ID: 1126482564

View in Genome Browser
Species Human (GRCh38)
Location 15:49142352-49142374
Sequence TTAATAGGAGGGGCACTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 64}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126482564_1126482572 24 Left 1126482564 15:49142352-49142374 CCATGGAGTGCCCCTCCTATTAA 0: 1
1: 0
2: 1
3: 17
4: 64
Right 1126482572 15:49142399-49142421 GACAGTACCTCAAAAAGAAGAGG 0: 1
1: 0
2: 0
3: 16
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126482564 Original CRISPR TTAATAGGAGGGGCACTCCA TGG (reversed) Intronic
900016634 1:155138-155160 TTAATAGGAGAGGCAATGCATGG + Intergenic
900046895 1:513730-513752 TTAATAGGAGAGGCAATGCATGG + Intergenic
900069099 1:755448-755470 TTAATAGGAGAGGCAATGCATGG + Intergenic
916450535 1:164916350-164916372 GTAGTAGGAAGGGCAGTCCATGG + Intergenic
922264780 1:223973355-223973377 TTAATAGGAGAGGCAATGCATGG + Intergenic
922740925 1:228013861-228013883 TTAAGATCAGGGCCACTCCATGG - Intronic
1067264686 10:44729322-44729344 ATAATAAGAGGGTCATTCCATGG - Intergenic
1076973225 11:150207-150229 TTAATAGGAGAGGCAATGCATGG + Intergenic
1078386490 11:10897579-10897601 TCCATAGGAGGGGCACTACTGGG + Intergenic
1080316953 11:30959948-30959970 TTATTAGGAAGGGCAATCCCAGG - Intronic
1082992666 11:59221478-59221500 TTATTGGGAGGTGCAATCCAAGG - Intergenic
1084014337 11:66369764-66369786 TGAAGAGGAGGGGCCGTCCAAGG - Intronic
1085280855 11:75329505-75329527 TTAACAGGAGGGGCTCTGCAAGG - Intronic
1086323817 11:85678092-85678114 TAAATTGGAGGGGCTCTCAATGG - Intronic
1086521722 11:87676017-87676039 TTTGCAGGAGGGGCTCTCCAGGG - Intergenic
1088416571 11:109596003-109596025 TTGTTAGGAGAGGCACTCCATGG - Intergenic
1089789323 11:120931258-120931280 TTATTAGGAGGGCCCCTGCAGGG + Intronic
1090090337 11:123691239-123691261 TCAAAAGGAGGGGGATTCCATGG - Intergenic
1103911023 12:124352339-124352361 TTAAAAAGGGGGGCTCTCCATGG + Intronic
1110125648 13:71939602-71939624 CTAGGAGGAGGGGCACTACAGGG + Intergenic
1112779503 13:102883339-102883361 TTAATCTGAGTGGCACACCAGGG + Intergenic
1113519752 13:110931608-110931630 CTAATCTGACGGGCACTCCATGG - Intergenic
1118251051 14:64161596-64161618 TTCATAGGCGGGGCGCACCATGG + Intronic
1119243404 14:73081850-73081872 TCACTAGGAGAGGCATTCCAGGG - Intronic
1122854660 14:104554332-104554354 TTCAGAGGTGGGGCACCCCATGG + Intronic
1126482564 15:49142352-49142374 TTAATAGGAGGGGCACTCCATGG - Intronic
1126561387 15:50048170-50048192 TTAACAGGAGGGGAGCTCCTGGG + Intronic
1129455336 15:75673659-75673681 GTCATAGGAGGGGCGGTCCAGGG + Intergenic
1130641877 15:85684076-85684098 TTAATAGGAGTTGCAAACCAAGG - Intronic
1131645234 15:94334971-94334993 TTCATGGGAGGGGCACTCCACGG - Intronic
1132549841 16:549839-549861 GTAAGAGGAGGGGCACTGCGTGG + Intronic
1139003822 16:62546827-62546849 TCCATAGGAGAAGCACTCCAGGG + Intergenic
1142447026 16:90147319-90147341 TTAATAGGAGAGGCAATGCATGG - Intergenic
1142460466 17:88012-88034 TTAATAGGAGAGGCAATGCATGG + Intergenic
1146927097 17:36752736-36752758 ATGATAGGAGGGGCTCCCCAAGG - Intergenic
1147815408 17:43206263-43206285 TTAATAGGAGGAGCAATTGAAGG + Intronic
1150052967 17:61983019-61983041 TTACTAGGAGGTGCACTGCTAGG + Exonic
1159704677 18:71673234-71673256 TTAAAAGGAGAGGCACCCCTAGG + Intergenic
1160650181 19:220512-220534 TTAATAGGAGAGGCAATGCATGG + Intergenic
1161929365 19:7326328-7326350 GTAATGGGAGGAGCACCCCATGG - Intergenic
926850048 2:17186292-17186314 TTTATAGGAGGGACTATCCACGG - Intergenic
932766382 2:74473193-74473215 GTAATAGGAAGGGCAGTACAGGG + Exonic
934593125 2:95576269-95576291 TTAATATAAGGAGCACTCTAAGG + Intergenic
937626640 2:124051404-124051426 TTAATAACAAGGGCACTCTAGGG + Intronic
937815998 2:126251349-126251371 GTAAGAGGAAGGGCACTGCAGGG + Intergenic
946439926 2:219686547-219686569 GTGAAAGCAGGGGCACTCCAGGG - Intergenic
946943644 2:224796795-224796817 TTAATAGTAGGGGCACAGCTGGG - Intronic
1171062616 20:21981167-21981189 TTAATAAGAGGGGCTCTGCAAGG - Intergenic
1174092897 20:48063545-48063567 ATAATGGGAGAGGCACTGCATGG - Intergenic
1174759116 20:53189226-53189248 TTAATAGAACGGGCCTTCCAAGG - Intronic
1179451067 21:41468811-41468833 TGAATAAGAGGGGGATTCCATGG - Intronic
1182759898 22:32713935-32713957 TTACTGGGAAGGTCACTCCAAGG - Intronic
951666508 3:25130580-25130602 TTAATAGGAGATGTAATCCAGGG - Intergenic
951826069 3:26870324-26870346 GTTATGGGAAGGGCACTCCAAGG + Intergenic
953256919 3:41299503-41299525 TTAATAGGCTGGGCACTGCCAGG - Intronic
955756553 3:62230670-62230692 TAAATAGGAGAGGCACCTCAGGG - Intronic
966371240 3:179252577-179252599 TCAGAAGGTGGGGCACTCCATGG + Intronic
967242262 3:187451581-187451603 TTATTAGGATGGCCACTTCAGGG - Intergenic
968367666 3:198199617-198199639 TTAATAGGAGAGGCAATGCATGG - Intergenic
983468687 4:168128138-168128160 ATGCTAGGAGGAGCACTCCAAGG + Exonic
985125091 4:186685137-186685159 ATGACAGGAAGGGCACTCCAAGG + Intronic
985161018 4:187044806-187044828 TTACTAGGAAGGGCCCACCATGG - Intergenic
986713456 5:10504277-10504299 TTATCAGGAGGGACACTCCAAGG + Intergenic
993479086 5:88400612-88400634 TAAATAGGAAGCGCACTCCACGG + Intergenic
1001228860 5:169968706-169968728 TTATTAGGAAGGGTACTCCCTGG + Intronic
1002041775 5:176520057-176520079 TCAATATGAGGGTCTCTCCAGGG + Intergenic
1002726886 5:181304846-181304868 TTAATAGGAGAGGCAATGCATGG - Intergenic
1003805709 6:9724371-9724393 TTAATAGGAAGGGAACTATAGGG - Intronic
1014421097 6:121246054-121246076 TTAATAGGAGAGGCACCCCTGGG - Intronic
1015391825 6:132690982-132691004 TTAGTAGGTGGGGCTCGCCACGG + Intronic
1023962091 7:44935512-44935534 TGAATGGCAGGGACACTCCATGG + Intergenic
1027934466 7:84585664-84585686 ATCTTAGGAGGGGCAGTCCATGG + Intergenic
1031369547 7:120947987-120948009 TCCATATGAGGGGCACTCCCTGG + Intergenic
1035305624 7:157929542-157929564 GTAAAAGGAGGGGAATTCCAGGG - Intronic
1035461522 7:159041927-159041949 TTACTAGGACAGGAACTCCAGGG + Intronic
1036077455 8:5517237-5517259 TTATTAGGAGGTGCAATCCCAGG - Intergenic
1037967599 8:23146209-23146231 TTAGGAGGAGCCGCACTCCAGGG + Intronic
1038576691 8:28710443-28710465 TTAATATGAGGTGCACAGCATGG + Intronic
1050097873 9:2086497-2086519 TTAATAGAAGGGGCATTGGATGG + Intronic
1054720635 9:68600231-68600253 TTAATAGAAAGAGCATTCCAAGG - Intergenic
1059461293 9:114432126-114432148 TTAAAATGAAGGGCATTCCATGG - Intronic
1062752007 9:138262322-138262344 TTAATAGGAGAGGCAATGCATGG - Intergenic
1194755000 X:97728522-97728544 TTAGAAGGAGGGGCACTTTAGGG - Intergenic