ID: 1126497812

View in Genome Browser
Species Human (GRCh38)
Location 15:49311945-49311967
Sequence GCCCCCGGCCCAATCTCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126497812_1126497816 18 Left 1126497812 15:49311945-49311967 CCCTGAGAGATTGGGCCGGGGGC 0: 1
1: 0
2: 0
3: 8
4: 98
Right 1126497816 15:49311986-49312008 GCTCATTAAGCCCCCTTTATTGG 0: 1
1: 0
2: 0
3: 7
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126497812 Original CRISPR GCCCCCGGCCCAATCTCTCA GGG (reversed) Intronic
900477352 1:2882220-2882242 GACCCAGGCCAACTCTCTCAAGG + Intergenic
900532021 1:3159130-3159152 TCCCCCAGCCCAAGGTCTCAAGG - Intronic
903128256 1:21262187-21262209 GCCCCTGACCCTGTCTCTCAAGG - Intronic
903628145 1:24745756-24745778 GCCCCCGGCCCATTGTCTGGGGG + Intronic
903812540 1:26042868-26042890 GCGCTGGGCCCTATCTCTCATGG - Intronic
907400148 1:54220249-54220271 GCCTCCGTCCCACTCGCTCAGGG - Intronic
910713501 1:90205505-90205527 GCCCCCGTCCCCATCACTCATGG + Intergenic
913671169 1:121098085-121098107 GCCCACGGCCCATCCTATCACGG + Intergenic
914022939 1:143885506-143885528 GCCCACGGCCCATCCTATCACGG + Intergenic
914661426 1:149793450-149793472 GCCCACGGCCCATCCTATCACGG + Intronic
915068625 1:153246863-153246885 CCCCCCCCCCCATTCTCTCATGG + Intergenic
1063244248 10:4202015-4202037 GCCACCAGCACAATCTCTCCAGG - Intergenic
1073110596 10:101061231-101061253 GCCCCCGGCCCAAAGTGCCACGG + Intergenic
1073473889 10:103740479-103740501 GCCCCAGGCCCTGGCTCTCATGG - Intronic
1076722930 10:132400581-132400603 TCCCCAGGCCAACTCTCTCAGGG - Intronic
1078329440 11:10407778-10407800 GCCCCCGGCCCCATCCCTCTTGG + Intronic
1084160170 11:67344078-67344100 GCACCTGGCCCAGTCTCTTATGG + Intronic
1084208221 11:67608332-67608354 GCTTCTGGCCCAATCCCTCATGG + Intronic
1085477443 11:76797074-76797096 GCCCATGGCCCAGTCACTCAGGG + Exonic
1085507005 11:77066594-77066616 AGCCCCGGCCCGATCCCTCACGG + Intergenic
1090284351 11:125486351-125486373 CCTCCAGGCCCAATCTCTTATGG + Intronic
1091277409 11:134361916-134361938 GCCCCCGGCCAAGTTCCTCAGGG + Intronic
1098313530 12:69170741-69170763 GCCACAGTCCCAAGCTCTCAAGG - Intergenic
1098805941 12:75020206-75020228 GCCCCCAGCCCCATCGCTCCTGG - Intergenic
1103800522 12:123534187-123534209 GCCCCCGGCCCCCTCTCCCGGGG - Intergenic
1104856251 12:131903803-131903825 GCCCCCTGCCCACTCCCTCCTGG + Intronic
1113888196 13:113672009-113672031 GCCCCCCACGCACTCTCTCAGGG - Intronic
1114615019 14:24063628-24063650 GACTCCTGCCCAATCCCTCAAGG - Intronic
1122342028 14:101034731-101034753 GCCCCCGCCCCACTCTTTCTAGG + Intergenic
1123000685 14:105292637-105292659 GTCCCCGTCCCCAGCTCTCAGGG - Intronic
1123035262 14:105469365-105469387 GGCCCCGGCCCATTGTCCCAAGG + Intronic
1124603330 15:31152165-31152187 GCCCTGGGCCCCATCCCTCAAGG + Intronic
1126497812 15:49311945-49311967 GCCCCCGGCCCAATCTCTCAGGG - Intronic
1127043132 15:54999044-54999066 GCCCCAGGACCATTCTCTAAAGG + Intergenic
1127177885 15:56381574-56381596 GCCCCCTGCCCAATATCACTAGG + Intronic
1132840424 16:1976123-1976145 GCCCCTGCCCCTACCTCTCAGGG - Intronic
1137056384 16:35748370-35748392 GCCTCCAGCCCAGTCTCTCCAGG - Intergenic
1137613808 16:49835519-49835541 GCCCCCAGCCCTGTCTCTGAGGG - Intronic
1138489171 16:57366220-57366242 GCCCCCTGCCCCATCTCACAGGG - Intergenic
1138549751 16:57740865-57740887 CCCCCATGCCCACTCTCTCATGG + Intronic
1141552671 16:84816660-84816682 GCCCTCTGCCCACTCTCTCTTGG - Intergenic
1142165220 16:88583069-88583091 GCCCCGGGCCCAACCTGGCACGG - Intronic
1142251132 16:88992572-88992594 GCCCCCTGCCCAGTATCTCTCGG - Intergenic
1143584723 17:7845393-7845415 GCCCCCTGCCCCAGCTCTCTGGG - Exonic
1143675697 17:8430889-8430911 GCCCCTGGGCCCATCTCCCAGGG + Intronic
1155314532 18:24558395-24558417 GCCCCCAGCCGAATTTCTCTGGG + Intergenic
1160555617 18:79723208-79723230 GCCCCAGGCCTCATCTGTCACGG + Intronic
1161026737 19:2040440-2040462 GCCCCAAGCCCCATCTCTCCCGG + Intronic
1163157058 19:15445377-15445399 GCCACCGACCCAGTCTCGCAGGG + Intronic
1165808618 19:38596907-38596929 GGCCCCGCCCCAATCTCCCGAGG - Intronic
1168688306 19:58361915-58361937 GCCCCCAGCCGCATCTATCAGGG + Intronic
946194997 2:218027593-218027615 GCCCTCGGCACATTGTCTCAGGG + Intergenic
947520853 2:230845011-230845033 GCCCCCATCCCAATCTTTAATGG + Intergenic
947542792 2:230990392-230990414 GGCCCCGGCCCAGTCTGTCGAGG + Intergenic
1168818986 20:760993-761015 GACCCCGCCCCCATCGCTCACGG - Exonic
1171522149 20:25784047-25784069 GCTCTCGGTCCAGTCTCTCATGG - Intronic
1171554678 20:26071836-26071858 GCTCTCGGTCCAGTCTCTCATGG + Intergenic
1173353035 20:42262378-42262400 GCCCCCAGCCCAACCTCTTTTGG + Intronic
1174151281 20:48488394-48488416 GCCCCCTGCCCTATCCCTAAAGG + Intergenic
1181032305 22:20154477-20154499 GCCCCTGCCCCATTCACTCAGGG - Intergenic
1181032324 22:20154561-20154583 GCCCCTGCCCCACTCACTCAGGG - Intergenic
1181032347 22:20154641-20154663 GCCCCCGCCCCACTCACTCAGGG - Intergenic
1181465906 22:23110478-23110500 GCCCACTGCCCTGTCTCTCAGGG + Intronic
1181511036 22:23388833-23388855 GCCCCCACCCCACTCACTCAGGG + Intergenic
1181511060 22:23388913-23388935 GCCCCCGCCCCACTCACTCAGGG + Intergenic
1181511072 22:23388956-23388978 CCCCCCGCCCCACTCACTCAGGG + Intergenic
1181511085 22:23388998-23389020 GCCCCCGCCCCACTCACTCAGGG + Intergenic
1181511098 22:23389040-23389062 GCCCCCGCCCCACTCACTCAGGG + Intergenic
1181511159 22:23389251-23389273 GGCCCCGCCCCACTCACTCAGGG + Intergenic
1182421181 22:30249274-30249296 GCCCCCGGCCGGCTCCCTCATGG + Intergenic
1183347769 22:37317414-37317436 TCACCTGGCCCAACCTCTCAGGG - Intergenic
1184011368 22:41751156-41751178 CCTCTTGGCCCAATCTCTCAGGG - Intronic
1184454361 22:44600814-44600836 GCCACCAGCCCACTCTCTCCAGG + Intergenic
954662588 3:52234071-52234093 GACCCCTGCCCAGTCTCTGAGGG + Intronic
959562248 3:107796015-107796037 GCCCCTGGCCAGATCTCTGATGG + Intronic
960055631 3:113274527-113274549 GCCCCCTGCCCCTTCTCTCCTGG - Exonic
966947431 3:184786925-184786947 GCCCCCTGCCCAGACTCTCCTGG + Intergenic
969662398 4:8537939-8537961 GACCCCGGCCCAATTGCCCAGGG + Intergenic
980081605 4:128350545-128350567 GCCCCAGACCCAATCACACAGGG + Intergenic
986521849 5:8627767-8627789 GCTCCCGGCCCAAGATCTGATGG - Intergenic
987687558 5:21225339-21225361 GCTCCCGACACAGTCTCTCACGG - Intergenic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
991353554 5:65745191-65745213 GCCCCTGCAGCAATCTCTCAGGG + Intronic
998094216 5:139388246-139388268 GCCCCTGGCCCAAGGTCACAAGG + Intronic
999217051 5:149944165-149944187 GCCCCATGCCCTCTCTCTCATGG + Intronic
999254764 5:150204165-150204187 CTCCCCGGCCCTATCTCCCAAGG + Intronic
1007284233 6:40736357-40736379 GCCCCTGCCCCCATCTCCCAGGG + Intergenic
1011194359 6:84766515-84766537 ACTCCCGGCCCAAACTCTCTAGG - Intergenic
1015020362 6:128465915-128465937 GCTCTCGGCCCATTGTCTCATGG + Intronic
1016461763 6:144285870-144285892 GCCCCCGCCCCATTCCCTCGGGG - Intronic
1024738917 7:52334858-52334880 GCCCCAGGCCCCATTGCTCAAGG - Intergenic
1035581106 8:739256-739278 GCCCCAGGCCCGACCTCTCCGGG - Intergenic
1041013003 8:53561959-53561981 GCCCCAGCCCCAATCTCTTCTGG - Intergenic
1041414404 8:57591628-57591650 GCCCTTGGCCTGATCTCTCATGG + Intergenic
1043111878 8:76195572-76195594 GCCCACTGCCCAATGTCTCATGG - Intergenic
1045183283 8:99809965-99809987 GACCCAGGCCCACTCTGTCATGG - Intronic
1049179861 8:141216693-141216715 CACCCCGGCCCCATCCCTCAGGG + Intronic
1049487399 8:142873704-142873726 GCCCCAGGCCTCATCTTTCATGG - Exonic
1052867545 9:33473829-33473851 GGCGCCGGCCCCATCACTCAGGG + Exonic
1053004321 9:34594080-34594102 GCCCCCAGCCCAGTGTCTCCAGG + Intergenic
1060993541 9:127862444-127862466 GCCTCCGGCCCAGGCCCTCAGGG + Intergenic
1061778890 9:132984369-132984391 GCCCACGGCCTTATCTCCCAGGG - Intronic
1192191347 X:68993190-68993212 GCCCCTGGCCCTAACTCGCAGGG - Intergenic
1195138135 X:101931635-101931657 GCGCCCAGCCCAATCTCGGACGG + Intronic
1196537390 X:116863272-116863294 TCCCCCGGTCCACTCTCTCTGGG + Intergenic
1200050260 X:153425629-153425651 GCCCCCAGCCCAACACCTCATGG - Intergenic
1202062723 Y:20904461-20904483 GCCCCAGATCCCATCTCTCAGGG - Intergenic