAGCAAAGGTGAAAGG - Intergenic
965867504 3:173222939-173222961 GAGAAAACAGCAGAAGTAAAAGG - Intergenic
966182824 3:177202596-177202618 AAGAAAACAGAAGAAATAGAGGG + Intergenic
966300449 3:178473578-178473600 AAAAACAAAGCAAAGGTGGATGG + Intronic
967109366 3:186280029-186280051 AACAAGACAGCAGAGGCAGAAGG - Intronic
967350799 3:188511547-188511569 AAGAAAACACAAAAGGTGAAAGG - Intronic
967613264 3:191533648-191533670 AGGAAAATAGCCAAGGTGGATGG - Intergenic
967657208 3:192064555-192064577 AAAAAAAAAGGAGAGATGGAAGG - Intergenic
967949669 3:194831182-194831204 AAGAAATGAGCACAGATGGAGGG + Intergenic
968028377 3:195462197-195462219 TCGAACACAGCAGAGGTGGGTGG + Intergenic
968288378 3:197521277-197521299 TAGAATACAGCAGTGGGGGATGG - Intronic
968321786 3:197775989-197776011 AACAAAGGAGCAGAGGTGGAGGG + Intronic
968756606 4:2419186-2419208 AAGAAGACAGAAGAGGTGTTTGG - Intronic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
970107637 4:12603008-12603030 ACGAAAACAGGAGAGGGGGCCGG + Intergenic
971193354 4:24448367-24448389 CATAAAGCAGCAGAGATGGATGG - Intergenic
971321845 4:25612058-25612080 AAGAAAAAAAAAGAAGTGGAAGG + Intergenic
971627766 4:28945013-28945035 AATAATACAGATGAGGTGGAGGG - Intergenic
971880024 4:32359585-32359607 AAAAAAAAAGCATAGGAGGAAGG - Intergenic
971986644 4:33833820-33833842 AAGAAAATATCAGAGCTGGAAGG - Intergenic
972553854 4:40161398-40161420 AATAAAACCACACAGGTGGAGGG + Intergenic
972723442 4:41724028-41724050 AAAAAAGGAGCAGTGGTGGAGGG - Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
972929748 4:44057174-44057196 AGGAAGATAGCAAAGGTGGAAGG - Intergenic
973304869 4:48635093-48635115 AGGGAAGAAGCAGAGGTGGAAGG + Intronic
973699934 4:53526799-53526821 AATATAACAGAAGAGGTCGAAGG - Intronic
974114065 4:57559253-57559275 AAAAAAACAGCAGAGACTGAAGG - Intergenic
974441534 4:61924602-61924624 AAGGAAACAGTAGAGGTGGGAGG - Intronic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
974841794 4:67307594-67307616 CAGAGAACAGCAGTGGTGGATGG - Intergenic
974993799 4:69127972-69127994 AAGAAGAAATAAGAGGTGGATGG - Intronic
975177243 4:71301806-71301828 AAGTCAACAGCAGAGGTGGCTGG - Intronic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
975709675 4:77148035-77148057 AACAAAACGGCAGAGGAGAAGGG + Intergenic
976001519 4:80379058-80379080 AAGAAAACTCCAGTGGTAGAAGG - Intronic
976190167 4:82479711-82479733 CAGCAATCAGCAGTGGTGGATGG - Intergenic
976414383 4:84755394-84755416 AATCAAACTGCAGAGGTGAAAGG + Exonic
976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG + Intronic
976695806 4:87918746-87918768 AAGAAAAGAGAAGAGAGGGAAGG + Intergenic
976766881 4:88607107-88607129 AAGAGTACACCAGAGGTGTAGGG + Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977738317 4:100444694-100444716 AACAAAACATCAGGGATGGAGGG + Intronic
977935392 4:102797044-102797066 AAGAAATCATCTGAGGGGGAGGG - Intronic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980195295 4:129580233-129580255 AAGCTACCAGCTGAGGTGGAAGG + Intergenic
980386303 4:132090774-132090796 CAGCAAACAGCAGTGATGGATGG + Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
981023692 4:140054544-140054566 GTGAAAACAGGAGAGGTGCAAGG - Intronic
981567007 4:146112584-146112606 AATAAGAAAGCAGAAGTGGAAGG + Intergenic
982159685 4:152555149-152555171 AAGAAAGCAGCTGAAGAGGACGG - Intergenic
982682220 4:158444987-158445009 GAGAAATCAACAGAGATGGAGGG - Intronic
982972162 4:162002846-162002868 TAGAAATCAGCAGAGGTGGCCGG + Intronic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983107622 4:163708810-163708832 AAGAAAAGAGAGGAGATGGAGGG + Intronic
983177726 4:164611136-164611158 TAGAAAATAGAAGAGCTGGAGGG + Intergenic
983660519 4:170126752-170126774 AGGAAAACATGAGTGGTGGAAGG - Intergenic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
983773972 4:171583522-171583544 AGGAAAACAGCAGAAGTCTAAGG - Intergenic
983968136 4:173839118-173839140 AACCAAAAAGCACAGGTGGAAGG + Intergenic
984143480 4:176032724-176032746 AAGAAAATAGATTAGGTGGATGG + Intergenic
984365393 4:178792990-178793012 GAGCAAAAAGCAGAGGTGGAGGG - Intergenic
984676258 4:182551394-182551416 AATATAACAGCAGCGGTGGTAGG + Intronic
984689276 4:182707245-182707267 AAGATAACAGAAGAGATGGAGGG + Intronic
985104186 4:186485411-186485433 AAGAAAAGAGGGGAGGGGGAGGG - Intronic
985201121 4:187486621-187486643 AGGAAAACAGCAGAATTGTATGG + Intergenic
985321817 4:188721268-188721290 AAGAAAACAGCAACTGGGGAGGG + Intergenic
985350731 4:189058645-189058667 CAGACAACAGCGGTGGTGGACGG - Intergenic
985622797 5:964375-964397 GAGCAAACAGCACAGGTGCATGG + Intergenic
986067113 5:4245427-4245449 AAAAAGAAAGCAGAGGTGGAAGG - Intergenic
987131022 5:14860243-14860265 CAGAAACCTGCAGAGGAGGAGGG + Intronic
987508221 5:18800422-18800444 GGCAAAACAGCAGTGGTGGAGGG - Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988246669 5:28692610-28692632 AGGAAAAAAGTAGAGGTGGATGG + Intergenic
988349400 5:30082771-30082793 TAGAAAACAGCAGAACTGGCTGG - Intergenic
988487337 5:31677874-31677896 AGGACAGCAGCAGAGGAGGAAGG + Intronic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988865966 5:35335397-35335419 AAGAAAGCAGAAGAGGGGGTTGG - Intergenic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989398392 5:40982774-40982796 AACAAAACAGCAGCTGTGGGAGG + Exonic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
989717696 5:44483491-44483513 CAGCAAATAGCAGTGGTGGACGG - Intergenic
990266822 5:54085822-54085844 AAGAAAAGAGAAGAGGTGGATGG + Intronic
990341535 5:54827952-54827974 AAGAAAGCAGCAGTGGAGGTGGG + Intergenic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
991017778 5:61949891-61949913 AGGAACACAGCAAAGGTGAATGG - Intergenic
991065828 5:62424125-62424147 AAAAAAAAAGCTGAGGTGGGAGG - Intronic
991123483 5:63043390-63043412 AACAAAAGAACAGAGGTGGGTGG - Intergenic
991627672 5:68621069-68621091 ATGAAAATAGAAGAGGTGGAGGG + Intergenic
991940763 5:71850094-71850116 ATGAAAACAGCTGGGGTGGGGGG - Intergenic
992198422 5:74362093-74362115 CTGAAAACAGCAAAGGTGGCTGG - Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
993140446 5:84026501-84026523 AAGAAAAATGCAGAGGCAGAAGG - Intronic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993708858 5:91202390-91202412 AAGAAAACAGGATAGGAAGAAGG + Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
994673940 5:102797807-102797829 AAGCATACAGGAAAGGTGGAAGG - Intronic
995072655 5:107942272-107942294 AAGTTCAGAGCAGAGGTGGAGGG + Intronic
995105624 5:108374685-108374707 AAGAAAAGAGAAGAGGAGAAGGG + Intronic
995125595 5:108574491-108574513 AGCGAAACAGCAGTGGTGGATGG + Intergenic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
995602781 5:113816566-113816588 AAACAAACATCAGAGCTGGATGG + Intergenic
995822965 5:116258817-116258839 CAGACAAAAGCAGAGGTGCAGGG - Intronic
995826973 5:116311282-116311304 AAGAGAACAACAAAGCTGGAAGG - Intronic
996019247 5:118573683-118573705 AGGAAAACGGCAGTGGGGGAAGG - Intergenic
996035198 5:118750864-118750886 AAAAGAACAGGAGAGATGGAGGG - Intergenic
996992512 5:129652030-129652052 AAAAAAAAATCAGAGTTGGATGG + Intronic
997109532 5:131059584-131059606 AAGAAAAGAGAAGAGCTGGAAGG - Intergenic
997163324 5:131632472-131632494 AAGAAAAGAGCAGAGTAAGAGGG - Intronic
997368567 5:133341504-133341526 AAGGAAGCAGCAGAGGATGAGGG + Intronic
997541480 5:134666543-134666565 AAGAAAACAGGAAAGCAGGAAGG + Intronic
997606389 5:135178207-135178229 CAGAAGACAGCAGATCTGGAGGG + Intronic
998261870 5:140637933-140637955 AAGAAAAGAGGAAAGGAGGAAGG - Intergenic
998518974 5:142782713-142782735 GAGAAAACAGCATAAGTGCAAGG + Intronic
998532397 5:142897825-142897847 TAGTAAATAGCAGAGCTGGAAGG + Intronic
998713910 5:144859094-144859116 AAGAATTCAGCATAGATGGATGG - Intergenic
1000149912 5:158489864-158489886 GTGAAAAAAGAAGAGGTGGAAGG + Intergenic
1001549650 5:172593760-172593782 GAAAAGACAGCAGAGGTGGGAGG + Intergenic
1002683535 5:180988971-180988993 CAGATGACAGCAGGGGTGGATGG - Exonic
1002685562 5:181006506-181006528 AAGAAAACAGAAGAAGAGGAAGG + Exonic
1003157185 6:3606880-3606902 GACAGAACAGCAGAGGAGGAGGG - Intergenic
1004206857 6:13599209-13599231 AGGAAAAGAGGAGAGGGGGAAGG - Intronic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1004398661 6:15268687-15268709 TACAAAACAGCAGGGGAGGATGG - Intronic
1005024899 6:21453374-21453396 AAGAAAACAGGTGAGGTAGCTGG + Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005955539 6:30660886-30660908 AAGAAAAAAGAAAAAGTGGAAGG + Intronic
1006072476 6:31507504-31507526 AAGAAAACATCAGCGGCAGAGGG + Exonic
1006423371 6:33949181-33949203 AAGAACAGAGGAGAGGTTGAGGG - Intergenic
1006899172 6:37489256-37489278 AAAAAAACAGCAGGGGTGTGAGG + Intronic
1007011949 6:38426521-38426543 GGCAAAACAGCAGTGGTGGATGG - Intronic
1007266315 6:40598998-40599020 ATGAAAACAGAGGAGTTGGAGGG + Intergenic
1007325250 6:41054562-41054584 CAGAAAACATCTGAGCTGGAAGG - Intronic
1007347198 6:41240529-41240551 ATGAAAACAGCATATGTGGCCGG + Intergenic
1007956153 6:45919492-45919514 AAGAAGAAAGGAGAGGTGGTGGG - Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1008847512 6:55985629-55985651 CAGAAAACTGCATAGGTGTAAGG + Intergenic
1009044532 6:58221811-58221833 GAGAAAACACCAGAGGTGACAGG + Intergenic
1009220355 6:60976055-60976077 GAGAAAACACCAGAGGTGACAGG + Intergenic
1009314885 6:62205640-62205662 AAGAAAAGAGTAGAGATGCAGGG + Intronic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1010247619 6:73676457-73676479 AAGACAAGAGCTGGGGTGGAAGG - Intergenic
1010296566 6:74205048-74205070 AAGAAAACAAGAGAGGAAGAAGG - Intergenic
1010298681 6:74232175-74232197 AAGAAAAAAGAAAAGATGGATGG - Intergenic
1011190324 6:84720755-84720777 CAGCGAACAGCAGTGGTGGATGG + Intronic
1011560565 6:88609610-88609632 AACAAAATGGCAGGGGTGGATGG + Intergenic
1011742631 6:90377706-90377728 AAGAAAAAAGAAGAAGGGGAAGG - Intergenic
1012235755 6:96812993-96813015 AAGATAACAGAAGAGGAAGAGGG - Intronic
1012276404 6:97280174-97280196 AAGGAAAATGGAGAGGTGGAAGG - Intronic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013051278 6:106537979-106538001 AAGAAAAAAGCAAAGAGGGAGGG + Intronic
1013078034 6:106788623-106788645 AAGAAAGAAGAAGAGGGGGAAGG - Intergenic
1013301450 6:108808622-108808644 ATGAAAACTGCAGACCTGGAGGG - Intergenic
1013616835 6:111851163-111851185 TAGAGGACAGCAGAGGTGGCTGG + Intronic
1013918525 6:115370652-115370674 AAGAAAGCAACAGAGGTTGAAGG + Intergenic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1014255008 6:119152184-119152206 AATAGAGCAGCAGATGTGGAGGG - Intergenic
1014917212 6:127165642-127165664 AAGAAATCTGCTGAGATGGAAGG - Intronic
1015579466 6:134707794-134707816 AATACAACAGCAGGGGTGGGTGG - Intergenic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1015742412 6:136470699-136470721 TAGAACACATCAGAGGTGGGAGG + Intronic
1015844042 6:137499010-137499032 GGGAAAATAGCAGAAGTGGAAGG + Intergenic
1016084839 6:139901024-139901046 AACAAAACAGTAGAAGAGGAAGG + Intergenic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1016485610 6:144534899-144534921 AGTAAAACAGCAGAGGTGGGAGG + Intronic
1016761443 6:147741807-147741829 AAGAAAAGAGCAGAGAAGGAGGG - Intergenic
1017273397 6:152536125-152536147 AAATCAAGAGCAGAGGTGGAGGG - Intronic
1017556295 6:155574361-155574383 AAGTAAATAACAGATGTGGATGG - Intergenic
1017892889 6:158653959-158653981 AAGAAAAGAGATGAGGAGGATGG - Intronic
1018481995 6:164200297-164200319 CAGAAAACTGCATTGGTGGATGG + Intergenic
1018743268 6:166746077-166746099 AAGAAATCTGTAGAGGCGGAAGG - Intronic
1019380906 7:722961-722983 AAGAATAAAGCAGACGAGGAGGG - Intronic
1019444414 7:1063854-1063876 AAGAGAACAGCACAGGTACAGGG - Intronic
1019636437 7:2078553-2078575 AAGAAGAAAGCAGAGGAGGCTGG + Intronic
1019903654 7:4043975-4043997 AAGAAAACACAAGAGGAGGAAGG - Intronic
1020792457 7:12643571-12643593 GAGAGAACACTAGAGGTGGAAGG - Intronic
1020859067 7:13465534-13465556 AAGATAACATCAAAGGTGGGTGG - Intergenic
1020972643 7:14964993-14965015 GTGAAAAAAGCAGAGGTAGAGGG + Intronic
1021144253 7:17065920-17065942 CAGCGAACAGCAGTGGTGGACGG - Intergenic
1021337242 7:19419028-19419050 AATAAAAAGGCAGAGGAGGAAGG + Intergenic
1021449078 7:20764789-20764811 AGGAAAAGAGGAGAAGTGGAAGG + Intronic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1021935630 7:25628526-25628548 AAGCAAAAAGGAGAGGAGGATGG - Intergenic
1021948517 7:25752216-25752238 AAGAAAACTGCAGGGCTGGGGGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022644816 7:32220237-32220259 AAGTATACAGAAGAGGTGGAGGG + Intronic
1022843710 7:34189861-34189883 AACATAAAAGCAGAGGTGGGAGG - Intergenic
1024037255 7:45518115-45518137 AATAAAACATCAGAAATGGAGGG + Intergenic
1024109882 7:46134237-46134259 AAGAGAACGCCAGAGGTGCATGG - Intergenic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1024596454 7:50941535-50941557 AAGAACACAGCGCAGGGGGATGG + Intergenic
1025273276 7:57546757-57546779 AAGAAAATATCAGAGCTGGAAGG - Intergenic
1026132966 7:67635548-67635570 AAGGGGACAGCAGAGGTGAATGG - Intergenic
1027148435 7:75715091-75715113 AAGAAAACCACAGAGCTGGCTGG + Intronic
1027960365 7:84939300-84939322 AAGAAAAGGCCAGAGCTGGAGGG + Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028371782 7:90100299-90100321 AAGAAAAGAGGGGAGGGGGAAGG + Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028863154 7:95677816-95677838 AATAAAATAGCAGAGGTGATGGG + Intergenic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1029603806 7:101586213-101586235 AAGAAAACAGCCCAGGGAGAGGG - Intergenic
1029667910 7:102007714-102007736 AAAAAAACACCAGAGGTGGGTGG - Intronic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030353706 7:108520176-108520198 AGCAAACCGGCAGAGGTGGAAGG + Intronic
1030770406 7:113468224-113468246 AAGAAAAAAGGAGGGGAGGAAGG - Intergenic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032259455 7:130323208-130323230 AAAAAAACAGGAGAGGAGGGAGG - Exonic
1032400393 7:131620342-131620364 GATAAACCAGCAGAGGTGGAAGG - Intergenic
1032582583 7:133117038-133117060 AAGAAAACACCAATGGTGGGTGG + Intergenic
1033721002 7:144059530-144059552 ATGAAAACAGCTGAGTTGGAGGG - Intergenic
1034112277 7:148548513-148548535 AAGAAAACAGAAGTGGAGGAAGG - Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1034974561 7:155440269-155440291 AAGTACTCAGCAGAGGTGGAAGG - Intergenic
1035022408 7:155807416-155807438 GAGCAAACTGAAGAGGTGGAGGG + Intronic
1035083116 7:156233709-156233731 AAGAGAACAGAAGAGATGGTTGG + Intergenic
1035096376 7:156359470-156359492 ATGGAACCAGGAGAGGTGGAAGG - Intergenic
1035208314 7:157309376-157309398 AAAGAACCAGCAGGGGTGGAAGG + Intergenic
1035390814 7:158503428-158503450 AAGAAAGCAGAAGAGGTGGATGG + Intronic
1035392659 7:158515722-158515744 AAGGAATCAGGAGAGGAGGATGG - Intronic
1035584478 8:761266-761288 AAGAAATCCACAGAGATGGAAGG - Intergenic
1036048531 8:5170253-5170275 AAGAAAACCTCAGAGATGGTGGG + Intergenic
1036619544 8:10415582-10415604 AAGATGGAAGCAGAGGTGGATGG - Intronic
1037165085 8:15817599-15817621 AAGTGCAGAGCAGAGGTGGAGGG - Intergenic
1037176195 8:15949090-15949112 AAGGAAAGAAAAGAGGTGGAGGG + Intergenic
1037583167 8:20258218-20258240 AATAAAACAGGAGATGTGGAAGG + Intronic
1037655004 8:20875417-20875439 AAGAAAATAGCAGAGCTGGCTGG + Intergenic
1037744277 8:21630595-21630617 AAGAATACAGCAGAGAGGGAAGG + Intergenic
1038347841 8:26748351-26748373 AGAAAAACAGCAGGGCTGGACGG - Exonic
1038350558 8:26772393-26772415 AAGAAAAGAAAGGAGGTGGAAGG - Intronic
1038856542 8:31339248-31339270 AAGAAGACAGGAGAGAAGGAGGG + Intergenic
1039262585 8:35787987-35788009 AAGAAAAAAGAAAAGGAGGAAGG + Intronic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1040730171 8:50435494-50435516 AGGAAAGAAGCAGAGGTGTAAGG + Intronic
1041030708 8:53733052-53733074 AGGAGATCAGCAGAGGTGAAGGG - Intronic
1041096069 8:54351456-54351478 AAGCAAACAGTATGGGTGGAGGG - Intergenic
1041327888 8:56688626-56688648 AAGAAAACAGAAGAGGTTCAAGG + Intergenic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1042098093 8:65241263-65241285 AAGAAAAGAGCATAGATGGGTGG - Intergenic
1042601896 8:70506842-70506864 AAGAAAACAGCTGAGTGGAAAGG + Intergenic
1043179145 8:77062421-77062443 AAGAAAACAGTAGAAATGGTAGG + Intergenic
1043181077 8:77087413-77087435 AAGAGAACAGCACTGGGGGATGG + Intergenic
1043207307 8:77462538-77462560 GAGAAGACAGGAGAGGTTGAAGG + Intergenic
1043266582 8:78273709-78273731 AAGAAAAAAGAAGAGAGGGAAGG - Intergenic
1043369928 8:79579007-79579029 AAGAAAATAGAAGAGTTGGAGGG - Intergenic
1043727869 8:83633957-83633979 AAGAAAAAAAAAGAGGAGGAAGG - Intergenic
1043814197 8:84781492-84781514 AAGAATAGAGTAGAGGTAGAGGG + Intronic
1044287225 8:90422942-90422964 TAGAAAAAAGCAGAAGAGGAAGG - Intergenic
1044487053 8:92766392-92766414 TGGACAACAGCAGAGGTGGCTGG + Intergenic
1044918343 8:97140272-97140294 AAGAAAACATCAGACTTTGATGG + Intronic
1045230584 8:100302717-100302739 AAGGAGACAGAAAAGGTGGAAGG + Intronic
1045372586 8:101539496-101539518 AAGAAGGTAGCAGAGGTGGTGGG - Intronic
1045550008 8:103163173-103163195 AAGACATAATCAGAGGTGGAAGG - Intronic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1045982426 8:108206343-108206365 AAGAAAAAAGAAAAAGTGGAAGG + Intronic
1046374570 8:113359818-113359840 AAGAAAACAGTGGAGATGGTGGG + Intronic
1046877516 8:119272167-119272189 AAGAAAAGAGAAGAGGGGGAGGG + Intergenic
1047272391 8:123374540-123374562 AAGAAGACAGTAGGGGTGGGTGG - Intronic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1047561252 8:125989981-125990003 GAGGAAACAGCAAAGGTAGAGGG + Intergenic
1047976831 8:130138853-130138875 AAGAAAACAGCTGAAGTGTTTGG + Intronic
1048496452 8:134939859-134939881 AAGTAAACAGCAGTGGAGGGAGG + Intergenic
1048565180 8:135588576-135588598 AAGGAAAGAGGAGAGGTGGCTGG - Intronic
1048631490 8:136247645-136247667 CAGCAAACAGCAGTGGTGAATGG - Intergenic
1048695913 8:137027613-137027635 AAGAAAACGGCAGGAGTTGAAGG + Intergenic
1048724430 8:137366435-137366457 GAGAAAAGAGGAGAGGTTGAGGG - Intergenic
1048947761 8:139465892-139465914 AAGAAGAAAGGAGAGGAGGAAGG + Intergenic
1049120902 8:140736364-140736386 AATAAAACAGCAGGGAGGGAAGG + Intronic
1049630036 8:143648884-143648906 AAGAAGATAGGAGAAGTGGAAGG + Intronic
1049732325 8:144185021-144185043 AAGAAAGGAGCTGAGGAGGAGGG + Intronic
1050042399 9:1510091-1510113 AGGAAAACAACACAGGGGGAAGG + Intergenic
1050668593 9:7969731-7969753 AGGAAAAGAGCATAGGTGGTAGG + Intergenic
1050808705 9:9717578-9717600 TTGAAAACAGCAGACATGGAAGG + Intronic
1050863757 9:10470800-10470822 AAGGAAACAGGAGTGGTGGAGGG + Intronic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1051970178 9:22878077-22878099 CAGCCAACAGCAGTGGTGGACGG + Intergenic
1052323321 9:27191596-27191618 AAAAAAAGAGAAGAGGAGGAGGG + Intronic
1052641609 9:31174381-31174403 AATAAATCAGCATAGGTAGAAGG + Intergenic
1052680130 9:31680551-31680573 AAGAAAAAAGAAGAGAAGGAAGG + Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1053153261 9:35756393-35756415 AAGGAGACAGCTAAGGTGGATGG + Exonic
1053802323 9:41772241-41772263 AAGACCACAGGACAGGTGGAAGG - Intergenic
1054142962 9:61543099-61543121 AAGACCACAGGACAGGTGGAAGG + Intergenic
1054190556 9:61983227-61983249 AAGACCACAGGACAGGTGGAAGG - Intergenic
1054647757 9:67604190-67604212 AAGACCACAGGACAGGTGGAAGG + Intergenic
1055218199 9:73893785-73893807 TAGAAAACAGAACAGGTGAAGGG + Intergenic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1055961256 9:81822338-81822360 AACAAAACCCCAAAGGTGGAGGG - Intergenic
1056049974 9:82757859-82757881 AAGAAAGCAACAGAGGAGGGAGG - Intergenic
1056253379 9:84773390-84773412 AAGAACACAGCAGTGATGGAGGG + Intronic
1056268044 9:84919251-84919273 AAGAAAGAAGCTGATGTGGATGG - Intronic
1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG + Intergenic
1056740712 9:89252149-89252171 AAGAAGACAGCAAAGGGTGAAGG + Intergenic
1056786370 9:89595202-89595224 TGGAAAATAGCAGAGATGGATGG + Intergenic
1056893250 9:90515724-90515746 AAGAAAAGACTGGAGGTGGAGGG + Intergenic
1057092719 9:92274117-92274139 AAGAACACAGCAGAGGTGATGGG + Intronic
1058645762 9:107130412-107130434 AAGAAAACAGAAAAGGTGGCTGG + Intergenic
1059268448 9:113057489-113057511 AAGAAAAAAGAAAAGGTGGGAGG + Intergenic
1059367781 9:113800177-113800199 CAGAAAACAGCAGCTGTGGAGGG + Intergenic
1059679154 9:116569500-116569522 AGATAAACAGCAGAGCTGGAAGG - Intronic
1060174049 9:121484347-121484369 AAGAAAAATGCAGAGGTAGAAGG - Intergenic
1060370988 9:123070841-123070863 AAGAAAATAAAAAAGGTGGAGGG - Intronic
1060422990 9:123482864-123482886 AACAGGACAGCAGAGGGGGAGGG + Intronic
1060573298 9:124664272-124664294 AAGCAAACAGCGGAAGTGTAAGG + Intronic
1060670872 9:125468134-125468156 AAGAAAACACAAGAAGTAGAAGG + Intronic
1060700027 9:125742750-125742772 AGGAAACTAACAGAGGTGGATGG + Intergenic
1060887784 9:127167820-127167842 AAGCCAAGAGGAGAGGTGGAGGG - Intronic
1061344441 9:130011022-130011044 AAACAGACAGCAGAGATGGAAGG + Intronic
1061404793 9:130387491-130387513 CAGAAAAGAGCAGAAGTGGTGGG + Intronic
1061928856 9:133821902-133821924 CAGAAAACAGCAGGAGTGAAAGG - Intronic
1062011836 9:134271447-134271469 TAGAAAATGGCAGAGGTGAAGGG + Intergenic
1062116690 9:134813419-134813441 AAAAAATGAGCAGCGGTGGAAGG - Intronic
1062723892 9:138060394-138060416 TAGAAACCAGCAGAGGGGCATGG + Intronic
1185818128 X:3175397-3175419 AAGAAAAAAGAAAAGGGGGATGG + Intergenic
1188345903 X:29065019-29065041 AACAAAACAAATGAGGTGGAAGG - Intronic
1189176261 X:38960375-38960397 AAAAAAACAGCAAAGCTGCAAGG - Intergenic
1189268476 X:39734080-39734102 AAGAATCCAGCAGAGGGTGAGGG - Intergenic
1189700983 X:43716168-43716190 AAGTAAACAGGAAAGGTGGATGG + Intronic
1189852240 X:45189315-45189337 AAGAAAAGAGCAGGTGTGGCTGG + Intronic
1189954280 X:46262003-46262025 CAGCAAACAGCAGCGGTGGGCGG + Intergenic
1190010189 X:46777781-46777803 AATAAAACAACAGAAGTGGAAGG + Intergenic
1190474656 X:50814254-50814276 AAGAAAGAAGGAGAGGCGGAGGG + Intronic
1190491116 X:50983470-50983492 AAGAAGACAGAAGAGGAGAAAGG - Intergenic
1190632545 X:52401631-52401653 AAAATAACAGCACAGGTGGTGGG - Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1191595114 X:62935291-62935313 AAAAAAACAGCTGAAGTGCAGGG + Intergenic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192409534 X:70920760-70920782 AACAAGGTAGCAGAGGTGGAAGG + Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192632984 X:72791337-72791359 TAGAAAACAGAAGAGAAGGAGGG + Intronic
1192648725 X:72929464-72929486 TAGAAAACAGAAGAGAAGGAGGG - Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1192963479 X:76153304-76153326 AAGAGAAAAGCAGAGATGAATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1194941008 X:100010148-100010170 AATAAAAGGGCAGAGGTGAAAGG - Intergenic
1194960871 X:100234215-100234237 AAGAGGACAGCAGAAGAGGAGGG + Intergenic
1195177884 X:102328525-102328547 AAGAACAGAGCAGTTGTGGATGG - Intergenic
1195180980 X:102358568-102358590 AAGAACAGAGCAGTTGTGGATGG + Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195274256 X:103264921-103264943 AACAAAGCAGCAAAGTTGGAAGG + Intergenic
1195584602 X:106551389-106551411 CAGCAAACAGCAGTGGTGGTCGG - Intergenic
1195613288 X:106893249-106893271 AAAAAAACAGCAGAGCATGATGG + Intronic
1195893011 X:109716472-109716494 AAGAAAAATGCAGAGTTGAAAGG + Intronic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196491989 X:116278400-116278422 GAGAAAAAAGAAGAGATGGAAGG + Intergenic
1196625119 X:117869543-117869565 CAGAATACAGCAGAGGTTGCTGG + Intergenic
1197106081 X:122717824-122717846 TTGAAAAATGCAGAGGTGGATGG + Intergenic
1197306557 X:124849314-124849336 TAGAATACAGCAAAGGTGGTGGG + Intronic
1197537875 X:127712898-127712920 AAAAAAAAAACAGAGGAGGAGGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198708721 X:139478047-139478069 AGGGAAAGAGAAGAGGTGGAAGG + Intergenic
1198719521 X:139600885-139600907 AAGACAACAGAAGATGTGCAGGG + Intronic
1198823380 X:140673420-140673442 AAAAAAACAGAAGAGTTGGCTGG - Intergenic
1198969633 X:142266854-142266876 AAGAGGTCAGCAGAGGTGAAAGG - Intergenic
1199036499 X:143056960-143056982 AAGAAAAGAGAAAAGGGGGAAGG - Intergenic
1199307318 X:146281080-146281102 AAGAAAAGAGAAGAGCTGGAAGG - Intergenic
1199432073 X:147773164-147773186 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1199729349 X:150615833-150615855 CAAAAAAAAGCTGAGGTGGATGG - Intronic
1199872185 X:151909291-151909313 AAGAAAACAGATCATGTGGAGGG + Intergenic
1199895509 X:152123244-152123266 AAGAAAACAGGTCATGTGGAGGG - Intergenic
1200292949 X:154888870-154888892 AAGAAAACAGCGTAGTTGGGGGG - Intronic
1200339797 X:155384602-155384624 AAGAAAACAGCGTAGTTGGGGGG - Intergenic
1200346673 X:155456086-155456108 AAGAAAACAGCGTAGTTGGGGGG + Intergenic
1201421473 Y:13804542-13804564 CAGCAAACAGCAGTAGTGGAGGG - Intergenic
1201680935 Y:16643117-16643139 AAGAGGTCAGCAGAGGTGAAAGG + Intergenic
1201725695 Y:17149114-17149136 ATGAAAACAGCAATGCTGGAAGG + Intergenic
1201942394 Y:19473955-19473977 AAGAAAAGGGCAGAGGTCAAAGG - Intergenic