ID: 1126484217

View in Genome Browser
Species Human (GRCh38)
Location 15:49161340-49161362
Sequence AGGTGCTAATAAGTGCTAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 113}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126484217 Original CRISPR AGGTGCTAATAAGTGCTAGT TGG Intronic
905574474 1:39032678-39032700 AGGTGATAATAAGTGCTGTGAGG + Intronic
907176365 1:52527118-52527140 AGGTACAAATAGATGCTAGTTGG - Intronic
910719882 1:90274469-90274491 AGGTGCTGAGAAGTGTTAGAGGG + Intergenic
911469562 1:98300789-98300811 AAGTGGTAAAAATTGCTAGTTGG - Intergenic
912019947 1:105095876-105095898 AAGTGGTAATAAGGGCAAGTTGG - Intergenic
912537793 1:110388546-110388568 AGGTGCTAAAAAGTGCTCTGGGG - Intronic
917447146 1:175115841-175115863 AGGTGCTGATAGGGGCTACTGGG + Intronic
918469895 1:184861458-184861480 AGGTGCTGATAAGTATTTGTTGG + Intronic
921350446 1:214229288-214229310 AGGTGTTTGTAAGTGCTTGTTGG - Intergenic
923512489 1:234664389-234664411 AGGTGCTAATCACAGCTACTCGG + Intergenic
1062904201 10:1169079-1169101 AGGCGCTAATGAGTGCTTTTAGG + Intergenic
1065315799 10:24462876-24462898 AGGCGCTAAAAAGTTGTAGTTGG + Intronic
1066526774 10:36288749-36288771 AGGCACTAACAAATGCTAGTGGG - Intergenic
1067697970 10:48549108-48549130 AGGTGTGTATGAGTGCTAGTGGG - Intronic
1067728203 10:48789581-48789603 AGGTGCTAAGAAGAGCAAGAGGG - Intronic
1068612178 10:59072180-59072202 AGGTGCGGAGAAGTGCTTGTTGG + Intergenic
1069779103 10:70943668-70943690 AGCTGCTAGTCAGTGCTAGCTGG - Intergenic
1072069318 10:91901070-91901092 AGGGGCTAATAAGTCACAGTGGG - Intergenic
1072706781 10:97686875-97686897 AGGTGCTTACAAGGGCCAGTCGG + Exonic
1072934832 10:99702128-99702150 AGGAGCTGATAAATGTTAGTAGG - Intronic
1075573608 10:123562714-123562736 AGGTGGTGATAAGAGCTAGGCGG - Intergenic
1078662476 11:13298462-13298484 AGATGGTGATAAGTGCTAGGAGG - Intronic
1081510744 11:43770375-43770397 AGGTCCTAATAAAAGCAAGTAGG - Intronic
1082826727 11:57585273-57585295 AGGCGATAATAACTGCTAGAAGG + Intergenic
1085276675 11:75304655-75304677 AGGTGCTACTAACATCTAGTAGG + Intronic
1089032550 11:115347376-115347398 AGGTGCTAATAACTCCAAGTGGG - Intronic
1090406836 11:126481160-126481182 AGGTGTTGATAAGTACTAGAAGG + Intronic
1093771097 12:23019648-23019670 AGGGGCTTATAAATTCTAGTTGG + Intergenic
1094564565 12:31588359-31588381 AGATGTTAATAAGTGCTATGAGG - Intronic
1103201689 12:119093144-119093166 AGAAGGTAATAAGTGCTAGGGGG - Intronic
1113921931 13:113918207-113918229 AGGAGCTGATAAGAGCCAGTGGG + Intergenic
1115235062 14:31201315-31201337 AGATGCTTTTAGGTGCTAGTAGG - Intronic
1119977730 14:79043984-79044006 AGGTGCTACTAATATCTAGTGGG - Intronic
1126484217 15:49161340-49161362 AGGTGCTAATAAGTGCTAGTTGG + Intronic
1128841142 15:70852981-70853003 AGCTCCTAATAAGTGCCTGTTGG + Intronic
1130680172 15:85989682-85989704 AGTTGCTAATTAGGGCAAGTTGG + Intergenic
1135013346 16:18903572-18903594 AGCTCCTAACAAGAGCTAGTGGG + Intronic
1135320277 16:21491168-21491190 AGCTCCTAACAAGAGCTAGTGGG + Intergenic
1135373112 16:21922658-21922680 AGCTCCTAACAAGAGCTAGTGGG + Intergenic
1135438677 16:22448044-22448066 AGCTCCTAACAAGAGCTAGTGGG - Intergenic
1136330502 16:29572866-29572888 AGCTCCTAACAAGAGCTAGTGGG + Intergenic
1136445132 16:30312586-30312608 AGCTCCTAACAAGAGCTAGTGGG + Intergenic
1141797235 16:86283305-86283327 AGCTGCTAGTAAATGCTGGTTGG - Intergenic
1147033502 17:37661443-37661465 AGTTGTTAATCATTGCTAGTAGG + Intergenic
1149097065 17:52855969-52855991 AGTAGCTACTAAGTGCTACTAGG + Intergenic
1149292470 17:55230525-55230547 AGATGGTAATAAGTGCTCTTGGG - Intergenic
1150163016 17:62915191-62915213 AGGTAGTAATAAGTGTTAATTGG - Intergenic
1150220924 17:63495487-63495509 AAGTGCTAATAACTGATTGTGGG + Intronic
1151418108 17:73979897-73979919 AGGTACTAATGAGTGCTGGAGGG + Intergenic
1157044482 18:44083337-44083359 TGGTGCTGTTAAGTTCTAGTAGG - Intergenic
1159147718 18:64476092-64476114 AGGTGTTAATGATTGCTAATGGG - Intergenic
928080235 2:28305066-28305088 AGGTCCTATTCAGTGCAAGTAGG - Intronic
939402816 2:141716163-141716185 AAGTGTTAAAAAGTGCTAGTTGG - Intronic
941019444 2:160392161-160392183 TGGTGCTAATAAGTACTATCTGG + Intronic
941195212 2:162442367-162442389 AGGTGTTAATAAATGCTAAGAGG - Intronic
942709734 2:178819662-178819684 AGGTGCTAATGACATCTAGTGGG + Intronic
945578147 2:211558023-211558045 AAGTGCTAACAAGTGGTATTTGG - Intronic
945861021 2:215122522-215122544 AGGTGGTAATATGAGCAAGTTGG + Intronic
1170548675 20:17456686-17456708 AGTTGCTAATACGTGCTGCTGGG - Intronic
1172007188 20:31825566-31825588 AGGTACTGAGAAGTGCTAGGAGG + Intronic
1172108582 20:32531695-32531717 TGGGCCTAAAAAGTGCTAGTTGG + Intronic
1173059342 20:39646706-39646728 AAGTGCTGATAAGTGCTATAAGG - Intergenic
1176194158 20:63829629-63829651 AGGTGCCCAAAAGTGCCAGTTGG + Intronic
1177826608 21:26091342-26091364 AGGTGGTAATAAGTAGTACTTGG + Intronic
1181136005 22:20766790-20766812 AGGTGCTCATAAGTGTTTGGGGG - Intronic
1183016144 22:34989229-34989251 AGGTTATAAGAAGTTCTAGTAGG + Intergenic
1184047243 22:41979107-41979129 GGGTGCTCATATGTGCTTGTTGG + Intronic
949590550 3:5489984-5490006 AGGTGGTCATAAGGGCTAGGAGG - Intergenic
950179771 3:10903018-10903040 AGGTACTAATAAAAGTTAGTTGG + Intronic
950185367 3:10941903-10941925 AGGTGGTAATATCTGCTCGTAGG + Intergenic
951764896 3:26186731-26186753 TCTTGCTAATAAGTGCTAGGTGG - Intergenic
952330661 3:32361766-32361788 AGGAGCTCAGAGGTGCTAGTAGG - Intronic
959806156 3:110556446-110556468 AGGTAATAATAAATGCTGGTTGG - Intergenic
961835246 3:129652774-129652796 AGGGGCTAACAAGTCATAGTGGG - Intronic
965264630 3:166526004-166526026 AGATGCTAAAAAATGGTAGTTGG + Intergenic
966512896 3:180784030-180784052 AGTTGCTAATAATATCTAGTTGG + Intronic
967701140 3:192593400-192593422 AGGTGATAATAAGTGCTGTGGGG - Intronic
973606173 4:52589680-52589702 GGGTGCTGATGAGTGGTAGTTGG - Intergenic
981340182 4:143613049-143613071 AGTTGCTAAAAAATGATAGTGGG + Intronic
982833712 4:160095731-160095753 AAGTGCAAATAAATGTTAGTAGG + Intergenic
984921418 4:184767367-184767389 AAGTGCTAATACGTGCTACATGG + Intronic
987012070 5:13777098-13777120 TGGTGTGAATAAGTGCTATTGGG - Intronic
988945995 5:36200475-36200497 AAGTGCTAATAAGGGCGAGGGGG - Intronic
995978925 5:118078281-118078303 AGCTGTTAATAAGTGCTAAGAGG + Intergenic
1000801354 5:165730450-165730472 ATTTACTATTAAGTGCTAGTGGG - Intergenic
1004407027 6:15342461-15342483 AGGTGCTAATAAATTCTAGGAGG - Intronic
1005658662 6:27969979-27970001 AAGTGCTAATCAGAGCAAGTAGG + Intergenic
1007910188 6:45505683-45505705 GGGTGCTCAAAAATGCTAGTTGG - Intronic
1007914891 6:45552284-45552306 AGGTGCTACTAACTTTTAGTGGG - Intronic
1007922484 6:45623264-45623286 AGGTGGTACTAAGTGCTATGTGG + Intronic
1013480758 6:110550732-110550754 AGGTGCTAATGAGTCCCAGGAGG - Intergenic
1016118468 6:140317618-140317640 AGGTGCTAATAGGCCCTAATGGG - Intergenic
1017070828 6:150574340-150574362 AGGTGATTCTAAGTGCGAGTGGG + Intergenic
1024143824 7:46490585-46490607 AGGGCCAAATAAGTGCTTGTGGG - Intergenic
1027451614 7:78337924-78337946 AGGTGCTCATAAGTACTTCTTGG - Intronic
1028632269 7:92947850-92947872 AGGTGCTAATAAATACTCCTCGG - Intergenic
1031027273 7:116693795-116693817 AGATGCTTATAAGTGTTTGTTGG + Intronic
1031601599 7:123716817-123716839 AAGTGGTATTAAGTGCTATTTGG - Intronic
1033068553 7:138180191-138180213 AGGTCCTAATAAGTGACAGAAGG + Intergenic
1034082960 7:148297544-148297566 GGGTGCTAGAAAGTGCTATTCGG + Intronic
1034893149 7:154858140-154858162 AAGTGCTGATAAATGCTGGTTGG - Intronic
1036477175 8:9103915-9103937 AGGTGCTCACAATTGCTAGAAGG - Intronic
1038860260 8:31379955-31379977 AGGTGATAAGAAATGCTGGTGGG + Intergenic
1039340895 8:36648726-36648748 AGGTGCTGATAGGTGGGAGTGGG + Intergenic
1039625104 8:39041492-39041514 AGCTCCTAATAAGTGGTAATGGG + Intronic
1042777660 8:72451813-72451835 AGGTGCTTATCAGTGATAATTGG - Intergenic
1045378711 8:101601298-101601320 CTGTGATAATGAGTGCTAGTGGG + Intronic
1048236244 8:132693635-132693657 AGGTACTACTAAGTGCTATTGGG + Intronic
1052785265 9:32822464-32822486 AGGTGGAAATGAGTGCTTGTGGG + Intergenic
1054769509 9:69070412-69070434 AGGGGCTCAGAAGTGCTAGGGGG + Intronic
1061749645 9:132769049-132769071 AGGGGCAAGTAAGTGCTAGGAGG + Intronic
1186430049 X:9497591-9497613 AGGTGCTAATCACAGATAGTTGG + Intronic
1186551128 X:10506868-10506890 AGTTGCAAATGAGTGCTTGTAGG - Intronic
1189782884 X:44532971-44532993 AGATGCTAAGAATTGCTTGTAGG + Intronic
1190949644 X:55130659-55130681 AGGGGCAAATATGTGCCAGTTGG + Intronic
1195547576 X:106130028-106130050 AGGTGCAAAGAAGGGCTAGTTGG + Intergenic
1197353915 X:125411339-125411361 AGATGTTAATAATTGCTTGTAGG + Intergenic
1199567578 X:149231283-149231305 AGCTGGTAAAAAGTGCTACTGGG - Intergenic
1202095365 Y:21243882-21243904 AGGTGCAAACAAGCACTAGTAGG + Intergenic