ID: 1126487930

View in Genome Browser
Species Human (GRCh38)
Location 15:49203336-49203358
Sequence GGCAAATGGTCTCGGTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 233}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126487930_1126487934 -9 Left 1126487930 15:49203336-49203358 CCACCACACCGAGACCATTTGCC 0: 1
1: 0
2: 1
3: 24
4: 233
Right 1126487934 15:49203350-49203372 CCATTTGCCAATTTTTTAATTGG 0: 1
1: 5
2: 129
3: 1183
4: 5637

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126487930 Original CRISPR GGCAAATGGTCTCGGTGTGG TGG (reversed) Intronic
900274880 1:1818573-1818595 GGAAAATAGGCTGGGTGTGGTGG + Intronic
903877405 1:26484818-26484840 GGTTAATGGGCTGGGTGTGGTGG - Intergenic
905816865 1:40957987-40958009 AAAAAATGGTCTGGGTGTGGGGG + Intergenic
906633559 1:47392385-47392407 GTTAAATGGGCTGGGTGTGGTGG + Intergenic
908383502 1:63618730-63618752 GGCCAAGGGTCTGGATGTGGAGG + Intronic
909873498 1:80775360-80775382 TGTAAATGGTCTCACTGTGGCGG - Intergenic
910338446 1:86158261-86158283 GACAATTGGGCTGGGTGTGGTGG + Intergenic
910921824 1:92356720-92356742 GGAAAATGGGCCAGGTGTGGTGG - Intronic
911173370 1:94794310-94794332 AGAAAATGGGCTGGGTGTGGTGG - Intergenic
911180607 1:94857016-94857038 GGCAAGTAGGCTGGGTGTGGTGG - Intronic
913203500 1:116515311-116515333 GGGAAATGGACTCGGTTTGAGGG - Intronic
913677045 1:121150680-121150702 GGCACATGGACTTGGGGTGGGGG - Intergenic
916318145 1:163473207-163473229 GGAAAATGGTCTCTGTGTGCTGG - Intergenic
917349806 1:174065063-174065085 TACAAATGGGCTGGGTGTGGTGG + Intergenic
918053361 1:180995113-180995135 GGAAAATGAGCTGGGTGTGGTGG - Intronic
918952667 1:191160143-191160165 GGCAAATGGGCTTGGTGCGGTGG + Intergenic
919794673 1:201314163-201314185 GGGACATGGCCTGGGTGTGGTGG + Intronic
920464344 1:206169197-206169219 GGCACATGGACTTGGGGTGGGGG - Intergenic
920725066 1:208427301-208427323 GGGAAATTGGCTGGGTGTGGTGG + Intergenic
923432190 1:233933575-233933597 GGGAACTGGGCTGGGTGTGGTGG + Intronic
924231011 1:241961695-241961717 GGAAAATGGGCTGGGCGTGGTGG + Intergenic
1064279135 10:13935149-13935171 AACAAATGGGCTGGGTGTGGTGG + Intronic
1064365581 10:14704734-14704756 GGCAAAAGGGCCAGGTGTGGTGG + Intronic
1069202305 10:65635418-65635440 AGCATATGGTGTGGGTGTGGGGG - Intergenic
1069804161 10:71107419-71107441 GGCAAAAGTTCACGGTGGGGTGG + Intergenic
1072044059 10:91637252-91637274 AGACAATGGTCTAGGTGTGGTGG + Intergenic
1072214422 10:93276223-93276245 AGAAAATGGGCTGGGTGTGGTGG - Intergenic
1072453029 10:95554339-95554361 GACAAATAGGCTGGGTGTGGTGG - Intronic
1074749322 10:116568655-116568677 GGCAAAATGTCTGGGTGTGGTGG - Intergenic
1080357634 11:31470125-31470147 GGCAAATGGGCTGGGTGCAGTGG + Intronic
1081055029 11:38399183-38399205 GGCACTTGATCTCGGTGGGGGGG + Intergenic
1083174303 11:60939585-60939607 GGGACACGGTCTCGTTGTGGTGG + Exonic
1083866964 11:65460503-65460525 CAGAAATGGTCTGGGTGTGGTGG - Intergenic
1088263966 11:107972221-107972243 GGAAAATTATCTGGGTGTGGTGG - Intergenic
1088363677 11:109017206-109017228 GGCAAATGGTCCCTGAGAGGGGG + Intergenic
1089600296 11:119610238-119610260 AGCAATTGGGCTGGGTGTGGTGG - Intergenic
1092916323 12:13192728-13192750 AGAAAATGGGCTGGGTGTGGTGG + Intergenic
1095246539 12:39929841-39929863 GGCACTTGGGCTGGGTGTGGTGG + Intronic
1096068536 12:48760463-48760485 GGTAAATGGGCTGGGTGTGGTGG - Intergenic
1099909213 12:88809259-88809281 CAAAAATTGTCTCGGTGTGGTGG - Intergenic
1100604851 12:96143228-96143250 GGAAATTGGGCTGGGTGTGGTGG + Intergenic
1100736984 12:97546292-97546314 AGGAAATGGGCTGGGTGTGGTGG + Intergenic
1102327615 12:112001462-112001484 GCCAAATGGTCCAGGTGTAGTGG - Intronic
1102959325 12:117081934-117081956 GGGAAATGGGCCAGGTGTGGTGG + Intronic
1103891814 12:124244888-124244910 GGCAAAAGGGCTGGGTGTGGCGG - Intronic
1104252160 12:127105347-127105369 GTGAAATGGGCTAGGTGTGGTGG - Intergenic
1104569582 12:129913093-129913115 GGGAAATTATCTGGGTGTGGTGG + Intergenic
1106456357 13:29930694-29930716 GCCAAAGGGGCTGGGTGTGGTGG - Intergenic
1106461566 13:29974761-29974783 GTCAAATGGGTTGGGTGTGGTGG + Intergenic
1108070486 13:46624034-46624056 GAAAAATTGTCTGGGTGTGGTGG - Intronic
1109810334 13:67505123-67505145 GAGAAATGTTATCGGTGTGGTGG - Intergenic
1109951587 13:69507530-69507552 TGAAAATAGTCTGGGTGTGGTGG + Intergenic
1110200246 13:72841481-72841503 GGCTAATAGGCTAGGTGTGGTGG + Intronic
1113443776 13:110350048-110350070 GGAAATTGGGCTGGGTGTGGTGG - Intronic
1114275807 14:21143002-21143024 GGCAAGAGGGCTGGGTGTGGTGG - Intergenic
1114455590 14:22851310-22851332 GGCAAATGGCCTCAGCATGGAGG - Intergenic
1118211013 14:63765642-63765664 GACATATGGGCTGGGTGTGGTGG - Intergenic
1119406512 14:74402669-74402691 GCCAAATGGGCCCTGTGTGGGGG - Intergenic
1119447677 14:74679887-74679909 GGCAAAAGGGCCAGGTGTGGTGG + Intronic
1121149376 14:91617030-91617052 GGAATATGGGCTGGGTGTGGTGG - Intronic
1121432930 14:93900186-93900208 GGCATATGGGCTGGGAGTGGGGG + Intergenic
1124937752 15:34188266-34188288 CGCAAATGAGCTGGGTGTGGTGG + Intronic
1125366926 15:38927290-38927312 GGCAAAGGGGCTGGGTGTGGTGG - Intergenic
1125829386 15:42703080-42703102 AGCAAATAGGCTAGGTGTGGTGG - Intronic
1126487930 15:49203336-49203358 GGCAAATGGTCTCGGTGTGGTGG - Intronic
1126816182 15:52457152-52457174 GGCAAAGGGGCTTGGTGTGGTGG + Intronic
1127902323 15:63350016-63350038 TGCAAATGGTTTCTGTTTGGGGG + Intronic
1128033751 15:64504766-64504788 AGCAAATAGGCTGGGTGTGGTGG - Intronic
1128263630 15:66250618-66250640 GGCAAAAGGGCTGGGTGCGGTGG + Intronic
1128884265 15:71272113-71272135 GGCAAAGGGGCTGGGTGTGGTGG + Intronic
1129702250 15:77774636-77774658 GGCTGATGGGCTCTGTGTGGTGG - Intronic
1130738679 15:86575209-86575231 TGCACATGGGCTGGGTGTGGTGG + Intronic
1131704533 15:94978787-94978809 GGCAAATGGGCTGGGCCTGGTGG + Intergenic
1133328259 16:4955648-4955670 GGCAACTGGGCCAGGTGTGGTGG + Intronic
1137243701 16:46684011-46684033 GGTAAATGGGCTGGGTGCGGTGG - Intronic
1139229689 16:65271919-65271941 GGCAAAGCATCTTGGTGTGGTGG - Intergenic
1139235704 16:65336287-65336309 GACTAATGGTCTCCCTGTGGGGG + Intergenic
1139693637 16:68657224-68657246 GCCAAACGGGCTCGGTGTGATGG + Intronic
1139773529 16:69298230-69298252 GGCAAATGCCCCAGGTGTGGTGG - Intronic
1140245238 16:73242353-73242375 GGCTAATGGGGTGGGTGTGGGGG - Intergenic
1141957660 16:87383423-87383445 TCCAGATGGTGTCGGTGTGGAGG + Exonic
1144179512 17:12738824-12738846 GACATCTGGTCTCGGTGTGTGGG - Intronic
1144381674 17:14705114-14705136 GGCCAGTGGTCTTGGTGTGCTGG + Intergenic
1147565877 17:41536220-41536242 GGCAGATGGTGTGGGTGGGGAGG + Intergenic
1148600072 17:48887578-48887600 GTCAAATGGGCTGGGCGTGGTGG - Intergenic
1148713416 17:49698408-49698430 GGCAAAGGGTCTCCCAGTGGGGG + Intergenic
1148732367 17:49845215-49845237 GGCATGTGGTCTGGGGGTGGAGG + Intronic
1150165672 17:62940255-62940277 GCCAGATGGGCTGGGTGTGGTGG + Intergenic
1150385660 17:64757639-64757661 ACCAAATGGGCTGGGTGTGGTGG + Intergenic
1150489722 17:65565913-65565935 GACAAATTGGCTGGGTGTGGTGG + Intronic
1151766168 17:76134480-76134502 GGTAAATGGGCTGGGTGAGGTGG + Intergenic
1152223013 17:79079567-79079589 GGGGAATGGTGACGGTGTGGTGG - Exonic
1152365036 17:79850653-79850675 GGAAAAGGGGCTGGGTGTGGTGG - Intergenic
1152547827 17:81011378-81011400 GGAAAATTGGCTGGGTGTGGTGG + Intergenic
1153824693 18:8864746-8864768 GCAAAATGGGCTGGGTGTGGTGG - Intergenic
1153849351 18:9078641-9078663 GGAAAATAGGCTGGGTGTGGTGG - Intergenic
1155564527 18:27119186-27119208 GGCAAATGTACTTGGTTTGGTGG - Intronic
1156029080 18:32691389-32691411 GCCAAAGAGTCTGGGTGTGGTGG + Intronic
1156469363 18:37367925-37367947 GGAAGATGGGCTGGGTGTGGGGG - Intronic
1157337041 18:46748257-46748279 GGCAAAGGGGCTGGGCGTGGTGG + Intronic
1158970596 18:62662805-62662827 GGCAAATGTGCTGGGAGTGGTGG - Intergenic
1160575183 18:79849108-79849130 GGCAGAGGGGCTCGATGTGGAGG - Intergenic
1161600047 19:5176415-5176437 GGCAATTGGGCCGGGTGTGGTGG + Intronic
1161748879 19:6079598-6079620 TGCAAGTGGGCTGGGTGTGGTGG + Intronic
1161884122 19:6980382-6980404 TACAAATGGGCTGGGTGTGGTGG - Intergenic
1162357820 19:10197343-10197365 AGCAAATGGGCTGGGTGCGGTGG + Intronic
1162821054 19:13223876-13223898 GCCAAATGGGCCGGGTGTGGTGG + Intronic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
1163693650 19:18751234-18751256 GGGAAATGGGCTGGGTGTGGTGG + Intronic
1165322111 19:35092163-35092185 TACAAATGGTTTGGGTGTGGTGG - Intergenic
1165828669 19:38719819-38719841 GGCCAAGGGGCTGGGTGTGGTGG + Intronic
1167042512 19:47030925-47030947 GGCAAAGGGGCCCAGTGTGGTGG - Intronic
926715590 2:15921423-15921445 GGCCAATGGTGTGGGTGGGGTGG + Intergenic
927899577 2:26809554-26809576 AGCAAATGGGCCGGGTGTGGTGG + Intergenic
929595525 2:43173302-43173324 GACAAATGGGCTGGGCGTGGTGG - Intergenic
929685850 2:44033538-44033560 GGAGAATGGTCACGGTGTGAGGG - Intergenic
931316664 2:61139460-61139482 GGCAAAAGGGCTAGCTGTGGTGG - Intergenic
931780804 2:65578021-65578043 GTTAAATGGGCTAGGTGTGGTGG + Intergenic
935973903 2:108558494-108558516 CACAAATCGTCCCGGTGTGGTGG - Intronic
936634783 2:114243606-114243628 GGGAAATGGGCTGGGTGTGGTGG + Intergenic
939326267 2:140693468-140693490 GCCAAAATGTCTCAGTGTGGTGG - Intronic
941397340 2:164990171-164990193 GACAACTGGGCTGGGTGTGGTGG + Intergenic
941837500 2:170041053-170041075 GACAAATAGGCTGGGTGTGGTGG + Intronic
941871645 2:170391865-170391887 AGGAAATGGGCTGGGTGTGGCGG + Intronic
942583698 2:177450122-177450144 GGCAAATAGGCTGGGCGTGGTGG - Intronic
942711951 2:178846773-178846795 GGCAAATGTTTTCTGTGTAGAGG - Intronic
944954352 2:204790815-204790837 AGAAAATGGGCTGGGTGTGGTGG + Intronic
947545618 2:231008343-231008365 GGCATATGGTGTAGGGGTGGAGG + Intronic
1169049490 20:2564013-2564035 GACAAATGGGCCAGGTGTGGTGG - Intronic
1169101600 20:2954508-2954530 GGCAAAGGGGCCAGGTGTGGTGG - Intronic
1170440164 20:16371297-16371319 GACAAATGGGCTGAGTGTGGTGG + Intronic
1172384587 20:34525010-34525032 GGCAAATGGGGCCGGTGCGGCGG - Intronic
1173802492 20:45903167-45903189 GGCAAGGGGTTTGGGTGTGGTGG - Intronic
1174345900 20:49929664-49929686 GGAAAATGGCCCGGGTGTGGTGG - Intergenic
1174375673 20:50124996-50125018 GGCAGATGGCTTCGGTTTGGGGG + Exonic
1174746512 20:53068517-53068539 AGCAACTAGACTCGGTGTGGGGG - Intronic
1177155031 21:17492901-17492923 TGCAGATGTTCTCTGTGTGGTGG - Intergenic
1177275751 21:18910943-18910965 GGCAAATTAGCTGGGTGTGGTGG + Intergenic
1177653283 21:23985040-23985062 AGCAAATTGGCTCAGTGTGGTGG + Intergenic
1177972825 21:27811289-27811311 GGCAAATGTTCTTGGTATGTGGG + Intergenic
1178564075 21:33667113-33667135 AGCAAATAGGCTGGGTGTGGTGG - Intronic
1178897254 21:36569123-36569145 AGTAAATAGTCTCGGGGTGGGGG + Intronic
1179177025 21:39015602-39015624 AGCAAATAGGCTGGGTGTGGTGG + Intergenic
1179413277 21:41178445-41178467 GGCACATTGGCTGGGTGTGGCGG + Intronic
1180753410 22:18142230-18142252 GGCAAATGGGCCGGGTGTGGTGG + Intronic
1181670635 22:24424121-24424143 GGGAACTGGTCTCGGGGCGGCGG - Intronic
1182207936 22:28647550-28647572 GGCAAATGGGCCAGGCGTGGTGG + Intronic
1182612408 22:31559879-31559901 GGCCAGTGGTCTTGGTGTGCTGG - Intronic
1183103176 22:35596463-35596485 TGCAAAGGGGCTGGGTGTGGTGG + Intergenic
1183164699 22:36139038-36139060 GGCAAATTGGCCCAGTGTGGAGG + Intergenic
1184049106 22:41991172-41991194 GGCAAACAGTCTCGGAGTAGGGG + Intronic
949143812 3:670318-670340 GACAAATGGGCTGGGCGTGGTGG - Intergenic
950137661 3:10593071-10593093 AGCAAATGGGCTGGGCGTGGTGG - Intronic
950209031 3:11104199-11104221 GGCAAAAGGGCTGGGTGTGGTGG - Intergenic
952944297 3:38467158-38467180 GACAAATGGGCTGGGTGCGGTGG + Intronic
954038682 3:47867958-47867980 GACAAATGGGCTAAGTGTGGAGG - Intronic
959056951 3:101576527-101576549 GGCCAGTGGTCTTGGTGTGCTGG + Intronic
959262559 3:104100276-104100298 GGCAAAGGGGCTGGGCGTGGTGG - Intergenic
961150419 3:124632903-124632925 GGCAAATGGTTTCTGTCTGCTGG - Intronic
961678559 3:128583519-128583541 GGTAAAGGGTCTCGGATTGGGGG - Intergenic
964714874 3:159711555-159711577 GACAAATGGTCTCCATTTGGGGG + Intronic
972601197 4:40574560-40574582 TGGAAATGGGCTGGGTGTGGTGG + Intronic
972918759 4:43911127-43911149 GGCCAGTGATCTAGGTGTGGGGG - Intergenic
973733174 4:53843302-53843324 GGCAAATGGGCTGGGTGCAGTGG + Intronic
973778170 4:54262760-54262782 GGAAAATCCTCTAGGTGTGGAGG + Intronic
975207263 4:71659516-71659538 AACAAATGGGCTAGGTGTGGTGG - Intergenic
977580417 4:98718559-98718581 GGGAAAGGGTCTGGGTGCGGTGG - Intergenic
980873175 4:138633277-138633299 GAGAAATGGTCTCCATGTGGAGG - Intergenic
982090628 4:151877085-151877107 AGCAAATGGGCTGGGCGTGGTGG + Intergenic
983025059 4:162726204-162726226 AGCAAATGGGCTGGGCGTGGTGG - Intergenic
984386422 4:179065538-179065560 GGCAAATGGTAGCAGTGTGCAGG + Intergenic
985107246 4:186511202-186511224 GGAAGAGGGTCTCTGTGTGGGGG - Intronic
985107256 4:186511254-186511276 GGAAGAGGGTCTCTGTGTGGGGG - Intronic
986155492 5:5170663-5170685 GGCAAAAGAGCTGGGTGTGGTGG - Intronic
987098432 5:14570709-14570731 TGAAAATGGGCTGGGTGTGGTGG + Intergenic
988428781 5:31094422-31094444 GGAAAATGGGCCTGGTGTGGTGG + Intergenic
992282915 5:75200583-75200605 AGTAAATGGGCTGGGTGTGGTGG - Intronic
993378148 5:87174438-87174460 TGCAAATGGGCCAGGTGTGGTGG + Intergenic
994109953 5:95990889-95990911 CTAAAATGGGCTCGGTGTGGTGG - Intergenic
994660419 5:102647398-102647420 GGCAAAAGGGCTGGGTGTGGTGG + Intergenic
998947011 5:147350653-147350675 GGCAAATAGGCTGGGCGTGGTGG - Intronic
999020347 5:148158702-148158724 GCCAAAGGGGCTGGGTGTGGTGG - Intergenic
999988043 5:157023327-157023349 GGCAAAAGGGCCGGGTGTGGTGG + Intergenic
1001000063 5:167997024-167997046 TTCAAATGGGCTGGGTGTGGTGG - Intronic
1003670383 6:8151862-8151884 GAAAAATGGTCTGGGCGTGGTGG - Intergenic
1004647740 6:17579325-17579347 GAAAAATGGGCTGGGTGTGGTGG - Intergenic
1005657346 6:27954369-27954391 GAAAAATTGTCTGGGTGTGGTGG - Intergenic
1006313276 6:33276406-33276428 GGCCAGTGGTCTTGGTGTGCTGG - Exonic
1008380026 6:50830990-50831012 GGCAAGTGGTCTAGGTTTGGGGG + Intronic
1008607891 6:53158249-53158271 GGCAAATAGGCCAGGTGTGGTGG + Intergenic
1013076748 6:106778668-106778690 AGAAAATGGGCTGGGTGTGGTGG - Intergenic
1014341554 6:120214044-120214066 GGCAAATGTTTTTGGTGTGCTGG - Intergenic
1015735935 6:136400127-136400149 GGAAAATAGGCTGGGTGTGGTGG + Intronic
1017249512 6:152263927-152263949 CGAAAATGGGCTGGGTGTGGTGG + Intronic
1017483442 6:154880778-154880800 ATCAAATGGGCTGGGTGTGGTGG - Intronic
1017696085 6:157017836-157017858 GGAAACTGGGCTGGGTGTGGTGG + Intronic
1018550293 6:164989901-164989923 TGAAAATGGGCTGGGTGTGGTGG - Intergenic
1020182487 7:5933303-5933325 GTCAAATTGGCTGGGTGTGGTGG - Intronic
1020300425 7:6791454-6791476 GTCAAATTGGCTGGGTGTGGTGG + Intronic
1022290134 7:28993792-28993814 GACAATTGGGCTGGGTGTGGTGG + Intergenic
1022589679 7:31649797-31649819 GGCAAATGGACTGGGCTTGGAGG + Intronic
1023025991 7:36049891-36049913 TGCAGGTGGTCTCTGTGTGGTGG + Intergenic
1023389008 7:39689278-39689300 GGCATGTGGGCTGGGTGTGGTGG - Intronic
1026729828 7:72901788-72901810 GGTATATGGACTGGGTGTGGTGG - Intronic
1027035414 7:74921772-74921794 GACAAATGGGCTGGGTGTGGTGG - Intergenic
1027164170 7:75822992-75823014 GGAAAGTGAACTCGGTGTGGTGG - Intronic
1027188581 7:75985530-75985552 GGGCAAGGGCCTCGGTGTGGCGG + Intronic
1028996404 7:97105142-97105164 GTCAAATGGGCTGGGCGTGGTGG + Intergenic
1029394641 7:100299369-100299391 GACAAATGGGCTGGGTGTGGTGG + Intergenic
1030211981 7:107005879-107005901 AGCAAATGGGCTGGGTGCGGTGG - Intergenic
1030362285 7:108607662-108607684 GGCAAATGGACTGGGGGCGGTGG - Intergenic
1030926207 7:115458279-115458301 GGCAGATGCTCTCTGTTTGGGGG + Intergenic
1031356279 7:120791039-120791061 GGCAAACTGGCTGGGTGTGGGGG + Intronic
1032394901 7:131582158-131582180 GACAAATGGGCTGGGTGGGGTGG + Intergenic
1032652807 7:133896948-133896970 GGCAACTGGGCCGGGTGTGGTGG - Intronic
1032949257 7:136888539-136888561 GGCAAAAGGTCTCTGTGGTGGGG + Intronic
1033658289 7:143387663-143387685 GGGACAGGGTCTCTGTGTGGGGG + Intronic
1035024062 7:155815117-155815139 GCCAAATGGTCTGGGGGGGGGGG - Intergenic
1035496073 7:159327450-159327472 AGTAAATGGGCTCGGTGTGGTGG + Intergenic
1035844513 8:2848417-2848439 GATAAATGGGCTGGGTGTGGTGG - Intergenic
1036155668 8:6339805-6339827 GGCAATTGGGCCAGGTGTGGTGG + Intergenic
1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG + Intronic
1041539706 8:58969697-58969719 GGAGAATGATCTCGGTGTAGAGG - Intronic
1041594654 8:59633903-59633925 GGTAAATGTTCTGGGGGTGGGGG + Intergenic
1042111324 8:65384147-65384169 GTCAAATGGTCTCTGTTTGCAGG + Intergenic
1042123525 8:65513464-65513486 TGCAAATGGTATGGATGTGGAGG + Intergenic
1042356576 8:67835018-67835040 GGCACACGGTCTCTGTGTGCAGG - Intergenic
1042461004 8:69068456-69068478 GGTAATTGGTTTCGGTGTGCTGG - Intergenic
1043845517 8:85158769-85158791 ATCAACTGGTCTGGGTGTGGTGG + Intergenic
1047071977 8:121355292-121355314 GGCAAAGGGTATAGGTGTTGAGG - Intergenic
1049628415 8:143637081-143637103 GCCAAATGGCCTGGGTGGGGCGG + Intronic
1049797851 8:144504722-144504744 GGCACATGGGCTGGGGGTGGGGG - Intronic
1052714067 9:32093597-32093619 GGCAAATGGATTTGGAGTGGGGG - Intergenic
1053612603 9:39730031-39730053 AGCAAATGGGCTGGGTGTGGTGG - Intergenic
1053870642 9:42487989-42488011 AGCAAATGGGCTGGGTGTGGGGG - Intergenic
1054085650 9:60741127-60741149 AGCAAATGGGCTGGGTGTGGTGG + Intergenic
1054240912 9:62612362-62612384 AGCAAATGGGCTGGGTGTGGTGG + Intergenic
1054555044 9:66646886-66646908 AGCAAATGGGCTGGGTGTGGTGG + Intergenic
1057452950 9:95182016-95182038 GGAACATGGTCTGGGTGTGGAGG + Intronic
1058896291 9:109403550-109403572 GGGAGATGGGCTGGGTGTGGTGG + Intronic
1059729839 9:117045845-117045867 GGCAAATGGTGTTGTGGTGGGGG + Intronic
1061901564 9:133675054-133675076 GGCAAAGGGGCCGGGTGTGGTGG + Intronic
1187311313 X:18146138-18146160 GGAAAAGGGACACGGTGTGGTGG - Intergenic
1187346502 X:18470047-18470069 AGTAAATGGGCTGGGTGTGGTGG + Intronic
1188207443 X:27378125-27378147 TGCAAATTGGCTGGGTGTGGTGG + Intergenic
1189132212 X:38511564-38511586 GGAAAATGGGCTGGGTTTGGTGG - Intronic
1189398614 X:40645555-40645577 GGAAGATGGTGTAGGTGTGGTGG + Intronic
1190139288 X:47828213-47828235 TGAAACTGGTCTGGGTGTGGTGG + Intergenic
1192426363 X:71080438-71080460 GATAAATGGGCTGGGTGTGGTGG + Intergenic
1192618730 X:72655118-72655140 TGCATATGGCCTGGGTGTGGTGG + Intronic
1192942741 X:75930175-75930197 GACAACTGGGCTGGGTGTGGTGG - Intergenic
1193109295 X:77711545-77711567 GTCAACTGGGCTGGGTGTGGTGG + Intronic
1199603598 X:149558860-149558882 GCCAATAGGTCTCAGTGTGGAGG - Intergenic
1199646789 X:149920614-149920636 GCCAATAGGTCTCAGTGTGGAGG + Intergenic
1200117870 X:153777069-153777091 GGCAGAAGATCTCGGTGGGGTGG - Intronic
1200708037 Y:6459374-6459396 GGATCATGGTCTCGTTGTGGAGG - Intergenic
1200929168 Y:8681611-8681633 GGCTTGTGGTCTCGTTGTGGGGG - Intergenic
1201026075 Y:9705334-9705356 GGATCATGGTCTCGTTGTGGAGG + Intergenic
1201600244 Y:15720473-15720495 AGAAAATGGGCTGGGTGTGGTGG + Intergenic