ID: 1126496168

View in Genome Browser
Species Human (GRCh38)
Location 15:49293040-49293062
Sequence CAGGCACAGGATGGAGTCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 246}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126496164_1126496168 -9 Left 1126496164 15:49293026-49293048 CCAGGTAAATGTTGCAGGCACAG 0: 1
1: 0
2: 1
3: 13
4: 143
Right 1126496168 15:49293040-49293062 CAGGCACAGGATGGAGTCTTGGG 0: 1
1: 0
2: 0
3: 20
4: 246
1126496163_1126496168 -8 Left 1126496163 15:49293025-49293047 CCCAGGTAAATGTTGCAGGCACA 0: 1
1: 1
2: 0
3: 16
4: 144
Right 1126496168 15:49293040-49293062 CAGGCACAGGATGGAGTCTTGGG 0: 1
1: 0
2: 0
3: 20
4: 246
1126496160_1126496168 19 Left 1126496160 15:49292998-49293020 CCAATAACATCAGAAACTGAGAT 0: 1
1: 0
2: 0
3: 16
4: 234
Right 1126496168 15:49293040-49293062 CAGGCACAGGATGGAGTCTTGGG 0: 1
1: 0
2: 0
3: 20
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126496168 Original CRISPR CAGGCACAGGATGGAGTCTT GGG Intronic
900343608 1:2200434-2200456 GAGACACAGGAAGGAGGCTTTGG + Intronic
900626284 1:3610177-3610199 CAGACCCAGGGTGGGGTCTTGGG + Intronic
900709730 1:4106048-4106070 CAGAGGCAGGATGGAGTCATGGG + Intergenic
900911141 1:5597790-5597812 CAGGCCCAAGATGGAGCCTGGGG - Intergenic
901081412 1:6586222-6586244 CAGGCATAGGAGGGACTCTGTGG + Intronic
902209140 1:14892310-14892332 AAGGCACAGGAGGGCATCTTGGG - Intronic
902653082 1:17849430-17849452 CATGCACAGGCTGGGGCCTTGGG + Intergenic
903224668 1:21887814-21887836 CAGGCAGAGGATGGGGGCATAGG - Intronic
903232009 1:21927659-21927681 CTGGGAAAGGCTGGAGTCTTTGG - Intronic
903603489 1:24558375-24558397 CAGGCTGAGGATGGAGCTTTTGG + Intronic
905087052 1:35390112-35390134 TAGGTACTGAATGGAGTCTTTGG + Intronic
905223089 1:36462372-36462394 CAGGCACAGTGTAGGGTCTTGGG - Intronic
906065754 1:42979054-42979076 CAGGCACAGGATAAAGCCATAGG + Intergenic
909834769 1:80240148-80240170 GTGGCAGACGATGGAGTCTTGGG + Intergenic
910478543 1:87634258-87634280 TAGGCACAGGATGGAGGGTGTGG + Intergenic
911357737 1:96842977-96842999 CAGACACAGCATGGAGTTTGAGG + Intergenic
911462394 1:98206921-98206943 CAGGCCCAGGAAAGAGTCCTGGG + Intergenic
912409346 1:109468841-109468863 CAGGGAAATGATGCAGTCTTGGG + Intronic
913430782 1:118788773-118788795 CTGGGACAGGATGGAGTTCTCGG + Intergenic
915892548 1:159784915-159784937 CAAGCACTGGATGCAGTCATTGG + Intergenic
916987426 1:170206851-170206873 CAGGCAGAGGTTGGAATGTTTGG + Intergenic
917166532 1:172118900-172118922 CTGGCACAGAAGGGAGCCTTTGG + Intronic
917516605 1:175713688-175713710 CAGGCAAAGGAAAAAGTCTTAGG + Intronic
919821011 1:201471985-201472007 CAGGCCCAGGCTGGATTATTTGG + Intergenic
920178435 1:204117631-204117653 CAGGCAGAGGTTGGTGGCTTGGG - Exonic
920907078 1:210181238-210181260 CAGGTACATGAGTGAGTCTTTGG - Intergenic
921113603 1:212064305-212064327 CAGGCACAGGATGTTGTCAGTGG - Intronic
923065421 1:230513108-230513130 GAGCCACAGGAAGGAGTCTGGGG + Intergenic
923304225 1:232673466-232673488 GAGGAAGAAGATGGAGTCTTTGG + Intergenic
923380297 1:233410976-233410998 CAGGCACTGAATGCAGCCTTAGG - Intergenic
1062946777 10:1467517-1467539 CTGGCTCAGGATGGAGACTCAGG + Intronic
1066541508 10:36451645-36451667 GAGGCACTGCATGCAGTCTTGGG - Intergenic
1067731436 10:48814475-48814497 CAGGCAGGGCATGGAGTCTTCGG + Intronic
1069783631 10:70974180-70974202 CGGGGAGAGGATGGGGTCTTTGG + Intergenic
1075220659 10:120581656-120581678 CAGGCACAAGGTGGAGCCTGTGG - Intronic
1076021379 10:127076727-127076749 CAGGCCTGGAATGGAGTCTTGGG - Intronic
1076852195 10:133098738-133098760 CTGGCACAGGATGGGGTACTTGG - Exonic
1077316641 11:1922278-1922300 CAGGCACAGAAGGGAGCTTTGGG + Intronic
1077918446 11:6625877-6625899 CAGGCCCAAGATGGGGTCTTGGG + Intronic
1078171273 11:8930851-8930873 CAAGCACAGGAAGGAGGCTGAGG - Intronic
1079969315 11:27017156-27017178 CAGGCACAGGGTGGAGGCCAGGG - Intergenic
1080304486 11:30821549-30821571 GAGGCTCAGGTTGGAATCTTTGG + Intergenic
1083953046 11:65967355-65967377 CAGACTCAGGATGGGGACTTTGG + Exonic
1084022288 11:66424890-66424912 CAGGGACAGGTTGGAGTCCAGGG - Exonic
1084055333 11:66628198-66628220 CAGGGACAAAATGGAGGCTTGGG + Intronic
1084287863 11:68143279-68143301 CAGGAGCTGGATGGAGTCTGGGG + Intergenic
1085715473 11:78869197-78869219 CAGGTACAGGATGGAATATAAGG + Intronic
1087285965 11:96265592-96265614 TAGGCACAGGATGGGGGCCTGGG - Intronic
1089079687 11:115765335-115765357 GAGGCAAATGAGGGAGTCTTTGG - Intergenic
1089756478 11:120691249-120691271 CAGGCCTGGGATGGAGGCTTGGG + Intronic
1091271454 11:134314416-134314438 CAGGCTCAGGAAGGTGTCCTTGG - Exonic
1091315580 11:134611700-134611722 CTAGTACAGGATGTAGTCTTAGG + Intergenic
1093645476 12:21581285-21581307 CAGGCCCAGGATGTGGTCTCAGG - Intronic
1095298599 12:40556195-40556217 CATGCCCAGGTTGGATTCTTTGG + Intronic
1097033327 12:56105000-56105022 CAGGCCCAGGCTGAAGTCTATGG + Intronic
1097805601 12:63961447-63961469 CAGGCCCTGGAAGCAGTCTTGGG + Intronic
1097863032 12:64536865-64536887 CAGGCAGTGGATGGAGTAATAGG - Intergenic
1100158240 12:91827161-91827183 CAGGCAGAGGGATGAGTCTTAGG - Intergenic
1100473509 12:94914992-94915014 CTGACACAGGATGGAGGTTTGGG - Intronic
1101079769 12:101171019-101171041 CAGGAGCAGGATGGTGTCGTGGG + Intronic
1102323196 12:111956903-111956925 CAGGCAGAGGCTGCAATCTTGGG - Intronic
1103674511 12:122644929-122644951 TAGGCACAGGATGGGGGCATGGG + Intergenic
1103715843 12:122944950-122944972 CAGGCACAGGAGGAAGGCATGGG - Intronic
1104477917 12:129085307-129085329 CAGGCACGGGGTGGATTCTGAGG + Intronic
1107164551 13:37269281-37269303 CAGGGACAGGAGAGAGTCCTAGG + Intergenic
1108228255 13:48312838-48312860 CAGGCACAGGATGGATTGGATGG - Intronic
1109313986 13:60727968-60727990 TAGGCACAGGATGGAGGGTGGGG + Intergenic
1110570638 13:76999280-76999302 CAGTGACAGGATGCAGTGTTTGG + Intronic
1113970643 13:114185783-114185805 CAAGCACAGGAGGGAGGCTGAGG + Intergenic
1116859885 14:49985975-49985997 CAAGCAAAGGATGGAGTTTCAGG + Intronic
1118985250 14:70748889-70748911 CAGGCAGTGGAAGGAGTCCTTGG + Exonic
1119101353 14:71882966-71882988 CTGGCACAGGAGGAAGTTTTGGG - Intergenic
1119482999 14:74970940-74970962 CTGGCACAGGATGGAAGCTGAGG - Intergenic
1121610208 14:95273488-95273510 CAGCCACAGATTGGAGTGTTAGG - Intronic
1121889635 14:97577209-97577231 AAGACACAGGATTGAGCCTTTGG + Intergenic
1121897752 14:97664329-97664351 CAGGCACACGGTGGAGCCATGGG - Intergenic
1202909591 14_GL000194v1_random:104621-104643 CAAGCACAGGAGGGAGGCTGAGG + Intergenic
1123449010 15:20348983-20349005 CAGGCACAGGAGGGAGGCCTGGG - Intergenic
1123989299 15:25671541-25671563 CAGGCTCAGGCTGGAGGCTCTGG + Intergenic
1125789383 15:42352066-42352088 CAGGCTCAGGATGGATGTTTTGG - Exonic
1126496168 15:49293040-49293062 CAGGCACAGGATGGAGTCTTGGG + Intronic
1127384699 15:58457863-58457885 CAGGGGCAGGATGGAGACATGGG - Intronic
1127449217 15:59100562-59100584 CAGTAACAGGATTGGGTCTTAGG - Intergenic
1127617559 15:60702076-60702098 CAGGCAGATGATGGAGTTTGAGG + Intronic
1128080066 15:64851802-64851824 CAGGCAGAGGAGGGTGTATTCGG + Intronic
1128145398 15:65329872-65329894 CAGGGACGGGTTGGAGGCTTTGG + Intronic
1129328749 15:74816151-74816173 CAGGCCCAGGATGGCGTCTGTGG - Exonic
1130917956 15:88320868-88320890 CAGACACAGGATGGTGTGTGTGG - Intergenic
1131027621 15:89158062-89158084 CAGGGCCAGGATGGAGATTTGGG + Intronic
1131622460 15:94082205-94082227 CAGGCACAGGAGGGAATATCTGG - Intergenic
1132630560 16:915278-915300 CAGGCACAGGATGGGGGCAGAGG + Intronic
1132680982 16:1141668-1141690 CAGGCACAGGCTGGGCGCTTGGG - Intergenic
1136395851 16:29992006-29992028 AAGGATCAGGATGGGGTCTTGGG + Intronic
1136454532 16:30372776-30372798 CAGGCACAGGACGGAGACCCTGG - Intronic
1137400935 16:48154013-48154035 CAATCACAGGATGGGGTCTGAGG + Intronic
1139017813 16:62711481-62711503 TAGGCACAGGATGGGGGCTGTGG - Intergenic
1139093067 16:63672544-63672566 GAAGCACATTATGGAGTCTTAGG + Intergenic
1139277087 16:65738002-65738024 CAGGCAGGGGCTGGATTCTTTGG - Intergenic
1140190815 16:72814488-72814510 AAGGAAGAGGATGGACTCTTTGG - Intronic
1141992431 16:87618246-87618268 AATGCACAGGATGGAGCCTAGGG + Intronic
1142029684 16:87832293-87832315 CTGGCTCAGGATGGTGTCTCGGG + Exonic
1143380028 17:6490263-6490285 CAGGCCCTGGATAGAGTCCTCGG + Intronic
1143498291 17:7324758-7324780 CAGGGACAGGATAGGGTTTTGGG - Intronic
1143784100 17:9244059-9244081 CAGGGGAAGGATGGAGTTTTCGG + Intergenic
1144027961 17:11295342-11295364 CAGGCCCATGATGGATTCTGAGG + Intronic
1144678363 17:17176184-17176206 CAGGCTGAGGAGGGAGTCCTTGG + Intronic
1144779446 17:17800501-17800523 CAGGGACAGGATGGGGTGGTCGG - Intronic
1145800155 17:27677401-27677423 CAGGCACACACAGGAGTCTTAGG - Intergenic
1146458007 17:33022053-33022075 CTGGCCCAGGATGGGGTCTGGGG + Intronic
1148386337 17:47237668-47237690 CAAGCACAGGAAGGAGGCTGAGG - Intergenic
1150285129 17:63950027-63950049 TTGGCACTGGATGGAGGCTTTGG - Intronic
1153151606 18:2101508-2101530 AAGACCCAGGATGGAGTCCTGGG - Intergenic
1154031168 18:10755752-10755774 CAGGCACAGGGTGGAATCTAGGG + Intronic
1155215721 18:23641551-23641573 CAAGCACAGGAGGGAGGCTGAGG + Intronic
1156562327 18:38139468-38139490 TAGGCAAGGGATGGAGTGTTAGG + Intergenic
1156858953 18:41814510-41814532 CAGGCAGAGGTTGGAGTCTGGGG - Intergenic
1159039897 18:63314648-63314670 CAGGCAAGGGATTGAGTTTTGGG - Intronic
1160403902 18:78631332-78631354 CAGGCACCTGATGGGGTCATGGG + Intergenic
1160408963 18:78661698-78661720 CAGGAAGAGGAGGGAGTCTGGGG + Intergenic
1161824900 19:6556704-6556726 GAGAAACAGGAGGGAGTCTTGGG + Intergenic
1163387974 19:17011761-17011783 CAGGCAGAGGAAGGAGCTTTGGG + Intronic
1163730951 19:18948905-18948927 CAGGCACAGGCCGGGGTCTCTGG + Intergenic
1164655530 19:29918402-29918424 CAGGCACAGCATTGAGGCATCGG - Intergenic
1165459395 19:35935710-35935732 CAGGCAGAGAAAGGAGCCTTGGG + Exonic
1166117283 19:40663608-40663630 CACGCCCAGGATGGAGACTCTGG - Intergenic
1166435101 19:42761028-42761050 CAGGTTGAGGATGGAGTCATGGG + Intronic
1167116688 19:47492758-47492780 CTGGCACGGCATGGAGTCGTAGG + Intronic
926542981 2:14204408-14204430 TAGGCACAGGATGGGGGCTGGGG - Intergenic
927157718 2:20231220-20231242 CAGGAACTGGAAGGAGTCTGAGG + Intergenic
928139093 2:28712285-28712307 TAGGCATAGGAAGGAGTCTTGGG - Intergenic
929457059 2:42073455-42073477 GAGGCCCAGAATGGAGTCTATGG - Intergenic
929816075 2:45232740-45232762 CAGGCACAGGCTGGATCCTTTGG - Intergenic
931938918 2:67230699-67230721 CAGGCACAGGATGGGGGATGGGG - Intergenic
934136417 2:89000384-89000406 CAGGCACAGCAGGTAGTATTGGG + Intergenic
934657434 2:96123488-96123510 CAGGCACAGGAGGGATTCCAGGG + Intergenic
935978655 2:108605045-108605067 GAGGCACAGGAATGTGTCTTGGG + Intronic
936573152 2:113633039-113633061 CAGGAACAGGAAGGAGGATTGGG + Intronic
937150197 2:119681138-119681160 CAGCCCCAGCAGGGAGTCTTGGG - Exonic
937243127 2:120475325-120475347 TAGGCACAGGAAGGAGACTCAGG - Intergenic
937877889 2:126839209-126839231 CAGGCACAGGACTCAGTCCTGGG + Intergenic
940193820 2:151070784-151070806 CAGTCACAGGACTGACTCTTAGG + Intergenic
940720767 2:157279624-157279646 CAGGCACAGGAAAGAATCTCTGG + Intronic
943705455 2:191028960-191028982 CAGTCTCAGGTTGGATTCTTAGG + Intergenic
943784369 2:191860932-191860954 CAGGCATAGGATAGTGTATTAGG + Intergenic
944507425 2:200426933-200426955 CAGACACAGGATGTAGTGATAGG + Intronic
948075649 2:235163393-235163415 GAGGCACAGGCTGGAGACTCCGG + Intergenic
948512643 2:238480293-238480315 AAGGGACATGATGGAGACTTTGG - Intergenic
1169360423 20:4944010-4944032 CAGGGAAAGGATGGAACCTTTGG + Intronic
1170977114 20:21175441-21175463 CTGGCAAAGGATGGAGACCTGGG - Intronic
1172245439 20:33442824-33442846 CAGGCACAGGCTGGGGTCACAGG - Intronic
1172673911 20:36653993-36654015 CAGTGACAGAATGGAGGCTTTGG + Intronic
1175421328 20:58836002-58836024 CAGTGACAGGAAGGAGTGTTGGG - Intergenic
1175806329 20:61831170-61831192 CAGCCACAGGAAGGAAGCTTTGG - Intronic
1175938684 20:62527010-62527032 CAGGCACAGGCTGCAGGCTTAGG + Intergenic
1176043773 20:63082062-63082084 CAGGCAGAGGCTGGAGTGGTGGG - Intergenic
1176628941 21:9119329-9119351 CAAGCACAGGAGGGAGGCTGAGG + Intergenic
1179432533 21:41333757-41333779 CAGGCAGAGGTTGGAGAGTTTGG + Intronic
1180994787 22:19959998-19960020 CAGGCAAAGGAAGGGGGCTTCGG + Intronic
1184150519 22:42635708-42635730 CAAGCCCAGGGTGGAGACTTGGG + Intronic
949756443 3:7416529-7416551 CAGGAACACCATGAAGTCTTTGG + Intronic
950854873 3:16095612-16095634 ATGGCACAGCATGGAGCCTTTGG - Intergenic
953282877 3:41575675-41575697 CTGGCACAGAAGGGAGTATTTGG + Intronic
953469695 3:43156066-43156088 GAGGCCCAGGAAGGGGTCTTAGG + Intergenic
954103856 3:48398541-48398563 CTTGCACAGGATGCTGTCTTTGG + Intronic
955400802 3:58590209-58590231 GAGGCACATGTTGGAGGCTTGGG - Intronic
960339126 3:116453853-116453875 CAGGCTCAGGAAGTTGTCTTAGG + Intronic
961650445 3:128414292-128414314 CAGGCCCAGGGTGGAAGCTTGGG - Intergenic
962006195 3:131352396-131352418 AAGCCACAGGATAGAGTGTTAGG - Intergenic
962943379 3:140145776-140145798 CAAGCACAGGAGGGTTTCTTGGG + Intronic
963263522 3:143216383-143216405 AAGAGATAGGATGGAGTCTTGGG + Intergenic
964307570 3:155357290-155357312 CAGGCACAGGATGGAGGGTGGGG + Intergenic
964456940 3:156879117-156879139 CAGGCAGAGGTTGGAGCATTAGG + Intronic
964965364 3:162486005-162486027 CAGCCACAGGATGGGGACTGTGG - Intergenic
965281975 3:166765738-166765760 CAGGCAGAGGATGGAATGTTTGG - Intergenic
965576963 3:170227309-170227331 CAGGCACATGATGCTGTCGTAGG + Intronic
965764429 3:172115149-172115171 GAGACACAGGATGGAGACTCTGG - Intronic
965764496 3:172115638-172115660 CAGGCACAGGATTGACTCTAGGG + Intronic
967216999 3:187219363-187219385 CAGGGACAGGAGGGAGCCTGGGG - Intronic
968917481 4:3502937-3502959 CGGGCACAGGTTGGAGTCCAGGG - Intergenic
969352988 4:6608913-6608935 CTGGGACAGCATGGAGTCTAAGG + Intronic
969447438 4:7253313-7253335 CAGATTCAGGATGGAGCCTTGGG - Intronic
969477846 4:7431473-7431495 CTGGGACAGGATGGAGCCATAGG - Intronic
973702393 4:53550298-53550320 CAGGAACAAGATCCAGTCTTGGG - Intronic
974285165 4:59855902-59855924 CAAGCACAGGAGGGAATCCTGGG - Intergenic
974303247 4:60097908-60097930 TAGGCACAGGATGGGGGCGTGGG - Intergenic
975644297 4:76530802-76530824 CAGCCACAGGATGGAGGCACAGG - Intronic
976401406 4:84611087-84611109 AAGGTAAAGGATGGAGTCTTGGG + Intronic
978400825 4:108328859-108328881 AAGGGACTGGATCGAGTCTTTGG + Intergenic
979408585 4:120345157-120345179 CAGGCACTGGGTGAAGTCTCTGG - Intergenic
979657886 4:123218082-123218104 CAGGAGCAGGATGGTGTATTAGG + Intronic
980526948 4:134001654-134001676 CAGGGACAAGATGGAATCTGTGG + Intergenic
984169482 4:176343490-176343512 CAAGCACAGGAGGGAGGCTGAGG - Intergenic
986014852 5:3748830-3748852 CAGGCAGAGGATGCAGGCTCTGG - Intergenic
988367127 5:30314637-30314659 AAGTCAAAGGATGGAGTTTTGGG - Intergenic
989605290 5:43238871-43238893 AAGGCACAGGACGGAGGATTAGG - Intronic
990786591 5:59427252-59427274 ATGCCACAGTATGGAGTCTTTGG - Intronic
991158769 5:63470087-63470109 CAGGCACAGGATAAAGTGTTAGG + Intergenic
994376510 5:99020936-99020958 CAGTCACAGGAAGGGGACTTTGG + Intergenic
995173003 5:109139239-109139261 CAGACTCAGGAAGGAGTCTGTGG - Intronic
995948552 5:117681235-117681257 CAGGGACAGGATGGAGGAATGGG - Intergenic
997161025 5:131609386-131609408 AAGACACAGGATGGAGACATGGG + Intronic
998390863 5:141786263-141786285 TAGGCACAAGACGGAGCCTTGGG - Intergenic
998509432 5:142699091-142699113 TAGGTACAGGATGGAGTCTCTGG + Intergenic
999483427 5:151969987-151970009 CAGGCAGGGTATTGAGTCTTGGG + Intergenic
1000998867 5:167986397-167986419 CAGGCACAGGTTAGGGGCTTGGG - Intronic
1002064547 5:176645530-176645552 CTGGCACAGGGTGGGGACTTGGG + Intronic
1003217942 6:4132185-4132207 CACACACAGGATGGAGTCTGGGG + Intronic
1003263485 6:4546463-4546485 CAGGCTCAGGATGGGGTTCTGGG - Intergenic
1004473281 6:15947873-15947895 GAGGCACAGGAAGGAGGGTTGGG + Intergenic
1004709043 6:18152978-18153000 CAATCACAGGATGGAGTTTTTGG - Intronic
1005166607 6:22929348-22929370 CAGGCACAGGATTCCGTGTTGGG - Intergenic
1005372503 6:25149988-25150010 GAGGCACAGCAGGGAGTCTCAGG + Intergenic
1009521976 6:64694613-64694635 CAAGCACAGGCTGGAGTCACTGG + Intronic
1009992166 6:70856971-70856993 CAGAGATAAGATGGAGTCTTTGG - Exonic
1014259863 6:119203957-119203979 GAGGCACAGGATTGAGTGCTAGG + Intronic
1014740547 6:125143651-125143673 TAGGCACAGGATGGGGAGTTGGG + Intronic
1015669193 6:135668322-135668344 CAGGCACAGGAAAGAGCCTCAGG - Intergenic
1016083019 6:139878553-139878575 TAGGCATAGGATGGAGGGTTGGG + Intergenic
1017056611 6:150442376-150442398 CAGGCTCAAGATGGATTCTCAGG - Intergenic
1017522618 6:155215031-155215053 CTGGCACAGGATGGTAGCTTGGG + Intronic
1018486562 6:164246427-164246449 ATGGAGCAGGATGGAGTCTTAGG - Intergenic
1019062592 6:169266772-169266794 CAGGCACAGGATCCAGTCACGGG - Intergenic
1019075768 6:169387106-169387128 CAGGCACAGGAAGGAGCCAGGGG + Intergenic
1019576933 7:1742151-1742173 CAGGCACAGGGAGGAGGCTTGGG - Intronic
1020287593 7:6696870-6696892 TAGGCACAGGATGGGAACTTTGG + Intronic
1020625493 7:10573682-10573704 CAGGCTCAGGATTGAGGCTGTGG - Intergenic
1021154161 7:17188964-17188986 CACCAACAGTATGGAGTCTTAGG + Intergenic
1021859798 7:24895038-24895060 CAGCCACAAGGTGGAGTTTTGGG + Intronic
1022092653 7:27117692-27117714 CAGGCAGGGGATGGAGGATTAGG - Intronic
1023506529 7:40904748-40904770 CAGGTAGAGGATGGAGATTTAGG + Intergenic
1024246718 7:47476312-47476334 CAGGCACAGAATGTAGTGGTAGG - Intronic
1024874337 7:54004696-54004718 CAGGCACATAATGGAGGCTGTGG + Intergenic
1027479824 7:78681655-78681677 CATGCACAGGAAGGAGACCTGGG + Intronic
1029635104 7:101778384-101778406 CTGGCACAGGCTGGTGGCTTTGG + Intergenic
1031993285 7:128211528-128211550 AGGGCACAGGAAGGAGTTTTGGG + Intergenic
1032082251 7:128865520-128865542 CCTGCGCAGGATGGAGTCCTTGG - Exonic
1032761598 7:134948305-134948327 CAGGCACGGTATGGGGTCCTGGG - Intronic
1032919308 7:136527667-136527689 CAAGCACAGGAAGGAGCCTGAGG - Intergenic
1034228676 7:149501990-149502012 AAGGCACAGGATGGGGTGTGTGG + Intergenic
1035104929 7:156434414-156434436 CAGGGACAGCAGGGAGCCTTGGG + Intergenic
1035201543 7:157270511-157270533 CAGGGACAGTCTGGAGGCTTGGG + Intergenic
1036170386 8:6478679-6478701 CAGCCTCAGGATGGAGTTCTAGG + Intronic
1036680306 8:10867571-10867593 AAGGCTCAGGATGGAGGCATGGG + Intergenic
1037617110 8:20529370-20529392 CAGGCACAGTGTGGAATCTCGGG + Intergenic
1039505748 8:38051161-38051183 TAGGCACAGCATGGAATCTGGGG - Intronic
1041144539 8:54860051-54860073 CAGGCAAAGGAAGGAGAATTAGG + Intergenic
1041748395 8:61233801-61233823 CAGGCAGAGAATGGAGTGTGTGG - Intronic
1042040675 8:64585670-64585692 CTGGCACATGCTGCAGTCTTAGG - Intergenic
1043745526 8:83869459-83869481 CAAGCACAGGAGGGAGCCTCAGG + Intergenic
1045635253 8:104178585-104178607 TAGCCACAGGATGGAATCTTGGG + Intronic
1047255342 8:123209653-123209675 CAGGCACAGGCTGAGGCCTTTGG - Exonic
1047861294 8:128970150-128970172 CAGTCACAGGAAGAAGACTTTGG + Intergenic
1050268057 9:3911986-3912008 GAGGAAAAGGATGGAGACTTCGG + Intronic
1055284282 9:74711814-74711836 GAGGCTCAGGATGGAGGCTGGGG + Intergenic
1057206336 9:93175187-93175209 CAGCTGCAGGATGGAGTCTTGGG + Intergenic
1061101359 9:128494920-128494942 CAGGCAGAGGCAGCAGTCTTGGG - Intronic
1061719782 9:132544444-132544466 CAGGGCCAGGATGGAGGCTGTGG - Intronic
1062315275 9:135964160-135964182 CAGGGAAAGGATGGAGCCATGGG + Intergenic
1062702120 9:137912738-137912760 CAGGAGCAGGATGGAGCCTGAGG - Intronic
1203751788 Un_GL000218v1:87010-87032 CAAGCACAGGAGGGAGGCTGAGG + Intergenic
1186955286 X:14675020-14675042 CAGGCACAGGAAGTAGACTATGG + Intronic
1188553231 X:31383643-31383665 CAGGCACAGGATGGAGGGCAGGG - Intronic
1190540203 X:51469471-51469493 CAGGAAGAGGATGGAGACATAGG - Intergenic
1193074545 X:77341498-77341520 CAGGCTCAAGATGGAGCCCTGGG + Intergenic
1194413030 X:93578847-93578869 CAGGCATAGGAGGGAGGCTGAGG + Intergenic
1200729364 Y:6716647-6716669 CAGGCACAGTATGGAGGTATTGG + Intergenic
1201165443 Y:11204630-11204652 CAAGCACAGGAGGGAGGCTGAGG + Intergenic