ID: 1126499632

View in Genome Browser
Species Human (GRCh38)
Location 15:49330952-49330974
Sequence TTGTTGTTGTTGTTGAAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6832
Summary {0: 7, 1: 215, 2: 477, 3: 1242, 4: 4891}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126499632 Original CRISPR TTGTTGTTGTTGTTGAAACA GGG (reversed) Intronic
Too many off-targets to display for this crispr