ID: 1126484937

View in Genome Browser
Species Human (GRCh38)
Location 15:49169936-49169958
Sequence ATCAGAAACTAGGTGTATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126484933_1126484937 26 Left 1126484933 15:49169887-49169909 CCATAACTAAAAAACAAACAAAC 0: 1
1: 8
2: 181
3: 2312
4: 6625
Right 1126484937 15:49169936-49169958 ATCAGAAACTAGGTGTATGTAGG 0: 1
1: 0
2: 0
3: 8
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126484937 Original CRISPR ATCAGAAACTAGGTGTATGT AGG Intronic
902153526 1:14464209-14464231 ATCAGAAACTAGTAGTAGCTGGG + Intergenic
903487764 1:23703945-23703967 CTCAGAAACTTGGTTTTTGTAGG + Intergenic
905592781 1:39179174-39179196 ATCAGAAAATAAGTGTGTGGGGG - Intronic
907253452 1:53159575-53159597 ATCAGAAGCTGGGTGGATGCTGG + Intergenic
908634431 1:66146579-66146601 ATCAGAATCTATGTGAATGGTGG + Intronic
909701367 1:78527632-78527654 ATCAGGAACTAGATGAAAGTTGG + Intronic
910436314 1:87209481-87209503 ATCAGCAACTTGGTGTTTGATGG - Intergenic
912624419 1:111195706-111195728 AGCAGTAACTAGGTGCTTGTGGG + Intronic
913182320 1:116334117-116334139 AACAGAAGCAAGGTGTATGGAGG + Intergenic
913304814 1:117416996-117417018 ATCAGAAACTAGAAGTAAGCAGG + Intronic
914978750 1:152392975-152392997 ATAAGCACCTAGGTGGATGTGGG - Intergenic
915688045 1:157656096-157656118 AACAGAAACTAGGGACATGTGGG + Intergenic
918386164 1:184010329-184010351 ATCCTAAACTAGGTGCCTGTGGG - Intronic
918656757 1:187036404-187036426 AACAGAAACTAGTTGACTGTTGG - Intergenic
921725301 1:218516774-218516796 AACTGAAACTAGGGGTATTTAGG - Intergenic
922285125 1:224164183-224164205 ATCAGAAACCAGAGGGATGTAGG - Intergenic
1063838076 10:10039257-10039279 AACAAAATTTAGGTGTATGTAGG - Intergenic
1067292430 10:44953459-44953481 ATCAGAAAGCAGCTTTATGTTGG - Intergenic
1069290398 10:66772123-66772145 ATCAGAAAACAGGTTAATGTGGG + Intronic
1069978627 10:72236429-72236451 AACAGGAATTAGCTGTATGTTGG + Intergenic
1071046278 10:81382666-81382688 AACTGAAACTAGGTGAATTTGGG - Intergenic
1071596970 10:86935219-86935241 ATCAGAAACAAGGTTTTTTTTGG - Intergenic
1073756478 10:106586322-106586344 ATCAGAAACTTGGTGTCTAAAGG + Intronic
1073903599 10:108251035-108251057 ATCAGAAAATGGGAGAATGTGGG + Intergenic
1074262072 10:111864003-111864025 ATCAGAAACCAGGTATGTGTTGG - Intergenic
1078475417 11:11625020-11625042 ATCAGATAATAGGTGTAAGCAGG + Intergenic
1081135520 11:39435787-39435809 ATGAGAAACTAAGTGAGTGTGGG + Intergenic
1081532235 11:43969922-43969944 AGCAGGGACAAGGTGTATGTAGG - Intergenic
1085890214 11:80570478-80570500 AATAGAAACTTGGTGGATGTTGG - Intergenic
1087273159 11:96132944-96132966 ATCAGAAAGTAGCAGTATGTTGG - Intronic
1090562049 11:127942980-127943002 GTCTGAAACTAGGTGGAGGTTGG - Intergenic
1095794472 12:46202800-46202822 ATCAGAAACTTGCAGTATTTTGG - Intronic
1100225255 12:92549905-92549927 ATCAGAAACCAGGTGGAGGCTGG + Intergenic
1102270211 12:111527522-111527544 ATCCCAAACTAGGTGTGGGTAGG + Intronic
1107455553 13:40551226-40551248 ATCACCAACTGGGTGTATGAAGG - Intergenic
1108019502 13:46112442-46112464 AGGAGAAACTATGTGTGTGTTGG + Intergenic
1108120869 13:47184803-47184825 ATCAGAGACTAAGAGTTTGTGGG + Intergenic
1110343444 13:74418886-74418908 AGCAGAAACTAGATGTCTTTTGG - Intergenic
1110549579 13:76797470-76797492 AGCAGAAGCTAGCTCTATGTTGG - Intergenic
1114366357 14:22031197-22031219 ATCAGAAAGTGGTTGTCTGTAGG - Intergenic
1114794384 14:25696041-25696063 ACCTGAAAATAGGTGTAAGTGGG + Intergenic
1115963823 14:38864837-38864859 ATCAGAAACTGGGTGGGAGTGGG + Intergenic
1117738698 14:58793447-58793469 ATGAATAACTAGGTGTAAGTAGG + Intergenic
1117864164 14:60128118-60128140 TTCCGATACTAAGTGTATGTTGG - Intronic
1121984097 14:98483916-98483938 ATCAGAGACTAGGGAAATGTTGG + Intergenic
1122405783 14:101500112-101500134 CTCAGAATGTAGGTGTGTGTTGG + Intergenic
1125188543 15:36962323-36962345 ATCTGAAACAAGGTATCTGTGGG + Intronic
1125607698 15:40951083-40951105 ATTAGAAACAATATGTATGTTGG - Intergenic
1126484937 15:49169936-49169958 ATCAGAAACTAGGTGTATGTAGG + Intronic
1129524469 15:76205037-76205059 ATCTGAAACTGGGTGGATGGTGG - Intronic
1130589196 15:85201592-85201614 CTCAGAAACTAAGTGTCTGGAGG - Intergenic
1135395060 16:22125025-22125047 ATAAGGAATTAGGTGTATCTGGG - Intronic
1138221120 16:55251162-55251184 AGCAGGAACAAGGTGTTTGTAGG - Intergenic
1141290191 16:82711564-82711586 ATAAGAAGGTAGGTCTATGTTGG - Intronic
1141354239 16:83328771-83328793 ATCAGCTACTAGGTGAATGTTGG - Intronic
1143396484 17:6602822-6602844 ATCAAAAACTCAGAGTATGTGGG - Intronic
1146393914 17:32446657-32446679 AACAGAAACTTAGTGTATGTAGG + Intronic
1149262088 17:54891116-54891138 ATCAGAAATTAGGTGGCTGCAGG - Intergenic
1149330516 17:55576555-55576577 GAGAGAAACTAGGTGTAGGTTGG - Intergenic
1150947516 17:69764515-69764537 ATCTGAAACAAAGTGTGTGTTGG + Intergenic
1159831365 18:73281909-73281931 TTCAGGAACAAGGTTTATGTAGG + Intergenic
1165824951 19:38700438-38700460 ATCAGAAACAATGTGTGTATCGG + Intronic
1165870764 19:38971338-38971360 ATCAGAGACTAGAAGAATGTGGG + Intronic
1167967841 19:53162260-53162282 TTCAGAAACTAAGTGTATTTTGG - Intronic
925541515 2:4972674-4972696 ATCAAAAACTAGGAGAATCTGGG - Intergenic
928411007 2:31053721-31053743 ATCAGAAGCTAAGTATTTGTGGG - Intronic
928736161 2:34291908-34291930 ATCAGTAACTAGGTTTCGGTGGG + Intergenic
934050821 2:88209260-88209282 ATTAAAAACAAGCTGTATGTAGG - Intergenic
936395769 2:112127750-112127772 ATCAGAATCTAGGTCAATTTGGG - Intergenic
937470361 2:122169077-122169099 ATCAGAACCTAGAAGTATGCTGG - Intergenic
937585228 2:123539185-123539207 TTCAGTAACTAAGTTTATGTGGG + Intergenic
939654567 2:144807815-144807837 TTAAAAAATTAGGTGTATGTGGG - Intergenic
940498710 2:154466958-154466980 TTCAGTGACTAGGTGGATGTTGG + Intergenic
943296666 2:186148828-186148850 ATCAGAAAGTAGTTGGATGTAGG + Intergenic
943446208 2:187991179-187991201 ATCATACACTATGTCTATGTAGG + Intergenic
945009921 2:205449911-205449933 ATTAGAATAGAGGTGTATGTGGG + Intronic
947441827 2:230129647-230129669 ATCAGAGACTTGGTGCGTGTTGG + Intergenic
1169371827 20:5033900-5033922 ATCAGAAAGTGGGTGGATCTGGG - Intergenic
1173885577 20:46455479-46455501 AACATAAATTATGTGTATGTTGG - Intergenic
1173990516 20:47299223-47299245 ATCTGAACCTAGGTAGATGTGGG - Intronic
1175052457 20:56167899-56167921 ATCAGAAACATGATATATGTAGG + Intergenic
1177330266 21:19650275-19650297 ATCAGTAACTAGTATTATGTTGG - Intergenic
1181940802 22:26475034-26475056 GTCATAGAGTAGGTGTATGTTGG - Intronic
951284773 3:20796334-20796356 CTCAGGATCTAGGTGAATGTTGG - Intergenic
951917251 3:27815119-27815141 ATCAAAAACTAGGTGAATACAGG - Intergenic
952587822 3:34913533-34913555 TGCAGAAACTAGATGTATGTTGG - Intergenic
953151275 3:40327434-40327456 ATTAGAAAATGGTTGTATGTAGG - Intergenic
953165287 3:40459553-40459575 GTCAAAAACTTGCTGTATGTTGG + Intronic
956301219 3:67774851-67774873 AGCAGAAACAAGTTCTATGTGGG + Intergenic
957118395 3:76057178-76057200 ATCTGATACTAGGCGTATGCGGG + Intronic
958869512 3:99540955-99540977 ATCAGAAACAAAGTTTGTGTTGG - Intergenic
959372365 3:105543624-105543646 ATCAGCAACTAGGAATTTGTAGG - Intronic
959580270 3:107976288-107976310 ATAAGCAACTATGTATATGTGGG - Intergenic
961406083 3:126680406-126680428 ATCAGAAACTAGGAGTCACTGGG + Intergenic
963136690 3:141912145-141912167 ACCAGAAACTAGGTTACTGTGGG - Intronic
964848129 3:161065889-161065911 ATCAGAAACAAGGTCTTTTTAGG - Intronic
965350722 3:167608545-167608567 ATCAGAAACAAGTTATATCTTGG - Intronic
967870781 3:194227213-194227235 CTGAGTAACTAGGTGGATGTTGG - Intergenic
968150201 3:196331968-196331990 ATCAGAAAATATGTGTATAGAGG + Intronic
970122270 4:12769375-12769397 ATCAGAACCTATATGTATGGTGG + Intergenic
971582544 4:28361175-28361197 ATCAGAAACTTGATGTTTGCGGG - Intergenic
976689061 4:87848910-87848932 AACAGAAACTAGAAGTGTGTTGG + Intergenic
979460767 4:120980158-120980180 TTCAGAAAATATGTGTAAGTTGG + Intergenic
980689629 4:136278723-136278745 ATCAGAAACTAGAGGACTGTGGG + Intergenic
981884250 4:149653835-149653857 ATCAGAAAGTAGGAGTTTCTTGG - Intergenic
987148272 5:15013546-15013568 ATCAGAAACTTGATGACTGTTGG + Intergenic
987995555 5:25273137-25273159 TTCAAGAACTAGGTGTTTGTAGG - Intergenic
994195766 5:96921233-96921255 ATCAGAAACTAAGTGAAGGCAGG - Intronic
994261709 5:97666998-97667020 AACAGAAAGTATGTGTATGCAGG + Intergenic
994774441 5:104025565-104025587 AGCAGAAACTTGGTGTGTGAAGG - Intergenic
995231598 5:109771158-109771180 ATTAGAAACTACATGTAAGTTGG - Intronic
996841443 5:127851321-127851343 ACCAAAAGCTAGGTGAATGTTGG - Intergenic
999730130 5:154470860-154470882 ATAAAAAACTAGGTTTATATGGG - Intergenic
1000204448 5:159045373-159045395 GTCAGAAAGTGGGTGTACGTAGG - Intronic
1005238935 6:23800686-23800708 ATCAGACACTGGGTTTGTGTTGG + Intergenic
1010601689 6:77835604-77835626 ATCAGATACTATGATTATGTGGG + Intronic
1017269611 6:152491145-152491167 ATCAGACACTAGTGGAATGTGGG - Intronic
1017269619 6:152491197-152491219 ATCAGACACTAGTGGAATGTGGG - Intronic
1017269627 6:152491249-152491271 ATCAGACACTAGTGGAATGTGGG - Intronic
1018178434 6:161199400-161199422 ATCAAATACTAGGTGTGTCTGGG + Intronic
1018285379 6:162232136-162232158 ATGCGAAACGAGGGGTATGTAGG + Intronic
1019848985 7:3535643-3535665 ATGAGAAACTATGTCTATATTGG + Intronic
1020976066 7:15008131-15008153 ATATTAAACTAGGTTTATGTGGG + Intergenic
1025008261 7:55372608-55372630 ATCAGTAACTATGTGTACCTAGG - Intronic
1026818180 7:73528676-73528698 ATCAAAACCTAGGTTTATCTAGG + Intergenic
1030195432 7:106848547-106848569 ATCAGACACTAGGTTTATCCTGG + Intergenic
1031508858 7:122623657-122623679 ATGAGAAACTAGGTGTTTGGGGG - Intronic
1032246128 7:130214652-130214674 AGCAGAAGATAGATGTATGTTGG + Intronic
1034596756 7:152203144-152203166 ATATGAAACTGTGTGTATGTTGG - Intronic
1036961613 8:13250243-13250265 ATCAGAAAGCAGCAGTATGTTGG - Intronic
1037220460 8:16513054-16513076 TTCAGAAACTAAGCTTATGTCGG - Intronic
1039510895 8:38091136-38091158 AGCAGAAACTGGGAGTGTGTGGG - Intergenic
1041132367 8:54714750-54714772 TTCATAAACTAGCTGTATCTGGG + Intergenic
1041501959 8:58548744-58548766 ATGAGGAACTATGTGGATGTTGG - Intergenic
1046499304 8:115055062-115055084 ATCAGAAACTTCATTTATGTAGG - Intergenic
1049964175 9:763488-763510 TTCAAAAACTAGGTGGAGGTCGG + Intergenic
1053395620 9:37771406-37771428 ATCACAAAGTATGTGTTTGTGGG + Intronic
1055101523 9:72470597-72470619 ATAAGAAACTAGGGGAATGCCGG + Intergenic
1056141126 9:83680905-83680927 ATCAGACACTAACTGTAGGTAGG + Intronic
1057343647 9:94227259-94227281 ATAAAAAAATAGGTGTGTGTGGG - Intergenic
1186341689 X:8652264-8652286 ATCAGAAACTAAATGTACATGGG - Intronic
1191727028 X:64292399-64292421 ACCATAAAGTAGGTGCATGTTGG + Intronic
1193222709 X:78945561-78945583 ATCAGAACAGAGGTGGATGTGGG + Intronic
1193247666 X:79248827-79248849 GTCAAAAACTAGGTGCCTGTGGG + Intergenic
1193954265 X:87839387-87839409 ATCAGAGACCATGTGTGTGTGGG + Intergenic
1199508216 X:148590384-148590406 ATCAGAAGCAAGGTCTAGGTAGG - Intronic
1201514608 Y:14805543-14805565 ATCAGATACTAAGTATGTGTTGG + Intronic