ID: 1126497329

View in Genome Browser
Species Human (GRCh38)
Location 15:49306635-49306657
Sequence TGCCTAGGGCTGGCCTGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 472
Summary {0: 1, 1: 0, 2: 6, 3: 53, 4: 412}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126497329 Original CRISPR TGCCTAGGGCTGGCCTGGCC TGG (reversed) Intronic
900164359 1:1238820-1238842 TGCCTGGAGCGGGCGTGGCCGGG - Intergenic
900208126 1:1440136-1440158 TGGCAAGGGCTGGCCTGGGGCGG + Exonic
900328079 1:2120584-2120606 AGCCAAGGGCTGGCCGGGCACGG - Intronic
900594977 1:3476548-3476570 GGACTAGGGCTGCCCGGGCCTGG - Intronic
900596031 1:3480589-3480611 TGCCGCCGGCTGGCCTCGCCAGG - Exonic
900606598 1:3526325-3526347 TGCCCATGTCTGCCCTGGCCTGG - Intronic
900609571 1:3538858-3538880 GGCGTGGGGCTGGCCTTGCCTGG - Intronic
901700558 1:11043057-11043079 TGCCTGGGTCTGGCCTGGGCCGG + Intronic
902334736 1:15748394-15748416 TGCCTCAGGCTGGCCTGGGCTGG + Intergenic
902793332 1:18784129-18784151 TGCCTGGCGCTAGGCTGGCCCGG + Intergenic
903411488 1:23147148-23147170 TGCTTAATGCTGGCCTGGCACGG + Intronic
903554626 1:24184464-24184486 TGACGTGGCCTGGCCTGGCCTGG + Intronic
903554627 1:24184469-24184491 TGGCCTGGCCTGGCCTGGCCAGG + Intronic
905211238 1:36375578-36375600 CACCTAGGTCTGGCCTGGCTGGG - Intronic
905269196 1:36775868-36775890 AGCCTAGGGCTGGCCAGGGCGGG - Intergenic
905447849 1:38038904-38038926 TCCCTGGAGCTGGGCTGGCCTGG - Intergenic
906477568 1:46180363-46180385 TGCCCAGGGCTGGTGTTGCCAGG + Intronic
906708320 1:47910963-47910985 TGCCCAAGGCTGGAATGGCCAGG + Intronic
909986272 1:82164049-82164071 TGCAAAGGCCTGGGCTGGCCTGG + Intergenic
912339419 1:108896877-108896899 TGCCTAGAGCTGGCCTTGGAAGG + Exonic
912710203 1:111944515-111944537 TGCCCAGGGCATGGCTGGCCGGG - Intronic
915530775 1:156500944-156500966 TCCCCAGGGCTGGCCGGGCCAGG + Intergenic
916058430 1:161083498-161083520 TCCCTGGGCTTGGCCTGGCCTGG - Intronic
916497841 1:165361107-165361129 TGCCTAGGGCTGTCCTTGCCAGG - Intergenic
920088555 1:203435719-203435741 TTCCCCAGGCTGGCCTGGCCTGG + Intergenic
920674459 1:208029536-208029558 TTCCCAGGGCTGGCCTGGCCTGG + Intronic
921207996 1:212865770-212865792 TCCCTATTGCTGGCCGGGCCTGG - Intronic
922016494 1:221653781-221653803 TACCTAGGGCAGGCCTGGGGAGG + Intergenic
922208312 1:223467988-223468010 TGCCTAGGAGGGGCATGGCCAGG - Intergenic
922461271 1:225816000-225816022 TGCCAAGGACTGGCCCGGCATGG + Intronic
923923380 1:238595483-238595505 TTCCTAGGGTTGGGCTGGTCTGG + Intergenic
924707530 1:246511732-246511754 TGGCTGGGGGTGGCCTGGGCAGG + Intergenic
1062855104 10:776071-776093 CGTCTTGGGCTGGCCTTGCCTGG - Intergenic
1063465652 10:6242384-6242406 TGCCCAGGACGGGCCTGGCCAGG + Intergenic
1063773850 10:9237988-9238010 TGGCCTGGCCTGGCCTGGCCTGG - Intergenic
1065766487 10:29035002-29035024 TGCCTAGGGCTGGCCCGTGGAGG - Intergenic
1066201526 10:33146297-33146319 AGCCTAAGGTCGGCCTGGCCTGG - Intergenic
1067143533 10:43676562-43676584 GGCCCAGTGCTGACCTGGCCCGG - Intergenic
1067249693 10:44576078-44576100 AGCCTGGGCCTGGCCTGCCCAGG + Intergenic
1067803614 10:49377463-49377485 TGCCTGAGTCTGGGCTGGCCCGG + Intronic
1069660875 10:70122662-70122684 AGCCGAGGGCTGGCCAGGCCTGG + Intronic
1070820406 10:79350859-79350881 TGCCTAGCGCTGCCCAGCCCAGG - Intronic
1071524102 10:86348211-86348233 TGCCTAGGCCTGTACAGGCCTGG + Intronic
1071599896 10:86953973-86953995 TGCCAAGGGAGGGCCTGCCCAGG - Intronic
1072809042 10:98445589-98445611 TGCAAAGGGCTGTGCTGGCCGGG - Intronic
1073046613 10:100642890-100642912 TGCGGAGGGCTGGGCTGGGCTGG - Intergenic
1073118569 10:101107664-101107686 TCCCCTGGGTTGGCCTGGCCTGG + Intronic
1073475160 10:103747728-103747750 CCCCTGTGGCTGGCCTGGCCAGG - Intronic
1073579969 10:104656364-104656386 AGCAAAGGGGTGGCCTGGCCTGG + Intronic
1075034882 10:119056331-119056353 TGCCTAGGGCTGGGGTGGTGGGG + Intronic
1075331330 10:121576358-121576380 AGGCTCGGGCTGGGCTGGCCAGG - Intronic
1075725411 10:124608333-124608355 GGGCTGGGGCTGGGCTGGCCAGG - Intronic
1075906067 10:126083128-126083150 TGCCTGGAGCGGGGCTGGCCAGG + Intronic
1076216289 10:128696203-128696225 TGCCTGTGGCTGGGCTGGCCTGG - Intergenic
1076768490 10:132650676-132650698 AGCCCATGGCTGGCCTGGCAGGG + Intronic
1076885086 10:133258515-133258537 TGCCTAGGCCTGGGTTGGCTCGG + Intergenic
1077136194 11:1000371-1000393 TGCCTGGGGTTGGCCAGGCCAGG + Intronic
1077149056 11:1060564-1060586 TGCCGTGGCCTGGCCTGGGCAGG - Intergenic
1077273513 11:1692781-1692803 TGCTCAGGGCTGGCATGGCCAGG - Intergenic
1077321199 11:1942877-1942899 TGCCTGGGTCTGGCCTCCCCTGG + Intergenic
1077352668 11:2100104-2100126 TGCCTGAGGCTGGCCTGGGTGGG + Intergenic
1077378652 11:2217608-2217630 TGCCTTGGGAAGGCTTGGCCTGG - Intergenic
1077895984 11:6453890-6453912 TCCTTAGGGCTGGCATGGGCTGG - Intronic
1078651958 11:13203970-13203992 TGCCTAGGGCTGGGAGGGCCTGG + Intergenic
1078776935 11:14402534-14402556 TGCCTAGGGCCAGTTTGGCCTGG + Intergenic
1079400939 11:20105789-20105811 TGCAAAGTGCTGTCCTGGCCAGG - Intronic
1081604434 11:44518556-44518578 AGCGGAGGCCTGGCCTGGCCTGG + Intergenic
1081658697 11:44874712-44874734 GGTCTATGGCTGGCCGGGCCTGG + Intronic
1081667471 11:44925016-44925038 TGTCCTGGCCTGGCCTGGCCTGG + Intronic
1081866158 11:46361798-46361820 TGCCTAGGGATGGTGGGGCCCGG - Intronic
1082004536 11:47412300-47412322 TGGCTTGGCTTGGCCTGGCCTGG + Intronic
1082004537 11:47412305-47412327 TGGCTTGGCCTGGCCTGGCCTGG + Intronic
1082775498 11:57241475-57241497 TGCCCAGAGCTGGCCTGCCCTGG + Intergenic
1083476198 11:62917229-62917251 AGCCTAGGGCTGGTCTCCCCAGG - Intronic
1083694925 11:64436457-64436479 TGCCTGGGGGTGGCCAGGCTGGG + Intergenic
1083921658 11:65784302-65784324 AGCCGAGGGGAGGCCTGGCCTGG + Intergenic
1083966542 11:66047161-66047183 AGAGAAGGGCTGGCCTGGCCTGG + Intronic
1084170377 11:67398080-67398102 TGGCTAGGGTTGCCCTGGCTGGG + Exonic
1084209678 11:67615227-67615249 GGGATGGGGCTGGCCTGGCCAGG - Intergenic
1084273819 11:68042035-68042057 GGCCTAGGGCAGGGCTGGCTGGG + Intronic
1084468991 11:69344218-69344240 TGACAGGGGCAGGCCTGGCCTGG + Intronic
1084548202 11:69825046-69825068 GGCCAAGTCCTGGCCTGGCCCGG + Intergenic
1084961857 11:72721069-72721091 AGCCCAGGCCTGGCCTGGCCTGG + Intronic
1085018607 11:73191207-73191229 TCCCTAGGCCTTGCCGGGCCTGG - Intergenic
1085186767 11:74582378-74582400 TGTCCTGGCCTGGCCTGGCCTGG + Intronic
1085337502 11:75707242-75707264 TGGCAAGGCCTGGCCTGCCCTGG - Intergenic
1085472639 11:76768008-76768030 GGTCCAGGCCTGGCCTGGCCAGG - Intergenic
1086062936 11:82718822-82718844 TGCCTAATGCTGGCCTGACTGGG - Intergenic
1086130119 11:83392803-83392825 TCCCTAGGGAGGGCCTGGCCAGG - Intergenic
1087375282 11:97332189-97332211 ATCCTAGGGCTGGAGTGGCCAGG + Intergenic
1087618236 11:100513345-100513367 TGCCTAGGGATGGACTTGCTGGG - Intergenic
1090077482 11:123588339-123588361 TGCCAAGGGCTGGGCAGGGCTGG - Intronic
1091130345 11:133141451-133141473 AGGCTAGGGCTGCCCTGGTCAGG - Intronic
1091323712 11:134668928-134668950 TGCCTGGGGCTGGCCTGGGTAGG + Intergenic
1091681227 12:2528570-2528592 TGGGTAGGGCAAGCCTGGCCTGG - Intronic
1091787754 12:3253189-3253211 TGCTTAGGGCAGGCTTGGGCTGG - Intronic
1095575552 12:43734169-43734191 TGGCTAGGAATGGCCTGGCCTGG - Intronic
1096145064 12:49273029-49273051 TGCCGAGGCCTGGGCTCGCCTGG + Exonic
1097237619 12:57550558-57550580 TGGCTGGGTGTGGCCTGGCCAGG + Intronic
1100404953 12:94264500-94264522 TGCCCGGGCCGGGCCTGGCCTGG + Intronic
1102570743 12:113825602-113825624 TTCCTGGGCCAGGCCTGGCCTGG + Intronic
1102990154 12:117309606-117309628 TCCCTAGGGTTGCCCTGGCCTGG + Intronic
1103347269 12:120259627-120259649 TGCTCAGGGCTGGCCTCTCCAGG - Intronic
1103570586 12:121842050-121842072 TGCCTAGGGCTGGGGTGGGAGGG + Intronic
1103880564 12:124162929-124162951 TGGCTTGGGTTGGGCTGGCCTGG + Intronic
1105574572 13:21638111-21638133 TGCCTGGGGCCAGCCTGGCTAGG - Intergenic
1108702466 13:52955509-52955531 TGCTGGGGGCTGGCCTGGGCTGG - Intergenic
1112492853 13:99882967-99882989 TGGGCTGGGCTGGCCTGGCCTGG - Intronic
1113485623 13:110650518-110650540 TGTCTAGCACTGGCCTGGCATGG - Intronic
1114483033 14:23047195-23047217 TGCCCAGGGCTGGGATGCCCAGG + Exonic
1115174251 14:30544315-30544337 TGACTGGGGCTGGCCGGGCCTGG + Intergenic
1117211056 14:53500576-53500598 TGCCTAGGGCTGGGCTGGTTGGG + Intergenic
1118186402 14:63542677-63542699 GGCCTTGGGAAGGCCTGGCCGGG - Intronic
1119379330 14:74218575-74218597 TGCCTGGGGCTGGCATGGGCTGG - Intergenic
1119539270 14:75428125-75428147 TGCCCAGGCCTGTCCCGGCCCGG - Intronic
1121022391 14:90588223-90588245 TGGCCTGGCCTGGCCTGGCCTGG - Intronic
1121022394 14:90588228-90588250 GGCCCTGGCCTGGCCTGGCCTGG - Intronic
1122446272 14:101771799-101771821 GACCAAGGGCTGGCATGGCCCGG + Intronic
1122716636 14:103700232-103700254 TGCTCTGAGCTGGCCTGGCCTGG + Intronic
1122913576 14:104845446-104845468 TACCAGGGGCTGGCCAGGCCTGG - Intergenic
1123037174 14:105476203-105476225 AGCCCCAGGCTGGCCTGGCCCGG - Intronic
1123054870 14:105564580-105564602 TGCCTGCTGCTGTCCTGGCCTGG + Intergenic
1123059998 14:105590287-105590309 TGGCCTGGGCTGGGCTGGCCTGG - Intergenic
1123060002 14:105590297-105590319 TGGCCTGGGCTGGCCTGGGCTGG - Intergenic
1123060274 14:105591274-105591296 TGCCCTGAGCTGCCCTGGCCTGG - Intergenic
1123063172 14:105603537-105603559 TGGGCTGGGCTGGCCTGGCCTGG - Intergenic
1123079314 14:105684159-105684181 TGCCTGCTGCTGTCCTGGCCTGG + Intergenic
1123084098 14:105709518-105709540 TGACTTGGGCTGGACTGGGCGGG - Intergenic
1123505030 15:20933486-20933508 TGCCTAGGGCTGGAGAAGCCGGG + Intergenic
1123562275 15:21507180-21507202 TGCCTAGGGCTGGAGAAGCCGGG + Intergenic
1123598520 15:21944467-21944489 TGCCTAGGGCTGGAGAAGCCGGG + Intergenic
1124192337 15:27591246-27591268 TGCACTGGGCTGCCCTGGCCTGG + Intergenic
1125500885 15:40239781-40239803 TGGCTTAGGCTGGCCTGGGCAGG + Exonic
1125677737 15:41511694-41511716 TGCGCTGGGCTGGGCTGGCCTGG - Intronic
1125988068 15:44075028-44075050 TGCTAAGAGCTGGCCTGGACCGG - Intronic
1126497329 15:49306635-49306657 TGCCTAGGGCTGGCCTGGCCTGG - Intronic
1127560051 15:60127296-60127318 TGGGCTGGGCTGGCCTGGCCAGG - Intergenic
1127707245 15:61559459-61559481 TACCTGAGGCTGGCCTGGCTGGG - Intergenic
1128758762 15:70200584-70200606 CGCCCTGGGCAGGCCTGGCCAGG + Intergenic
1128777114 15:70329020-70329042 TGCCATGAGGTGGCCTGGCCAGG - Intergenic
1129413201 15:75361027-75361049 AGCCAAGGCCTGGCCTGACCTGG + Exonic
1129751634 15:78069301-78069323 TGGCTAGGGCCGGCCCGCCCTGG - Intronic
1130542885 15:84834763-84834785 CGCCATGGGCTGTCCTGGCCAGG + Intronic
1130722713 15:86405219-86405241 TGCCTATGCCTGGCCGGGCGCGG + Intronic
1131035331 15:89218354-89218376 TGGGTTGGGCTGGCCTGGCTGGG + Intronic
1132147752 15:99438440-99438462 GGTCTTGGGCTGCCCTGGCCGGG - Intergenic
1202970620 15_KI270727v1_random:234322-234344 TGCCTAGGGCTGGAGAAGCCGGG + Intergenic
1132828479 16:1916519-1916541 TGCCCAGGGCGGGCCTGGACTGG + Intronic
1132851442 16:2026744-2026766 CGCCTCGGGCTGGCCGGGCGCGG + Intronic
1133022067 16:2971150-2971172 TCCCTAGGGCTGGCCCTGCTGGG + Exonic
1134062231 16:11206135-11206157 AGCCCTGAGCTGGCCTGGCCTGG + Intergenic
1135514731 16:23121445-23121467 AGCCTAGGCCTGGCCTGGCCCGG + Intronic
1136268672 16:29135528-29135550 TGACTGGGGCTGGCCTTCCCAGG - Intergenic
1136787729 16:32945717-32945739 TGCCGTGGGCTGGGCTGGCATGG + Intergenic
1136882052 16:33908072-33908094 TGCCGTGGGCTGGGCTGGCATGG - Intergenic
1137488508 16:48911274-48911296 TGCCTTGGTGTGGCCTGACCTGG + Intergenic
1137626631 16:49912908-49912930 TGCACAGGGCTGGCCTGGCCAGG - Intergenic
1137832768 16:51559856-51559878 TCCCTAGGCCTGGAGTGGCCTGG - Intergenic
1139807251 16:69577623-69577645 TGCCTGGGGCTGGAGTGGGCAGG + Intronic
1140452713 16:75083893-75083915 TGCCTGAGGCAGGACTGGCCAGG + Intronic
1141727335 16:85798934-85798956 TCCCTAGGGTTGCCGTGGCCAGG - Intronic
1141835757 16:86538233-86538255 TCCCTAGAGCTGGCCTGAGCTGG - Intronic
1142071981 16:88095895-88095917 TGACTGGGGCTGGCCTTCCCAGG - Intronic
1142182757 16:88679213-88679235 TGCGGGAGGCTGGCCTGGCCAGG - Intronic
1142220740 16:88853785-88853807 TCCCCAGGGCTGCCCTGCCCTGG - Intronic
1142285954 16:89171630-89171652 GGCCGAGGGCCGGCCTGGGCAGG - Intergenic
1142358120 16:89613670-89613692 TGCCTAGGCCGGGCCCTGCCAGG + Intronic
1143113474 17:4567094-4567116 TGCCAAGGGCAGCCCTGGCTTGG + Intergenic
1144143784 17:12377261-12377283 TGGCCTGGCCTGGCCTGGCCTGG - Intergenic
1144522925 17:15966374-15966396 AGCCTGTGGCTGGACTGGCCAGG + Intronic
1144653607 17:17021753-17021775 GGTGCAGGGCTGGCCTGGCCTGG + Intergenic
1144962122 17:19050471-19050493 TGGCTGGGTCTGCCCTGGCCTGG - Intergenic
1144973039 17:19124050-19124072 TGGCTGGGTCTGCCCTGGCCTGG + Intergenic
1145957170 17:28862489-28862511 TGCCTAGCACTGCCCTGGCAAGG + Intergenic
1146208990 17:30927321-30927343 TGTCTAGAGCTGGCCAGGCACGG + Intronic
1146377278 17:32303182-32303204 TGCCTGGGGCTGCCCTGGGGCGG + Intronic
1147119969 17:38330158-38330180 CGCCTTGGGCCGGCCTAGCCTGG + Exonic
1147148084 17:38497835-38497857 TGCCGCGGGCTGGGCTGGCATGG + Intronic
1147647145 17:42040619-42040641 GGCCGAGGCCTGGCCTGGCCTGG - Intronic
1147732709 17:42614020-42614042 GGCCCAGGGCCGGCCTGGCCTGG - Intronic
1147739967 17:42665849-42665871 GGCCCAGGGCCAGCCTGGCCTGG - Intronic
1147867119 17:43560369-43560391 TGCTTAGTGCTGGCTTGTCCTGG + Intronic
1147893476 17:43734124-43734146 CTCCTAGGCCTGGCCTGCCCTGG - Intergenic
1147927923 17:43956622-43956644 TGACTTGGGGTGGCCTTGCCAGG - Intronic
1148837603 17:50474112-50474134 GACCAGGGGCTGGCCTGGCCAGG - Intronic
1151347885 17:73514498-73514520 TTCCCAGGGCTGGGCTGGCTGGG - Intronic
1151377384 17:73699204-73699226 TGCCGAGGGCTTCCCTGGCATGG - Intergenic
1151663790 17:75534067-75534089 TGCCTGGGGCTGGCGTGGGCAGG - Intronic
1152073135 17:78143940-78143962 TGCTCTGGGCTGCCCTGGCCAGG - Intergenic
1152101589 17:78304794-78304816 TCCCTAGGGCTGGCCTGACCTGG - Intergenic
1152278647 17:79372505-79372527 TCCCAAGGCCAGGCCTGGCCCGG + Intronic
1152340662 17:79722363-79722385 GGCCAGGGGCTGGCCTGCCCAGG - Intergenic
1152545687 17:80999106-80999128 TGCCTGGGCCTGGCCTTGACAGG - Exonic
1152642214 17:81453998-81454020 TGCCTGGCCCTGGCCTGGCGTGG - Intronic
1152879650 17:82807864-82807886 TGCCTCTGGCTGGCCCTGCCGGG + Intronic
1153649728 18:7229399-7229421 TGGCAAGGGCTGGTTTGGCCTGG - Intergenic
1154358468 18:13640654-13640676 GGTCCAGGGCTGGCTTGGCCCGG + Intronic
1157444916 18:47737474-47737496 TCCCTCGGGATGGCCTGGTCAGG + Intergenic
1157471347 18:47991415-47991437 TTCCTAGGGGTGGCCAGACCAGG + Intergenic
1159486250 18:69062031-69062053 TGTCTTGGCTTGGCCTGGCCTGG + Intergenic
1160388855 18:78515143-78515165 AGCCCAGGTCTGTCCTGGCCAGG + Intergenic
1160496258 18:79377571-79377593 TGCCCTGGGCTTGCCTGGCAGGG - Exonic
1160496273 18:79377636-79377658 TGCCCTGGGCTTGCCTGGCAGGG - Exonic
1160496287 18:79377702-79377724 TGCCCTGGGCTTGCCTGGCAGGG - Exonic
1160496323 18:79377833-79377855 TGCCCTGGGCTTGCCTGGCAGGG - Exonic
1160594222 18:79963213-79963235 TGCCTAGGGGTGGCGCGGCTGGG + Intergenic
1160727628 19:624604-624626 TGCCCAGGGCTCACCTGGGCTGG - Intronic
1161400343 19:4064485-4064507 GGCTTAGGCCTGGCCTGGCCTGG + Intronic
1161400775 19:4065642-4065664 GGCCTAGCGCAGGCCGGGCCCGG - Intronic
1161594312 19:5143507-5143529 TGTCTGGGGGTGGCCTGCCCTGG + Intronic
1163458015 19:17420164-17420186 CGCCGCTGGCTGGCCTGGCCTGG + Exonic
1163495332 19:17643300-17643322 TGCCCATGGCTGGCCGGGCGCGG - Intronic
1163862202 19:19748363-19748385 TGGCCAGGGATGGCCAGGCCTGG + Intergenic
1164620720 19:29694698-29694720 TGTCTGGGCCTGGCCTGGCCTGG + Intergenic
1165304709 19:34996283-34996305 TGCCCAGGTCTGACCTGTCCTGG - Intronic
1165557844 19:36650939-36650961 TTCCTAGAGCTGGCCGGGCGTGG + Intronic
1165831085 19:38730774-38730796 TCCCTAGGCCTTGCCTGGCATGG - Exonic
1166319115 19:42005629-42005651 TGCCTCGGGGGTGCCTGGCCCGG + Intronic
1166693062 19:44835727-44835749 TGCCAGGGGCTGGCCAGGCATGG - Intergenic
1166744687 19:45135625-45135647 AGCTTAGGGTGGGCCTGGCCTGG + Intronic
1166961913 19:46502171-46502193 TGCCCAGGGCGGGACTGGGCAGG - Intronic
1167410767 19:49342411-49342433 TGCCTGGGGCTGGGCTGGAGTGG - Intronic
1167538494 19:50070725-50070747 TGCCCTGGACTGGCCTGGCCTGG + Intergenic
925028092 2:625317-625339 TGCCTGGGGCTGGGGTGGGCAGG - Intergenic
925090993 2:1155982-1156004 TGTCCTGGCCTGGCCTGGCCTGG - Intronic
926244309 2:11112048-11112070 TGCAGAGAGCAGGCCTGGCCCGG + Intergenic
926290524 2:11525689-11525711 TGGGTAGGGCAGTCCTGGCCTGG - Intergenic
926801332 2:16663564-16663586 TGCCCAGGGCTGGCTTGGGAGGG + Intronic
927257348 2:21051062-21051084 TGCCTAGGGCTGGACAGGTAGGG - Intergenic
927404310 2:22750023-22750045 TGCCTTGGGATGGTCTGGCTAGG - Intergenic
927812465 2:26187638-26187660 TGAATAGGCCTGGCCTGGCGAGG - Exonic
927889678 2:26740536-26740558 TGCCGACAGCTGGCCTGGTCTGG - Intergenic
929486621 2:42360873-42360895 TGGCGGGGGCTGGCCTGGCGTGG - Intronic
929552986 2:42906077-42906099 TGCCTAGAGCTGGACTTTCCAGG - Intergenic
929822200 2:45282661-45282683 TGCCAAAGGCTGACCTGGCAGGG - Intergenic
931241999 2:60461893-60461915 TGCATAGGGCTGGGCCGGCCTGG + Exonic
932209344 2:69914669-69914691 CACTTAGGGCTCGCCTGGCCTGG + Intronic
932306579 2:70707908-70707930 TGCCTGTGGCTGGCCAGTCCTGG + Intronic
934558325 2:95299215-95299237 TTCCTGTGGCTGGCCTGGCCAGG + Intronic
935195721 2:100814535-100814557 TGCCTTGGGCTGACCTGCACTGG + Intergenic
936078542 2:109417184-109417206 TGCCTGGGGCTGGGAGGGCCTGG + Intronic
936600407 2:113889919-113889941 GGCCTGGGCCTGGCCTGGCCGGG + Intergenic
937319146 2:120950520-120950542 TGGCTTGGGCTGGCATGGCCAGG - Intronic
937445339 2:121952731-121952753 TGACTCTGGCTGGCCTGGCCAGG - Intergenic
938261956 2:129902963-129902985 TGCCTAGGGCTGGGCAGGGGGGG - Intergenic
941003849 2:160227450-160227472 TGCCTCGGGGAGGCCTGACCTGG - Intronic
946186094 2:217981189-217981211 TCCCTGGGGCTGGTCTGCCCAGG - Intronic
946407020 2:219497224-219497246 TGCCCAGAGCTGGGCTGGCGGGG - Intronic
947623193 2:231604081-231604103 CACCCAGGGGTGGCCTGGCCTGG + Intergenic
947860476 2:233354436-233354458 GGCCGAGGGCGGGCCGGGCCGGG - Intergenic
948412539 2:237775179-237775201 TACCTAGAACTGCCCTGGCCTGG - Intronic
948598045 2:239093000-239093022 TGCCGAGGGCTGGCAGGGCTGGG + Intronic
948639282 2:239364184-239364206 TGCCTCGGGCTGGCATTGCTGGG - Intronic
948879657 2:240850366-240850388 TGCCCAGGGCAGGCCCAGCCAGG + Intergenic
948879672 2:240850410-240850432 TGCCCAGGGCAGGCCCAGCCAGG + Intergenic
948879687 2:240850454-240850476 TGCCCAGGGCAGGCCCAGCCAGG + Intergenic
948879702 2:240850498-240850520 TGCCCAGGGCAGGCCCAGCCAGG + Intergenic
1168893507 20:1308885-1308907 TGCCTGAGCCTGGACTGGCCGGG - Exonic
1169164510 20:3410470-3410492 TGCCTAGGGCTGGGGTGGTTGGG - Intergenic
1169193340 20:3671080-3671102 TCCCAGGGGCCGGCCTGGCCTGG - Exonic
1170625019 20:18023711-18023733 TGCCTGGGGGTGGCATGGCAGGG - Intronic
1171852195 20:30316683-30316705 CGCCTCCGCCTGGCCTGGCCCGG + Intergenic
1172303544 20:33865863-33865885 TGCTTGGGGCTGTCCTGGGCTGG + Intergenic
1172312454 20:33929157-33929179 TGCCCAGGGCTGGCCTCTCTTGG + Intergenic
1172445432 20:34990831-34990853 CACCCAGGGCTGGCCTGGCTGGG + Intronic
1173162742 20:40664386-40664408 TGGCCTGGCCTGGCCTGGCCTGG + Intergenic
1173310681 20:41893718-41893740 GGGCTGGGGCTGACCTGGCCAGG - Intergenic
1173788559 20:45812821-45812843 TGCCTAGGGCATGGCAGGCCCGG - Intronic
1174419351 20:50389661-50389683 TGCCAAGGGAAGGCCTGGTCAGG - Intergenic
1175350932 20:58317385-58317407 TGCCCAGGGTTGGCCAGGCACGG - Intronic
1175608231 20:60328830-60328852 TGCTGAGGACTGGCCTTGCCAGG - Intergenic
1175793733 20:61758305-61758327 TGACTGGGGCTGGCCTGGCTTGG - Intronic
1175894322 20:62329375-62329397 GGCCCAGGGCTGGGCTGGGCTGG - Intronic
1175951913 20:62588068-62588090 GGCAGTGGGCTGGCCTGGCCTGG + Intergenic
1176002748 20:62840321-62840343 TGCCTGGGGCTGGCCGCGCCTGG + Intronic
1176299270 21:5090934-5090956 GGCACAGGCCTGGCCTGGCCCGG - Intergenic
1177057523 21:16326412-16326434 TGCCTCGGGCTGCCCTTTCCCGG - Intergenic
1177076118 21:16575606-16575628 GGGCTGGGGCTGGACTGGCCGGG + Intergenic
1179459910 21:41527359-41527381 AGCCTAGGGCTGGACTGGGCTGG + Intronic
1179634148 21:42696667-42696689 TGCCTAGGAAGGGCCTGGGCTGG - Intronic
1179857756 21:44171013-44171035 GGCACAGGCCTGGCCTGGCCCGG + Intergenic
1179998439 21:44984576-44984598 AGCCTGGAGCTGGCATGGCCGGG + Intergenic
1180075375 21:45459145-45459167 TTCCCAGGTGTGGCCTGGCCGGG + Intronic
1180903560 22:19392545-19392567 GTCCTAGGGCTGGCCCTGCCTGG - Intronic
1182746017 22:32606066-32606088 TGCCCAGGGCCTGGCTGGCCTGG + Intronic
1183061875 22:35341114-35341136 TGCTTAGTGCAGGCCTGGCCCGG - Intronic
1183367076 22:37412571-37412593 TGCCTGGTACTGGCCAGGCCTGG - Intronic
1183629051 22:39022218-39022240 TGCACAGGGCTGGCCTGGAAAGG + Intronic
1184089226 22:42283674-42283696 TGCCCAGCCCTGCCCTGGCCCGG + Intronic
1184103670 22:42355104-42355126 GGCCTAGGGCAGGCCAGGCCAGG - Intergenic
1184115364 22:42418842-42418864 TCCCGGGCGCTGGCCTGGCCTGG + Intronic
1184229862 22:43152549-43152571 TGCCTCAGGCTGCCCTGTCCCGG - Intronic
1184276766 22:43413094-43413116 TCCCCAGTGCTGGGCTGGCCTGG + Intronic
1184309402 22:43631500-43631522 GGCCTAAGCCTGGGCTGGCCAGG - Intronic
1184974580 22:48051979-48052001 TAACCTGGGCTGGCCTGGCCGGG - Intergenic
1185370044 22:50456723-50456745 TACCTGGGGCTGGCTGGGCCCGG + Intronic
950719232 3:14870666-14870688 TGCGTAGGGCTGGCCATGGCTGG - Intronic
950831186 3:15877928-15877950 TGCCGCGGGCTGGGCAGGCCAGG - Intergenic
951132298 3:19062261-19062283 TGACTTGGGCTGGGATGGCCAGG + Intergenic
951187477 3:19730505-19730527 TGGCCTGGCCTGGCCTGGCCTGG + Intergenic
952744442 3:36764203-36764225 AGGCTGGGGCTGGCCGGGCCGGG + Intergenic
952898555 3:38095183-38095205 AGCCAAGTGCTGGCCTGGGCAGG - Intronic
952962064 3:38598510-38598532 TGCCTAGGGCAGGAATGGCTGGG + Intronic
952965294 3:38617353-38617375 GGCCCTTGGCTGGCCTGGCCTGG - Intronic
952966752 3:38625774-38625796 TGCCTCTGGCTGGGCTGGGCAGG + Intronic
953711254 3:45273039-45273061 AGCCCAGGGCTGGAGTGGCCTGG - Intergenic
954068311 3:48124632-48124654 TGGCCTGGCCTGGCCTGGCCTGG + Intergenic
959320372 3:104866480-104866502 TGGCAAGGGCAGGCCTGGCATGG - Intergenic
959492529 3:107007700-107007722 TGCCTAAGTCTGGCCAGGCATGG + Intergenic
960803473 3:121561336-121561358 TGCCCAGGGTTGGCCGGGCGTGG + Intergenic
961058744 3:123810701-123810723 TGCCTGTGGCAGGACTGGCCGGG + Intronic
963123885 3:141797764-141797786 TCCCTTGGGGTGGCCGGGCCAGG - Intronic
965132813 3:164723485-164723507 TGCCTATCCCTGCCCTGGCCTGG - Intergenic
965298361 3:166977622-166977644 TGCCTAGAGCTGGAGTGGCCAGG - Intergenic
966884935 3:184372195-184372217 TGCAAAGGCCTGGGCTGGCCTGG - Exonic
967278057 3:187795751-187795773 TGGCTTGGTCTGGCCTGGCCAGG - Intergenic
968045611 3:195622504-195622526 TGTTGAGGCCTGGCCTGGCCTGG + Intergenic
968045652 3:195622621-195622643 TGTTGAGGCCTGGCCTGGCCTGG + Intergenic
968045667 3:195622660-195622682 TGTTGAGGCCTGGCCTGGCCTGG + Intergenic
968064364 3:195750386-195750408 TGTTGAGGCCTGGCCTGGCCTGG + Intronic
968064379 3:195750425-195750447 TGTTGAGGCCTGGCCTGGCCTGG + Intronic
968308989 3:197667427-197667449 TGTTGAGGCCTGGCCTGGCCTGG - Intergenic
968309003 3:197667466-197667488 TGTTGAGGCCTGGCCTGGCCTGG - Intergenic
968457274 4:706092-706114 TGCCAAGGGCTTCCCGGGCCAGG - Intronic
968612249 4:1562647-1562669 AGCCCAGGGCTGGCGTGGGCCGG + Intergenic
968811317 4:2800790-2800812 TGTCTTGGGGTGACCTGGCCGGG + Intronic
968897909 4:3415559-3415581 CGCCTTGGCCTGGCCCGGCCTGG + Intronic
968905714 4:3449711-3449733 GGCCTGGGGCTGGCCTGGGAGGG - Intergenic
968962518 4:3752772-3752794 TGCCTGAGCCTGGCCTGGCAGGG + Intergenic
969695919 4:8734820-8734842 TGGAGAGGCCTGGCCTGGCCAGG + Intergenic
972532810 4:39976789-39976811 AGCCTGGGGCTGGCAGGGCCGGG - Intronic
975373589 4:73615862-73615884 TGCCTAGAGGTGGGCTTGCCTGG + Intronic
975661872 4:76696579-76696601 TGTCATAGGCTGGCCTGGCCTGG + Intronic
976180141 4:82391089-82391111 TGCCAAAGGCTGGCCGGGCGCGG - Intergenic
977706814 4:100080742-100080764 TGCCTAGAGCTGCTCTGGGCAGG - Intergenic
982374296 4:154672746-154672768 TGCCTAGGGCTGCACAGCCCAGG - Intronic
983216381 4:165006734-165006756 TGCGGAGGCCTGGCCTGACCTGG - Intergenic
984815279 4:183830573-183830595 TGCCCAGGGCTGGTCTGGCCTGG + Intergenic
985493635 5:193029-193051 TGCCTGAGGCTGCCTTGGCCTGG - Intronic
985655393 5:1129129-1129151 TGCCTAGGGCCTGCCAGGCCAGG + Intergenic
986156334 5:5180051-5180073 TGCATGGGGCTGGGCTGTCCTGG - Intronic
986518796 5:8591944-8591966 TGCCCAGGGCTGGCTTAGGCAGG - Intergenic
986646625 5:9922576-9922598 TGCCTCAGGCTGGCCAGGGCTGG - Intergenic
986794941 5:11200967-11200989 AGCCTGGGGATGGCCTGGCACGG - Intronic
989952549 5:50316844-50316866 TGCTTAGGACCGGCCAGGCCTGG + Intergenic
993904124 5:93604325-93604347 GGCCTCGGGCTGGCCGCGCCGGG + Intergenic
994425941 5:99587248-99587270 TGCCTAGAGCTGAGCTGGCAGGG + Intergenic
995783936 5:115808267-115808289 AGCCTAGGGCTGGCCGGGTGTGG - Intronic
996724668 5:126663825-126663847 TGCAAAGGGCTGGTCTGGCCGGG - Intergenic
997519165 5:134511614-134511636 TGCCTAGAGCTGGCCTAGCTGGG + Intergenic
998399910 5:141843265-141843287 TGCCCCAGGCTGGGCTGGCCAGG - Intergenic
1001102570 5:168826284-168826306 TGCTTGGGGCTGGCCAGCCCGGG + Intronic
1001474756 5:172042600-172042622 TTCCCAACGCTGGCCTGGCCTGG + Exonic
1002319187 5:178364921-178364943 TGCCTGGGGCTGAACTGGCTTGG + Intronic
1002355767 5:178627400-178627422 CGCCTAGGGCGGGCCTTGGCTGG + Intronic
1002506248 5:179681090-179681112 TGTCCTGGGGTGGCCTGGCCTGG - Intronic
1002651327 5:180697951-180697973 TGCCTGTGGCTGGAGTGGCCAGG + Intergenic
1003479272 6:6516409-6516431 TGCACAGGGCAGGCCTGGACAGG - Intergenic
1005998257 6:30945339-30945361 TGGCCTGGCCTGGCCTGGCCTGG - Intronic
1006770345 6:36547554-36547576 TGCCTAGGGCTGGCTGGACCTGG + Intergenic
1007383509 6:41505106-41505128 TGCCCAGGGCGGCCTTGGCCGGG - Intergenic
1007538791 6:42621749-42621771 TGGCCAAGGCTGGCCTGGCGCGG - Intronic
1011781437 6:90794330-90794352 TGCCAAGTGCTGACCAGGCCTGG + Intergenic
1012804779 6:103879726-103879748 TGCCCAGGGCTTGTCTGGTCAGG + Intergenic
1013487768 6:110614497-110614519 TGCTCTGGGCTGGGCTGGCCTGG + Exonic
1014057256 6:117030562-117030584 ACCCCAGGGCTGGGCTGGCCTGG - Intergenic
1015257788 6:131199607-131199629 TGCTTATGGCTGGTGTGGCCTGG - Intronic
1017430650 6:154367301-154367323 GGCCTGGAGCCGGCCTGGCCAGG - Intronic
1017461299 6:154653473-154653495 TGTGTTGTGCTGGCCTGGCCAGG - Intergenic
1017878791 6:158545336-158545358 TGCCTGGGACTGGCCTCCCCTGG + Intronic
1018028231 6:159822128-159822150 TGCCTAGGGCAGCCCTGAGCTGG + Intergenic
1018134288 6:160764583-160764605 TGCTCTGGCCTGGCCTGGCCTGG - Intergenic
1018292597 6:162308016-162308038 TGCATAGGCCAGGCATGGCCAGG - Intronic
1018752894 6:166822552-166822574 TGTCTAGGGCTGCCCTGACAGGG - Intronic
1018902575 6:168058856-168058878 TGCCTGGGGCTGGGGTGGCCGGG - Intronic
1019316725 7:390390-390412 TGGCCAGGGAGGGCCTGGCCGGG + Intergenic
1019509140 7:1408520-1408542 TGCCTATGGGTGACATGGCCTGG - Intergenic
1020014551 7:4823532-4823554 TGCATTGGGCTGGCCAGGCAGGG - Intronic
1020083162 7:5297123-5297145 TGCCCAGGCCTGGCCTGCCCCGG - Exonic
1021537984 7:21726569-21726591 TGCCTAGTGATGGCCAGGCGCGG + Intronic
1022446100 7:30471914-30471936 TGCCGTGGGCTGGGCAGGCCTGG + Intronic
1023674725 7:42617513-42617535 TGCCTGGGGCTGAGCAGGCCTGG - Intergenic
1023860553 7:44215616-44215638 TTCCTGGGGGAGGCCTGGCCTGG + Intergenic
1025211121 7:57020064-57020086 TGCCCAGGCCTGGCCTGCCCCGG + Intergenic
1025251597 7:57354822-57354844 TGCCAAGGGAAGGCCTGGTCAGG + Intergenic
1025660834 7:63556783-63556805 TGCCCAGGCCTGGCCTGCCCCGG - Intergenic
1026638427 7:72104303-72104325 TGCCTAGGGCTTGCAGGGACAGG + Intronic
1026849026 7:73713407-73713429 TGTCTTGGGCTGGCCAGGGCGGG + Intronic
1026874724 7:73872537-73872559 TGCCTGGTGGTGGCCTGGACAGG + Intergenic
1026878121 7:73891410-73891432 TGCTGAGGGCTGGGATGGCCAGG + Intergenic
1027222902 7:76225409-76225431 TGCCTCTGGCTGGCAAGGCCAGG + Intronic
1028894103 7:96021670-96021692 TGCCTAGGGCTGGGCTTGGAAGG - Intronic
1029585208 7:101466370-101466392 TGCCTAGTGCTGGGCAGGTCGGG - Intronic
1031806843 7:126317197-126317219 TGCCTAGAGCTGGAGTGGCTGGG + Intergenic
1032994817 7:137433164-137433186 TGCTTAGGTCTGGACTGTCCTGG - Intronic
1033448425 7:141441588-141441610 TGCCTGGAGCTGGCCAGGCCTGG + Intronic
1033882559 7:145903103-145903125 TGACTAGGGCTGGCTAGGGCTGG + Intergenic
1034417226 7:150971523-150971545 TACCTCTGACTGGCCTGGCCTGG - Intronic
1034873749 7:154706473-154706495 TGACTAGGAGTGGCCTGGCCAGG - Intronic
1035117098 7:156533694-156533716 TCCCCAGGGCTGGCCTGGCATGG - Intergenic
1035244391 7:157552807-157552829 TGCCTATGCTGGGCCTGGCCGGG + Intronic
1035266812 7:157693682-157693704 TGCCCGGAGCCGGCCTGGCCGGG - Intronic
1035684966 8:1517299-1517321 TGCCTAGGTCTGGCCACTCCAGG - Intronic
1037797451 8:22008424-22008446 GGGCTAGGGTTGGCCTGGACAGG - Intergenic
1038870691 8:31489968-31489990 TCCCCAGGGCTGGCAGGGCCAGG - Intergenic
1040292419 8:46132248-46132270 CCCCCAGGGCTGTCCTGGCCTGG - Intergenic
1040295829 8:46148591-46148613 TCCCCAGGGCTGTCCTGGTCGGG - Intergenic
1040312935 8:46246127-46246149 TCCCCAGGGCTGTCCTGGGCAGG + Intergenic
1040314608 8:46254387-46254409 TTCCCAGGGCTGTCCTGGACGGG + Intergenic
1040388794 8:46932631-46932653 TGCCTGGGCTGGGCCTGGCCTGG + Intergenic
1040839765 8:51772538-51772560 TCCTCAGGGCTGACCTGGCCTGG - Intronic
1044992051 8:97804794-97804816 TGGCCTGGCCTGGCCTGGCCTGG + Intronic
1044992053 8:97804799-97804821 TGGCCTGGCCTGGCCTGGCCTGG + Intronic
1045028687 8:98115095-98115117 TGCCTGGTGCTGGCCAGGCATGG + Intronic
1045110993 8:98939818-98939840 CGCCCAGGGCGGGACTGGCCCGG - Intronic
1045569320 8:103353189-103353211 TAACTAGGACTGGCCTGGTCAGG - Intergenic
1046055266 8:109071238-109071260 TCTCTGGGGCTGGCCTGGGCTGG - Intergenic
1048592915 8:135838038-135838060 TGGCAAGGGCTGGCAGGGCCAGG + Intergenic
1049591353 8:143464412-143464434 GGCCAAGGGTTGGCCAGGCCGGG - Intronic
1049646457 8:143738016-143738038 TGCCTGTGGCTGCTCTGGCCTGG + Intergenic
1049791915 8:144476043-144476065 TGCCTTTGGGTGGCCAGGCCCGG + Exonic
1049800813 8:144516746-144516768 GGCCCAGGGCTGGTCCGGCCTGG + Exonic
1049936387 9:504829-504851 TGCCTCGGGCTGGCCCCGCGCGG + Intronic
1049946242 9:598920-598942 TACCTAGGGATGGCCGGGCATGG - Intronic
1057229234 9:93308807-93308829 AGCCCTGGCCTGGCCTGGCCTGG - Intronic
1057454043 9:95191292-95191314 TGACTGGGGCTGGGCTGGGCTGG - Intronic
1058596984 9:106625541-106625563 AGTCTCTGGCTGGCCTGGCCTGG + Intergenic
1060545034 9:124454506-124454528 TGCCCAGTCGTGGCCTGGCCAGG + Exonic
1060777689 9:126388201-126388223 TGCCTAGGGCTGGCGGGGAGTGG - Intronic
1060821856 9:126665788-126665810 TGCCCCGGGCTGGCATGGGCTGG - Intronic
1061180532 9:129022738-129022760 ACCCTAGGGCTGGCCTCCCCAGG - Intronic
1061824038 9:133246882-133246904 TGTGAAGGGCAGGCCTGGCCCGG - Intergenic
1061925961 9:133806207-133806229 AGCCTTGGGTGGGCCTGGCCAGG - Intronic
1061975990 9:134068206-134068228 GGCCGAGAGCGGGCCTGGCCCGG + Intronic
1062020837 9:134318698-134318720 CGCGAAGGGCTGGCCTGGGCTGG + Intronic
1062028361 9:134350834-134350856 AGCCTGGGGCCGGCCTGGCCTGG + Intronic
1062309712 9:135929249-135929271 AGCCCAGGGCTGGCAGGGCCAGG - Intergenic
1062321540 9:135992753-135992775 GGCCGAGGGCTGGGCTGCCCCGG - Intergenic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1062541761 9:137044666-137044688 TGCCTAGGGAGGGCCCTGCCAGG + Intronic
1062548061 9:137072605-137072627 GGGCCATGGCTGGCCTGGCCTGG - Intergenic
1062554147 9:137106447-137106469 TGCCTGGGCCAGGCCTGGCACGG - Intronic
1062716882 9:138015172-138015194 CGCCTCGGGCTGGCTTGGGCCGG - Intronic
1187882386 X:23859374-23859396 TGCCTAGGGCTGGACGGTACGGG - Intronic
1188497648 X:30796347-30796369 TGCCTTGGCCTTGCCTTGCCTGG + Intergenic
1189745199 X:44161618-44161640 TGCCAAGGACTGGCCTGGGCAGG + Intronic
1190114853 X:47619750-47619772 GTCCTAGGGGTGGTCTGGCCAGG + Exonic
1190246639 X:48695284-48695306 TGCCTAGGACTGGCTGGGGCTGG + Intergenic
1190278460 X:48914115-48914137 ACCCTAAGCCTGGCCTGGCCTGG - Exonic
1190310990 X:49116966-49116988 TTCCTAGGGGTGGCAGGGCCTGG - Intronic
1190335356 X:49258473-49258495 GGCCGAGGGCTTGCCAGGCCTGG + Exonic
1190731940 X:53232391-53232413 TGGATGTGGCTGGCCTGGCCTGG - Intergenic
1193509482 X:82382395-82382417 GCCCTGGGGCTGGCCTGCCCAGG - Intergenic
1196445666 X:115844871-115844893 CGTCTAAGGGTGGCCTGGCCGGG - Intergenic
1196446337 X:115847852-115847874 CGTCTAAGGGTGGCCTGGCCGGG - Intergenic
1196447008 X:115850833-115850855 CGTCTAAGGGTGGCCTGGCCGGG - Intergenic
1196447677 X:115853816-115853838 CGTCTAAGGGTGGCCTGGCCGGG - Intergenic
1196448347 X:115856795-115856817 CGTCTAAGGGTGGCCTGGCCGGG - Intergenic
1196449016 X:115859786-115859808 CGTCTAAGGGTGGCCTGGCCGGG - Intergenic
1196449687 X:115862777-115862799 CGTCTAAGGGTGGCCTGGCCGGG - Intergenic
1196450356 X:115865760-115865782 CGTCTAAGGGTGGCCTGGCCGGG - Intergenic
1196451026 X:115868745-115868767 CGTCTAAGGGTGGCCTGGCCGGG - Intergenic
1196451697 X:115871724-115871746 CGTCTAAGGGTGGCCTGGCCGGG - Intergenic
1196452368 X:115874711-115874733 CGTCTAAGGGTGGCCTGGCCGGG - Intergenic
1196453038 X:115877680-115877702 CGTCTAAGGGTGGCCTGGCCGGG - Intergenic
1196453708 X:115880673-115880695 CGTCTAAGGGTGGCCTGGCCGGG - Intergenic
1196454377 X:115883682-115883704 CGTCTAAGGGTGGCCTGGCCGGG - Intergenic
1197978015 X:132185822-132185844 TACCTAGGACTGGCATTGCCAGG - Intergenic
1198212591 X:134529770-134529792 TGCCAATGGGTAGCCTGGCCTGG - Intergenic
1198799306 X:140432886-140432908 TGGGTAGGGCTACCCTGGCCTGG - Intergenic
1200141162 X:153903809-153903831 TGCCTTGGGCTGGGCTGGGCTGG + Intronic
1200418137 Y:2934998-2935020 TGGCAGGGGGTGGCCTGGCCCGG + Intergenic