ID: 1126499649

View in Genome Browser
Species Human (GRCh38)
Location 15:49331144-49331166
Sequence CTTGACATGCTGAAAGTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 221}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126499646_1126499649 11 Left 1126499646 15:49331110-49331132 CCAATGGGATTGCTCTAGATTTT 0: 1
1: 0
2: 0
3: 14
4: 130
Right 1126499649 15:49331144-49331166 CTTGACATGCTGAAAGTAAAAGG 0: 1
1: 0
2: 0
3: 24
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126499649 Original CRISPR CTTGACATGCTGAAAGTAAA AGG Intronic
902357806 1:15918929-15918951 ATTGACATTAAGAAAGTAAATGG + Exonic
903508594 1:23856311-23856333 CTTGACAGGCTGAGTGTACAGGG - Intronic
903728223 1:25468689-25468711 CTTGAGAGCCTGAAAGGAAATGG + Intronic
904149637 1:28426881-28426903 CTGGACATGCTGAACTTAAAAGG - Intronic
905347897 1:37323818-37323840 CTTGCCATGCTTAAAGTTGAGGG + Intergenic
906898380 1:49805588-49805610 CTTGAGTAGCTGAAATTAAATGG + Intronic
907586087 1:55619386-55619408 CTTGGCATGATAAAAGTAATGGG - Intergenic
907768609 1:57437128-57437150 CTTCAGATGGTGAAAGTGAATGG + Intronic
908695885 1:66841305-66841327 CCTGACCAGCTAAAAGTAAATGG + Intronic
909116210 1:71540625-71540647 TTTGACATGCTGAATCTAAAAGG + Intronic
910350968 1:86297269-86297291 CTAAACATGATGAGAGTAAAGGG - Intergenic
910370519 1:86510721-86510743 CCAGACATCATGAAAGTAAAAGG - Intergenic
910778262 1:90898199-90898221 CTTGAGATCCTAATAGTAAAGGG + Intergenic
910973355 1:92879586-92879608 AATGGCATGCTGAAAGAAAAAGG - Intronic
911515053 1:98857787-98857809 ATAGATATGTTGAAAGTAAAAGG - Intergenic
911704534 1:100995880-100995902 CTTTACATGCTGAAAACAAATGG + Intronic
912159986 1:106970562-106970584 CATGATATGATGAAAGAAAAAGG - Intergenic
914837045 1:151215897-151215919 CTTATCATGCTGTAAGCAAATGG + Intronic
914906225 1:151747342-151747364 ATGGGCAGGCTGAAAGTAAAAGG - Intergenic
915041318 1:152970463-152970485 CTTGGAATGCTGAAAATATATGG + Intergenic
916439644 1:164810550-164810572 CTGCACAAGCTGAAAGAAAAGGG - Intronic
918373877 1:183889005-183889027 TTTAAAATGCTGAAACTAAAAGG - Intronic
919842176 1:201617601-201617623 CTTGACTAGCTGAAACTATAAGG - Intergenic
922031287 1:221802051-221802073 GTTGGCATGGGGAAAGTAAATGG + Intergenic
923252709 1:232192038-232192060 CTACAGATGGTGAAAGTAAAAGG + Intergenic
923587935 1:235291853-235291875 ATTTACAAGCTGAAAGTAAAGGG + Intronic
1063181887 10:3609247-3609269 TCTGATATGCTCAAAGTAAAGGG + Intergenic
1063736270 10:8758755-8758777 CTAAACATGCTGAAAATATATGG + Intergenic
1064527410 10:16271944-16271966 CTGGTCATGCTGAAAATACAAGG - Intergenic
1064798527 10:19041413-19041435 CTTGAGCTGCTCAAAATAAATGG + Intergenic
1066178247 10:32933369-32933391 TTTAACATACTGAAAGCAAAGGG - Intronic
1068055721 10:52011063-52011085 CTTGGCATTCTGAAATTAAATGG - Intronic
1071064694 10:81616765-81616787 CTCGATAGACTGAAAGTAAAAGG + Intergenic
1078924023 11:15858056-15858078 CTAGATATCCTGAAAGTGAATGG - Intergenic
1079866047 11:25735517-25735539 CTTGACATGCTAAAACAGAAAGG + Intergenic
1081885045 11:46487937-46487959 CTAAACAGGCTGAAAGTAAAAGG + Intronic
1082138524 11:48578830-48578852 CTAAAAATGATGAAAGTAAAGGG + Intergenic
1086561394 11:88173832-88173854 GTTCACATGCTAAAAGAAAAAGG + Intronic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1087066684 11:94034026-94034048 CTTAAAATGCTGAAAGGACATGG + Intronic
1087177549 11:95109326-95109348 CTTGATCTGCTGCAAGGAAAAGG - Intronic
1087608910 11:100410068-100410090 TTTGACAAGCTGAGAGAAAAAGG + Intergenic
1088079469 11:105893566-105893588 GTTCTTATGCTGAAAGTAAAGGG - Intronic
1089782388 11:120882775-120882797 CCTGTCATCCTGAAAGCAAATGG - Intronic
1090906685 11:131082817-131082839 CCTGATAGGTTGAAAGTAAAAGG - Intergenic
1091372373 11:135071694-135071716 CTTTACATGGTGAGAGAAAAGGG + Intergenic
1093493323 12:19728206-19728228 CAGGACATACTGAGAGTAAAAGG + Intergenic
1093815696 12:23543632-23543654 TTTGAGCTGTTGAAAGTAAATGG - Intronic
1095532318 12:43202938-43202960 CTTGAAGTGCAGAAAGTAAGTGG + Intergenic
1096733809 12:53636557-53636579 ATTTATAGGCTGAAAGTAAAAGG - Intronic
1098155659 12:67595366-67595388 CTTGACATTCTAAAAGAAATAGG - Intergenic
1098575265 12:72034826-72034848 CTTGTCTTGCTTATAGTAAATGG + Intronic
1101262511 12:103047375-103047397 CTAAACATGCTGTAAGGAAATGG - Intergenic
1102884527 12:116511506-116511528 CGTGCCCTGCTGAAAGTCAAGGG - Intergenic
1105880745 13:24604616-24604638 ATCCACAGGCTGAAAGTAAAGGG - Intergenic
1106295388 13:28408840-28408862 CTTGGCATGCTGTATGCAAATGG - Intronic
1106531568 13:30597886-30597908 CTTGGAATGCTGAAAGAAAAAGG - Intronic
1106741373 13:32646638-32646660 GGATACATGCTGAAAGTAAAAGG - Intronic
1106969992 13:35128022-35128044 TTTGAAAGGTTGAAAGTAAAAGG + Intronic
1107484829 13:40815745-40815767 ATCCACAGGCTGAAAGTAAAGGG + Intergenic
1109807187 13:67458592-67458614 CTTGATATGCTAAACATAAAGGG - Intergenic
1112204727 13:97313496-97313518 CTTGACATTGTGAGATTAAATGG + Intronic
1112233135 13:97608801-97608823 CTTGACAAGCTGAGAGAAGAAGG + Intergenic
1113065006 13:106364173-106364195 AGTGACTTGCTCAAAGTAAATGG - Intergenic
1113286559 13:108855622-108855644 CTTCAAATGTTGCAAGTAAAGGG + Intronic
1114395937 14:22361320-22361342 ACTCACATGCTCAAAGTAAAGGG - Intergenic
1115021656 14:28688213-28688235 CTCAACTTGCTCAAAGTAAAGGG - Intergenic
1115890945 14:38028122-38028144 TTTAATATGGTGAAAGTAAATGG - Intronic
1116602674 14:46947251-46947273 CTTGACATGCAGAGAGATAATGG - Intronic
1116735021 14:48678238-48678260 TTTTGCCTGCTGAAAGTAAATGG + Intergenic
1120850106 14:89162359-89162381 CCTGACATGCTGAAACCAAATGG + Exonic
1120957673 14:90097300-90097322 CTTAACATGGTGAAGGTCAAAGG + Intronic
1123412246 15:20070437-20070459 TTTTACATGCGGAAAGAAAAGGG - Intergenic
1123482998 15:20652728-20652750 TTTGAAAGGTTGAAAGTAAAAGG - Intergenic
1123521590 15:21077557-21077579 TTTTACATGCGGAAAGAAAAGGG - Intergenic
1124936255 15:34174611-34174633 GTAGGCATGCAGAAAGTAAAAGG + Intronic
1126499649 15:49331144-49331166 CTTGACATGCTGAAAGTAAAAGG + Intronic
1127402748 15:58606610-58606632 CTTGATATGTTGAAAATAGAAGG - Intronic
1131117284 15:89803175-89803197 CTTGAGATGCTGAAGGTACCTGG - Intronic
1132116413 15:99139258-99139280 CTTGAGATTCTGAATGGAAAGGG + Intronic
1136238248 16:28928048-28928070 CTTGACATGCGGAGTGTAGATGG + Intronic
1137338741 16:47576815-47576837 ATAGACATGCTTAAAGTTAAAGG - Intronic
1138037113 16:53619515-53619537 CTTGTCATTCTGAAAGCAATCGG - Intronic
1138463903 16:57172866-57172888 CTGGACATTCTGAAAGGAAAAGG + Exonic
1139200139 16:64967001-64967023 CTTTAAATGATGAAAGTAACTGG + Intronic
1140318661 16:73925717-73925739 ATAGATAGGCTGAAAGTAAAAGG - Intergenic
1140960741 16:79910151-79910173 TTTGACATGCTGGAAGCAAATGG + Intergenic
1146101097 17:29983173-29983195 GTTGTTATTCTGAAAGTAAAGGG - Intronic
1151272454 17:73007516-73007538 CTTGGCCTGGTGAAAGCAAAAGG + Intronic
1157350542 18:46880801-46880823 CTTGACATGTTGGAACTAACAGG + Intronic
1159261121 18:66014632-66014654 CTTGAAATGCTTTAAATAAAGGG + Intergenic
1159993105 18:74933756-74933778 CTTGACCTTCTGAAATTTAATGG + Intronic
1162084508 19:8240472-8240494 CGTGACATGCTGGAAGGAAGGGG - Intronic
1164151114 19:22552218-22552240 CTCGGGAGGCTGAAAGTAAAGGG - Intergenic
1167040099 19:47019027-47019049 CTTAACATGGGGAAAGAAAATGG - Intergenic
925027050 2:618298-618320 CCTAAAATGCTGAAAGCAAAGGG + Intergenic
926490914 2:13525584-13525606 ATTGACAGGGTGAAAGAAAAAGG + Intergenic
927410673 2:22822065-22822087 CTAGAAAAGCTGAAAGTATAGGG + Intergenic
927461097 2:23298734-23298756 CCTGACACGCAGAAAATAAAGGG + Intergenic
928297245 2:30094799-30094821 CTAGACAGTTTGAAAGTAAAAGG + Intergenic
930491036 2:52072528-52072550 CTTGACTTCCTGAAAGAAAATGG + Intergenic
930538301 2:52671555-52671577 TTTGGCCTGCAGAAAGTAAACGG + Intergenic
931016965 2:57993289-57993311 CTTAACATCATAAAAGTAAAAGG + Intronic
931245143 2:60486077-60486099 CTTGACCTGCTGATAGAACAAGG - Intronic
931523214 2:63122750-63122772 GTTGAAATGGTAAAAGTAAAAGG + Intronic
932032786 2:68207787-68207809 CGTCACATGCTCAAACTAAATGG + Intronic
932034567 2:68229752-68229774 ATAGGCATGTTGAAAGTAAAAGG - Intronic
934153672 2:89174275-89174297 CATGATATGATCAAAGTAAAGGG - Intergenic
934213562 2:90007657-90007679 CATGATATGATCAAAGTAAAGGG + Intergenic
937540362 2:122943624-122943646 ATTGACAGGTTAAAAGTAAAAGG + Intergenic
941301073 2:163802075-163802097 CATGAGATGCACAAAGTAAATGG + Intergenic
941483379 2:166046530-166046552 CTTAAGATTCTCAAAGTAAAGGG - Intronic
942027751 2:171927374-171927396 CTTGACATGCAGAAAATACTTGG + Intronic
942339515 2:174929171-174929193 TTTGGCATGCTGAAGGTTAATGG - Intronic
943026141 2:182631144-182631166 CTTGACAGCCAGAAAGTCAATGG + Intergenic
943768393 2:191688190-191688212 CTTAACATGTTGAGATTAAATGG + Intronic
943862444 2:192885647-192885669 CTATACATGCTGAAAGGAAAGGG - Intergenic
945192113 2:207199435-207199457 GATGAGATGCTGAAAGTGAAAGG - Intergenic
945399352 2:209361345-209361367 TTTGAAAGGCTGCAAGTAAAAGG - Intergenic
946232548 2:218301377-218301399 TTTGACTTGTTAAAAGTAAATGG - Intronic
1174754802 20:53147312-53147334 TTTGACCTACTGAAAGAAAAGGG - Intronic
1178031911 21:28537679-28537701 ATTGACATACTGATAGTAAATGG + Intergenic
1178174825 21:30084574-30084596 CTTGATATGTAGAAAATAAAAGG - Intergenic
1179253529 21:39695350-39695372 CTGGACTGGCTGAAGGTAAAGGG + Intergenic
1179812493 21:43881373-43881395 CTTAACATGCAGACAGAAAAGGG + Intronic
1181806298 22:25376382-25376404 CTTGTCTGGTTGAAAGTAAATGG - Intronic
1182767278 22:32766653-32766675 AGTGACATGATGAAAGTAGAAGG - Intronic
1184316278 22:43693215-43693237 CCGGATAGGCTGAAAGTAAAAGG + Intronic
950322935 3:12074190-12074212 ATAGAAAGGCTGAAAGTAAAGGG - Intronic
952512874 3:34074775-34074797 CAGGACATGCTGAAGCTAAAAGG + Intergenic
953501785 3:43443491-43443513 TTTGACATGCTGAACTGAAAAGG - Intronic
955757118 3:62236475-62236497 CTTGACAGCATGAAAATAAATGG + Intronic
956286384 3:67614622-67614644 CTTCACAGGCTGAAGGTGAAGGG + Intronic
957494268 3:80970088-80970110 CTTAAAATTCTGAAAGGAAATGG - Intergenic
958778825 3:98517355-98517377 CTTGTCCTGATAAAAGTAAAAGG + Intronic
959047382 3:101489433-101489455 ATTCACAGGCTCAAAGTAAAGGG + Intronic
959613422 3:108320287-108320309 TTTCACATGCAGAAAATAAAAGG - Intronic
959630578 3:108502850-108502872 CTTGAAATACAGAAAGTGAAGGG - Intronic
959661648 3:108875184-108875206 CTTGACATGGAGAAAGAGAAAGG + Intergenic
960059460 3:113305423-113305445 CTTTTCATGCAGAAAATAAAAGG - Intronic
961640895 3:128364290-128364312 CTTGCCATGCTGACTGTGAATGG - Intronic
961754169 3:129117705-129117727 CGTGAGATTCTGAAAGTGAATGG - Intronic
962683230 3:137821851-137821873 CTAGAACTGCTGAAAGGAAAGGG + Intergenic
963033376 3:141001387-141001409 CTTGATAGGCTCAAAGCAAAAGG + Intergenic
963713118 3:148770241-148770263 ATAGGCATGTTGAAAGTAAAAGG + Intergenic
965636805 3:170790194-170790216 TTTGAATTGCTGAAACTAAATGG + Intronic
965844172 3:172942342-172942364 CATAAAATGTTGAAAGTAAAAGG + Intronic
965872174 3:173276648-173276670 CTTGTGATGAGGAAAGTAAAAGG + Intergenic
969979286 4:11138030-11138052 CTTGACATTCCTAAACTAAATGG - Intergenic
970190979 4:13517763-13517785 CTTAACATACGGAAAGAAAATGG - Intergenic
970285201 4:14505549-14505571 ATTGATAGGCTTAAAGTAAATGG - Intergenic
970310018 4:14772385-14772407 CTAGAGATGATGAAAATAAATGG + Intergenic
974466997 4:62270647-62270669 CTTCACATGGTGACAGCAAAGGG - Intergenic
974756106 4:66210160-66210182 CTTGAATTCCTGAAAATAAAGGG - Intergenic
975740418 4:77424175-77424197 ATTCACATGCTGAAACTTAATGG - Intronic
976499613 4:85772307-85772329 CTTGACTTTCTGAGAGTAAGAGG - Intronic
976607801 4:86998855-86998877 CTTGAGATACTGAAAGTAGAGGG - Intronic
979414809 4:120423679-120423701 CTTGACATTCTGTATCTAAAAGG + Intergenic
979862849 4:125715906-125715928 CTTCACATGGTGAAGGGAAAAGG - Intergenic
980187502 4:129480521-129480543 CTTGAGATTCTAAATGTAAAAGG - Intergenic
980851119 4:138382938-138382960 CTTGAAAAGCTGGAACTAAAGGG - Intergenic
981087533 4:140699471-140699493 CTTGGCATGGTGAAACAAAATGG + Intronic
981139257 4:141249356-141249378 CTTTAAATGCTGAATCTAAATGG + Intergenic
981470633 4:145130615-145130637 TTTTACATGCTGAAAGTAGTAGG + Intronic
982328014 4:154149567-154149589 CTTGACGTGCTGAGAGAAGAAGG - Intergenic
984374045 4:178904174-178904196 TATCACATGCTGAAATTAAAAGG + Intergenic
984654165 4:182299652-182299674 CTTGACTTTCTGGAAGTAAAGGG - Intronic
985364090 4:189208164-189208186 CTTGACCTGCTGAACACAAAGGG - Intergenic
987478183 5:18418398-18418420 CCAGACATTCTTAAAGTAAATGG - Intergenic
987496369 5:18650476-18650498 AATGAGATGCTGAATGTAAATGG - Intergenic
988575445 5:32419015-32419037 CTTGACAGGATAAATGTAAAGGG + Intronic
989692888 5:44166607-44166629 CTTCACATGGTGACAGTAGAGGG + Intergenic
989755193 5:44943700-44943722 CTTGACATGCAGAAATACAAAGG - Intergenic
990885144 5:60582880-60582902 TTAGAAATGCTGAAAATAAATGG - Intergenic
991090180 5:62686802-62686824 CTTCACATGCTGACAGTCAAGGG + Intergenic
992547667 5:77830680-77830702 TTTAACATGCTGAAATTAATTGG - Intronic
992584677 5:78224631-78224653 ATAAACAGGCTGAAAGTAAAAGG + Intronic
993634124 5:90324098-90324120 CTTTATAGGCTCAAAGTAAAGGG - Intergenic
993797819 5:92290813-92290835 CTTCCCATACTGAAAGTAATAGG - Intergenic
995792050 5:115899255-115899277 CTTTATTTGGTGAAAGTAAAAGG - Intronic
995981001 5:118104183-118104205 CTTTATATGCTGAAGGAAAAAGG + Intergenic
996108330 5:119533792-119533814 CATGACATGCAGGAAGAAAATGG + Intronic
997741425 5:136258408-136258430 ATTGACATGCTGGAGGCAAAAGG - Intronic
998781047 5:145657119-145657141 CTGGACTTGCTGGAAGGAAATGG + Intronic
999163753 5:149529711-149529733 CTTTACATGCTGTAAATAATTGG + Intronic
1000668016 5:164023030-164023052 CTTGACAAGCATAAAGAAAAGGG + Intergenic
1000926556 5:167201384-167201406 TTTTACATGCTGAAAATGAATGG + Intergenic
1002214805 5:177623331-177623353 AAAGACTTGCTGAAAGTAAAAGG - Intergenic
1002256076 5:177959321-177959343 GTTGACATGGAGAAAGGAAACGG + Intergenic
1003851879 6:10232121-10232143 CATGAAAGGTTGAAAGTAAAAGG + Intergenic
1003970097 6:11291010-11291032 TTTCACATGCTGGAAGTGAAAGG + Intronic
1004405406 6:15328445-15328467 CTTGAAATGCTGAAAATCGAAGG + Intronic
1007205648 6:40148447-40148469 CTTGACAGTCTGAAAGAATAGGG - Intergenic
1008970366 6:57360347-57360369 CATTAAATGCTGAAAATAAAAGG - Intronic
1009159335 6:60262167-60262189 CATTAAATGCTGAAAATAAAAGG - Intergenic
1009971069 6:70626308-70626330 CTTGACTTACAGAAATTAAAAGG - Intergenic
1013872518 6:114783213-114783235 CCTGAAGTGCTGAAAGAAAAGGG - Intergenic
1014763125 6:125379896-125379918 CTTGACATTCTTGGAGTAAAAGG + Intergenic
1016149859 6:140727020-140727042 CATTACATGGTGAAAGAAAAGGG - Intergenic
1016525696 6:144999316-144999338 CTTAAAATGCTGAAAGGAAAGGG - Intergenic
1021210081 7:17839542-17839564 CACCACAGGCTGAAAGTAAAAGG - Intronic
1021784512 7:24138704-24138726 CCTGACATGCTGTAACAAAAGGG - Intergenic
1022122715 7:27324988-27325010 TTAGAGATACTGAAAGTAAAAGG - Intergenic
1023536329 7:41216281-41216303 CTTGACATTCTAAGAGTCAATGG - Intergenic
1024108829 7:46123705-46123727 GTTGAAATGCTGAAAGTAGAAGG - Intergenic
1025024463 7:55505040-55505062 CTTGACAGGATAAAAGTAATGGG - Intronic
1025151031 7:56549675-56549697 CTGGACAAGCAGAAAATAAAGGG - Intergenic
1025766156 7:64453206-64453228 CTGGACAAGCAGAAAATAAAGGG + Intergenic
1029873735 7:103724973-103724995 TTTGACATTCTGAAAACAAAAGG + Intronic
1030651491 7:112120514-112120536 CTAGTCATACTAAAAGTAAATGG + Intronic
1030857002 7:114571189-114571211 GTTGATATGCAGAAAATAAATGG + Intronic
1032409050 7:131680249-131680271 TGTGACGTGCAGAAAGTAAATGG + Intergenic
1032793391 7:135258818-135258840 CAGGACATGCTGAAAGTACCTGG - Intergenic
1033705033 7:143878218-143878240 ATTCACATGCTTAAATTAAATGG - Intronic
1035776949 8:2195724-2195746 CACGACATGCTGTAAGTTAAGGG - Intergenic
1036068718 8:5415651-5415673 TTAGACATGCTGAAAGTAGAAGG - Intergenic
1044308290 8:90663736-90663758 CATCCCATGCTCAAAGTAAAGGG - Intronic
1045133877 8:99191082-99191104 ACTGAAATGCTGAAAGAAAAAGG - Intronic
1045473747 8:102536131-102536153 TTTGAGATGCTAAAAATAAAAGG - Intronic
1047073689 8:121376343-121376365 CTTGAGTTGCAGAAAGTGAAAGG + Intergenic
1047388323 8:124430010-124430032 CTTGACTTGCTGGAAGAAAATGG + Intergenic
1047678663 8:127230965-127230987 CTGGACCTGCTGAAAATAACAGG + Intergenic
1048658400 8:136569666-136569688 CTTCACATCCTGAAAGTATATGG - Intergenic
1051210024 9:14731526-14731548 CTTTCAATGCTGAATGTAAAAGG + Intergenic
1052341757 9:27370537-27370559 CTTCACATGGAGAAAGAAAAAGG - Intronic
1052777060 9:32742825-32742847 ATTGACATGATGAAAGGGAAGGG + Intergenic
1053402942 9:37843930-37843952 CTAGAAAAGTTGAAAGTAAAAGG + Intronic
1057696415 9:97326001-97326023 CATCACATTCTGAAAGAAAAAGG + Intronic
1058030580 9:100192734-100192756 CTAGAAATGCTCAAAGTAAAAGG - Intronic
1058207091 9:102121925-102121947 CTTTCCATGCTAAAAGTTAATGG - Intergenic
1059527326 9:115004688-115004710 CCTGGCATGATGAGAGTAAAGGG + Intergenic
1186158518 X:6751265-6751287 CTTTATATGTTGAAAGGAAAAGG + Intergenic
1188269685 X:28123563-28123585 TTTGAAATGCTTGAAGTAAAAGG - Intergenic
1188726175 X:33585376-33585398 ATTGACTTGATGAAAGTAAGAGG - Intergenic
1189543574 X:42018712-42018734 TTTCACCTGTTGAAAGTAAAAGG - Intergenic
1193331505 X:80239772-80239794 CCTGCCATTCTCAAAGTAAAAGG - Intergenic
1193913173 X:87329927-87329949 ATTGATATTCTCAAAGTAAAAGG + Intergenic
1194462546 X:94190205-94190227 ATTAACATACTGAAAATAAAGGG - Intergenic
1194488530 X:94517339-94517361 CCTTACATGCTGAAAGTATGAGG + Intergenic
1194499479 X:94662618-94662640 CTTGTCATGCTGAATGAACAAGG + Intergenic
1195200553 X:102546677-102546699 CCTGACATGCTGAAACCAAATGG + Intergenic
1196972378 X:121123831-121123853 CGTGACATTATGAAAGTTAAAGG - Intergenic
1197446648 X:126558092-126558114 ATTGATAGGCTAAAAGTAAAAGG + Intergenic
1197822249 X:130553068-130553090 ATTCTCCTGCTGAAAGTAAAAGG - Intergenic
1199690639 X:150306609-150306631 CTTTCCTGGCTGAAAGTAAAAGG - Intergenic
1201611668 Y:15849894-15849916 GTTGACATGCTCAATATAAATGG - Intergenic