ID: 1126503416

View in Genome Browser
Species Human (GRCh38)
Location 15:49374617-49374639
Sequence CCTGGGAGGCGGAGCCTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1265
Summary {0: 2, 1: 0, 2: 9, 3: 151, 4: 1103}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126503416_1126503425 24 Left 1126503416 15:49374617-49374639 CCATCTAGGCTCCGCCTCCCAGG 0: 2
1: 0
2: 9
3: 151
4: 1103
Right 1126503425 15:49374664-49374686 CTCCTGAGTATTGAGATTACAGG 0: 1
1: 10
2: 121
3: 440
4: 2398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126503416 Original CRISPR CCTGGGAGGCGGAGCCTAGA TGG (reversed) Intronic
900167763 1:1250660-1250682 CCTGGGAGGCTGGGCCTAACTGG + Intergenic
900396717 1:2456121-2456143 TTTGGGATGCGGAGCCCAGAGGG + Intronic
900605663 1:3522535-3522557 CCTGGGAGGCAAATCCCAGAAGG + Intronic
900645963 1:3708870-3708892 CCGGGGAGGCGGGGCCTCGTGGG - Intronic
901042996 1:6376818-6376840 CCTGGGAGGCAGAGCGAACATGG + Intronic
901077040 1:6561637-6561659 TCTGGGAGGCGGAGCTTGCAGGG + Intronic
901119265 1:6877187-6877209 CATGGGAGGGGGAGCGCAGAAGG - Intronic
901292803 1:8137345-8137367 CCCGGGAGGCGGAGCTTGCAGGG + Intergenic
901358941 1:8678583-8678605 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
901362403 1:8713656-8713678 CCCGGGAGGCAGAGCCTGTAGGG + Intronic
901368322 1:8773746-8773768 CCTGGGAGGCAGAGACTGCAGGG + Intronic
901459652 1:9383996-9384018 CCTGGGAGGCAGAGGCTGAAAGG - Intergenic
901475179 1:9484599-9484621 TTTGGGAGGCTGAGGCTAGAGGG + Intergenic
901482319 1:9533874-9533896 CCCGGGAGGCGGAGCTTGCAGGG - Intergenic
901530186 1:9848157-9848179 CCAGGGAGGCGCAGCCAGGAAGG - Intergenic
901574795 1:10192118-10192140 CCCGGGAGGCGAAGCTTACAGGG + Intergenic
901771616 1:11533329-11533351 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
901897454 1:12326717-12326739 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
902172399 1:14622613-14622635 CCTGGGGGGCGGAGCTTGCAGGG + Intronic
902278063 1:15353627-15353649 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
902415604 1:16237011-16237033 CCTGGGAGTCGGGATCTAGAAGG - Exonic
902648230 1:17819050-17819072 CCTGGGAGGAGGAGGCTGGGAGG - Intronic
903208396 1:21800305-21800327 CCTGGGAGGCGGAGCTGGTAGGG - Intergenic
903433197 1:23325062-23325084 CCCGGGAGGCGGAGCTTGCAGGG + Intronic
903749601 1:25612814-25612836 CCTGGGAGGTAGAGGCTACAGGG - Intergenic
903958144 1:27039461-27039483 TCAGGGAGGGGGAGCCTGGAAGG - Intergenic
904020512 1:27461068-27461090 CCCGGGAGGCGGAGCTTGCAGGG + Intronic
904673511 1:32183197-32183219 CCCGGGAGGCGGAGCTTGCAGGG - Intronic
904970224 1:34413746-34413768 CATGGGAGGCGGAGCTTGCAGGG - Intergenic
905007458 1:34721333-34721355 GCTGGAAGGCAGAGGCTAGAGGG - Intronic
905763437 1:40580330-40580352 CTTGGGAGGCTGAGGCAAGAGGG + Intergenic
905991882 1:42344700-42344722 CCTGGGAGGTGGAGGCTGCAGGG + Intergenic
906124811 1:43421282-43421304 CCGGGGTGGTGGAGCCTGGAGGG - Exonic
906280855 1:44552644-44552666 CCCGGGAGGCGGAGCTTGCAGGG - Intronic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
907122441 1:52019442-52019464 CCCGGGAGGCGGAGCTTGCAGGG - Intergenic
907229494 1:52982492-52982514 CCTGGGAGGCGGAGCTTGCAGGG + Intronic
907392951 1:54170488-54170510 CCCGGGAGGCGGAGCTTGCAGGG - Intronic
907543229 1:55235365-55235387 CCTGGGAGGCGGAGCTTGCAGGG + Intergenic
907708963 1:56859985-56860007 CCTGGGAGCCGGAGGCTGCAGGG + Intronic
907838337 1:58132467-58132489 CCCGGGGGGAGGAGCCAAGATGG - Intronic
907853237 1:58277113-58277135 CCCGGGAGGCGGAGCTTGCAGGG - Intronic
908282096 1:62550794-62550816 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
908725832 1:67175931-67175953 CTTGGGAGGCTGAGGCTGGAAGG - Intronic
908748107 1:67395190-67395212 CCTGGGAGGCGGAGGTTACAGGG + Intronic
908805972 1:67932941-67932963 CCTGGGAGGCGGAGGTTTCAGGG - Intergenic
908943754 1:69468895-69468917 ATTGGGAGGTGGAGCCTAGTCGG - Intergenic
909059007 1:70857609-70857631 GCTGGGAGGCGGAGCTTGCAGGG - Intronic
909516244 1:76510484-76510506 CCAGAGAGACGGAACCTAGAAGG + Intronic
909560610 1:77005498-77005520 CCTGAGAGGAGGAGCCAAGATGG - Intronic
909630688 1:77766988-77767010 CATGGGAGATGGAGCCTAGGAGG + Intergenic
909769038 1:79397265-79397287 CATTGGAGGTGGAGCCTAGTGGG - Intergenic
910315766 1:85881982-85882004 CGTGGGATGCAGTGCCTAGAGGG - Intronic
911196715 1:95002242-95002264 CCTGGGGGGGGGAACCTGGAAGG + Intronic
911366220 1:96940850-96940872 CCCGGGAGGCGGAGCTTGCAGGG + Intergenic
911607729 1:99927577-99927599 TTTGGGAGGCTGAGGCTAGAGGG - Intergenic
912448895 1:109757863-109757885 CCTGGGAGAAGGGGCCAAGACGG + Exonic
912996955 1:114539942-114539964 CCTGGGAGGCGGAGGCTTCAGGG + Intergenic
913410909 1:118550212-118550234 CCTGGGAGGCGGAGCTTCCTGGG + Intergenic
913931369 1:124967849-124967871 TCTGGGGGGAGGAGCCAAGATGG - Intergenic
914391964 1:147232061-147232083 TCTGGGGGGTGGAGCCAAGATGG - Intronic
914410540 1:147423215-147423237 CCTTGGGGGAGGAGCCAAGATGG + Intergenic
914434007 1:147644037-147644059 ACTGGGAGGTGGAGCCTAATGGG - Exonic
914696182 1:150082428-150082450 CCTGGGAGGCGGAGGTTGGGAGG + Intronic
914739458 1:150451597-150451619 CCTGGGAGGCGGAGCTTGCAGGG + Intronic
914849633 1:151304729-151304751 CCTGGGAGGCGGAGGCTGCAGGG - Intronic
914964413 1:152241353-152241375 CCTGGGAGGCAGAGCTTGCAGGG + Intergenic
915214862 1:154333235-154333257 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
915428441 1:155846445-155846467 CCCGGGAGGCGGAGCTTGCAGGG + Intronic
915438897 1:155931484-155931506 CTTGGGAGGCTGAGCCTGGGAGG + Intronic
915519968 1:156436333-156436355 GCTGGGAGGCGGCGGCTAGGAGG - Intergenic
915527596 1:156485625-156485647 CTTGGGAGGCTGAGGCTGGAAGG - Intronic
915579559 1:156805298-156805320 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
915579911 1:156807376-156807398 CCTAGGAGGCAGAGGGTAGAGGG - Intronic
915808913 1:158886100-158886122 CCGAGGAGGAGGAGCCAAGATGG + Intergenic
916082649 1:161244605-161244627 CCTGGGAGGCGGAGGTTGCAGGG + Intergenic
916185550 1:162129115-162129137 CCAAGGAGGCGGAGCTTAGCTGG - Intronic
916540979 1:165753701-165753723 CTTGGGAGGCTGAGACAAGAGGG + Intronic
916695889 1:167236177-167236199 CCTGGGAGGTGGAGGCTGCAGGG - Intronic
916774928 1:167952291-167952313 CCCGGGAGGCGGAGCTTGCAGGG - Intronic
916963523 1:169912457-169912479 CCTGGGAGGCGGAGCTTGCAGGG - Intergenic
917262849 1:173188786-173188808 CCAGGGAGGCGGAGGCTGCAGGG - Intronic
917285679 1:173419264-173419286 CCTGGGAGGCGGAGCTTGCAGGG + Intergenic
917338896 1:173953961-173953983 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
917353879 1:174106064-174106086 CCTGGGAGGCGGAGGTTGTAGGG - Intergenic
917501139 1:175586374-175586396 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
917561790 1:176166200-176166222 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
918098811 1:181356056-181356078 CCTGGGAGGGGGTGCCTTTATGG - Intergenic
918518099 1:185384721-185384743 AATGGGAGGTGGAGCCAAGATGG - Intergenic
918681088 1:187354431-187354453 CCTGGGAGGCGGAGCTTGCAGGG + Intergenic
918929593 1:190837265-190837287 CCCGGGAGGCGGAGCTTGCAGGG - Intergenic
919865495 1:201779520-201779542 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
920388855 1:205586374-205586396 CCTGGGAGGTGGAGCCTACCTGG + Intronic
920650381 1:207833023-207833045 CTTGGGAGGCAGAGCTTAGTGGG + Intergenic
920667020 1:207970426-207970448 CCTGGGAGGCGGAGGTTGCAGGG + Intergenic
920685441 1:208105666-208105688 CCTGGGAGACGTACACTAGAAGG - Intronic
920989411 1:210922304-210922326 CCTGGGAGGCAGAGCTTGCATGG + Intronic
920993352 1:210961762-210961784 CCTGGGAGGCAGAGGTTACAGGG + Intronic
921388841 1:214599134-214599156 CCTGGGAGGCGGAGCTTGCAAGG + Intergenic
921472760 1:215567864-215567886 CGTGGGAGGCCAAGCCTGGAGGG + Intronic
921595332 1:217048272-217048294 GCTGGGAGGTGGAGAGTAGAGGG + Intronic
921741088 1:218686002-218686024 CCTGGAAGGCGGAGCTTGCAGGG - Intergenic
921978592 1:221229529-221229551 CCCGGGAGGCGGAGCTTGCAGGG - Intergenic
922111779 1:222565784-222565806 CCAGGGAGGTGGAGGCTACAGGG + Intronic
922518083 1:226223374-226223396 CCTGGGAGGGGCAGCCCGGAGGG - Intergenic
922521555 1:226257027-226257049 CCTGGGAGGTGGAGGCTGCAGGG - Intronic
922631237 1:227113940-227113962 CCTGGGAGGCTGAGGCTGCAGGG + Intronic
922824163 1:228505669-228505691 GGTGGGAGGTGGAGCCAAGATGG + Intergenic
923385964 1:233465627-233465649 CTTGGGAAGTGGAGCCTAGTGGG + Intergenic
923495366 1:234519977-234519999 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
923659673 1:235947159-235947181 CCTGGGAGGCTGAGGTGAGAGGG + Intergenic
923695412 1:236245095-236245117 CTTGGGAGGCTGAGGATAGAAGG - Intronic
923718538 1:236447909-236447931 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
924158600 1:241207042-241207064 CCCGGGAGGCGGAGCTTGCAGGG - Intronic
924547571 1:245044640-245044662 CCCGGGAGGTAGAGCCGAGATGG - Intronic
924716740 1:246582422-246582444 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1063480918 10:6375649-6375671 GCTGGGGGGAGGAGCCAAGATGG - Intergenic
1063744173 10:8860994-8861016 CCTGGGAGGCCGAGGCTGCAGGG - Intergenic
1064002818 10:11677661-11677683 CCGGGGAGGCGGAGGCTGCAGGG + Intergenic
1064698824 10:17996920-17996942 CCCGGGAGGCGGAGCTTGCAGGG + Intronic
1064714770 10:18165486-18165508 CCTGGGAGGCGGAGGTCACAGGG - Intronic
1064873649 10:19968386-19968408 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1065015594 10:21460072-21460094 CCCGGGAGGCGGAGCTTGCAGGG - Intergenic
1065036661 10:21646128-21646150 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
1065737213 10:28765045-28765067 CTTGGGAGGCTGAGGCTGGAGGG + Intergenic
1065974551 10:30830909-30830931 CCTGGGTGGAGGAGGCTGGAGGG + Intronic
1066215327 10:33280904-33280926 CCTGGGAGGTTGAACCGAGATGG + Intronic
1066275759 10:33866682-33866704 CTTGGGAGGCTGAGGCTGGAGGG + Intergenic
1066387438 10:34953199-34953221 CCTGGGAGGCGGAGTTTGCAGGG - Intergenic
1066444941 10:35473779-35473801 CTTGGGGGGAGGAGCCAAGATGG + Intronic
1066478028 10:35766923-35766945 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
1066498833 10:35970581-35970603 TGTGGGAGGTGGAGCCTAGTAGG + Intergenic
1066537551 10:36408196-36408218 CCCGGGAGGCGGAGCTTGCAGGG - Intergenic
1066827097 10:39608262-39608284 GGTGGGAGGAGGAGCCAAGATGG - Intergenic
1067577913 10:47419551-47419573 CCTGGGAGGAGGAGCCTGCTGGG + Intergenic
1067713922 10:48672169-48672191 CCTGCGCGGGGCAGCCTAGACGG - Intergenic
1068240365 10:54296067-54296089 CCCGGGAGGCGGAGCTTGCAGGG + Intronic
1069167817 10:65185938-65185960 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
1069294746 10:66829939-66829961 CCCGGGAGGCGGAGCTTGCAGGG - Intronic
1069412121 10:68164397-68164419 GCTGGGATGTGGAGCCTAAAGGG - Intronic
1069442944 10:68445385-68445407 CCTGGGAGGCGGAGATTGCAGGG + Intronic
1069499318 10:68936411-68936433 CCTGGGGGGCGGAGCTTGCAGGG + Intronic
1069861728 10:71475778-71475800 CCTGAGGGGCGGAGGCTGGAAGG + Intronic
1069896048 10:71680670-71680692 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
1070297520 10:75175622-75175644 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1070613121 10:77948023-77948045 CCTGGGAGGCGGAGCTTGCAGGG + Intergenic
1071006437 10:80889179-80889201 CCTGGGAGGCGGAGCTTGCAGGG + Intergenic
1071274436 10:84040021-84040043 CCTGGGAGGCGGAGGTTGCAGGG + Intergenic
1071407741 10:85355503-85355525 TGTGGGAGGAGGAGCCAAGATGG + Intergenic
1071544358 10:86517005-86517027 CCTGGGAGGCGGAGCCAGCATGG + Intronic
1072054837 10:91744856-91744878 CCCGGGAGGCGGAGGCTGCAGGG + Intergenic
1072107586 10:92289431-92289453 CTTGGGAAGCTGAGGCTAGAAGG + Intronic
1072222832 10:93341349-93341371 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1072262326 10:93691281-93691303 CTTGGGAGGCTGAGGTTAGAAGG - Intronic
1072605248 10:96975905-96975927 CTTGGGAGGCTGAGCCAGGAGGG + Intronic
1073211021 10:101802591-101802613 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
1073330511 10:102667461-102667483 CCTGGGAGGCGGAGGTTGCAGGG + Intergenic
1073535090 10:104269169-104269191 GCAAGGAGGCGGGGCCTAGACGG - Exonic
1073667486 10:105550200-105550222 GCTGGGAGGAGGAGCCAAGATGG + Intergenic
1074681377 10:115911078-115911100 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1074745524 10:116528587-116528609 CCCGGGAGGCGGAGCTTGCAGGG - Intergenic
1074753819 10:116610081-116610103 CCCGGGAGGCGGAGCTTGGAGGG - Intergenic
1075890431 10:125945234-125945256 ACTGGGGGGAGGAGCCAAGATGG + Intronic
1076109335 10:127849031-127849053 CCCGGGAGGCGGAGCTTGCAGGG + Intergenic
1076396016 10:130137808-130137830 CCTGGGAGGCGGAGGCTGCAGGG - Intronic
1076612542 10:131735720-131735742 CCTGGGAGAGGGAGGCCAGAGGG + Intergenic
1076712567 10:132346598-132346620 CCCGGGAGGCGGAGCCAAGATGG + Intronic
1076716267 10:132365675-132365697 CCTGGGAGGTGGAGGCTGCAGGG - Intronic
1077077089 11:706751-706773 CCTGGGTGTCGGAGCCCAGAAGG + Exonic
1077183950 11:1228283-1228305 CCCAGGAGGCGGAGCCAAGGAGG - Intronic
1077283851 11:1757238-1757260 ACTGAGAGGGGGTGCCTAGAAGG + Intronic
1077669987 11:4148333-4148355 CCTGGGAGGCTGAGGCAAGAGGG - Intergenic
1078270288 11:9788668-9788690 CCTGCGAGGCGGAGCTTGCAGGG - Intronic
1078451533 11:11444152-11444174 GCAGGGAGGCGGGGCCTGGAGGG - Intronic
1078451547 11:11444201-11444223 GCAGGGAGGCGGGGCCTGGAGGG - Intronic
1078674856 11:13400677-13400699 TCTGGGGGGTGGAGCCAAGATGG - Intronic
1078738609 11:14045325-14045347 TTTGGGAGGCCGAGCCGAGAGGG + Intronic
1078759614 11:14241927-14241949 CCGGGGAGCCTGAGCCTAGGAGG + Intronic
1078901963 11:15650355-15650377 CCCGGGAGGCAGCGCCTGGATGG + Intergenic
1079577585 11:22022003-22022025 CAAGGGAGGAGGAGCCAAGATGG - Intergenic
1079978572 11:27124255-27124277 CCTGGGAGCAGCATCCTAGAAGG - Intronic
1080004684 11:27394235-27394257 CCTGGGAGGTGAAGGCTACAAGG - Intronic
1080357594 11:31469497-31469519 CCTGTTAGGCTGAGCCTAGTAGG - Intronic
1080370230 11:31630402-31630424 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1080516747 11:33030033-33030055 CCCGGGAGGCGGAGGCTGCAGGG - Intronic
1080550289 11:33368582-33368604 CCTGGGAGGCGGAGGTTGCAGGG + Intergenic
1080790935 11:35521996-35522018 CCTGGGAGGTGGAGCTTGCAGGG - Intronic
1081500271 11:43659523-43659545 ACTGGGGGGTGGAGCCAAGATGG - Intronic
1082073346 11:47957497-47957519 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
1083184273 11:61008312-61008334 CCTGGTGGGCGGGGCCTGGAGGG - Intronic
1083361304 11:62110670-62110692 CCTGGGAGGCGGAGCTTGCAGGG - Intergenic
1083553063 11:63605626-63605648 CCCGGGAGGCGGAGCTTGCAGGG - Intronic
1083907976 11:65686428-65686450 TCTGGGAGGCGGAGGTTACAGGG + Intergenic
1084068003 11:66716402-66716424 CCTGGGAGGGGGAGCTTGCAGGG + Intronic
1084121140 11:67069766-67069788 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1084394147 11:68897894-68897916 CCTGGGAGACAGAAGCTAGAGGG - Intronic
1084607370 11:70180346-70180368 CCTGGGAGGCGGAGGTTGTAGGG - Intronic
1084645483 11:70454949-70454971 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
1085050124 11:73376173-73376195 ACTGGGCGGCGGTGCCCAGAGGG - Intergenic
1085274224 11:75287936-75287958 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1085902809 11:80721871-80721893 CCCGGGAGGCGGAGCTTGCAGGG + Intergenic
1086476296 11:87178499-87178521 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1086567183 11:88240491-88240513 CCTGGGGGGCGGTTCCAAGATGG + Intergenic
1086838374 11:91653942-91653964 CCTGGGAGGCGGAGCTTGCAGGG - Intergenic
1086988040 11:93271300-93271322 CCTGGGAGGTTGAGGCTACAGGG + Intergenic
1087021094 11:93604116-93604138 CCTGGGAGGAGCCGCCTAGGAGG + Intergenic
1087177878 11:95111661-95111683 CATAGGAGGCAGAGCTTAGACGG + Intronic
1087790676 11:102403690-102403712 CTTGGGAGGTGGGGCCTAGTGGG + Intronic
1088016930 11:105072136-105072158 CTTGGGAGGCAGAGCTGAGAGGG - Intronic
1088201451 11:107339739-107339761 CCTGGGAGGCAGAGTCTTCAGGG - Intronic
1088300866 11:108356928-108356950 TCCGGGAGGAGGAGCCAAGATGG + Intronic
1088303565 11:108384695-108384717 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1088935301 11:114394053-114394075 CCCGGGAGGCGGAGCTTGCAGGG - Intronic
1089223759 11:116897805-116897827 CCTGGGAGGCAGAGATTACAGGG + Intronic
1089237136 11:117038972-117038994 CCTGGGAGGCGGAGGCTGCAGGG + Intronic
1089265977 11:117262160-117262182 CCCGGGAGGCGGAGCTTGCAGGG - Intronic
1089657174 11:119957653-119957675 CATGGGAGGCTGAGCCAGGAGGG + Intergenic
1089726216 11:120482667-120482689 CCTGGGAGGCGGAGCTTGCAGGG + Intronic
1089776272 11:120838860-120838882 CCTGGGAGGCAGAGGTTGGAAGG - Intronic
1090308978 11:125717634-125717656 CCTGATGGGCGGAGCCAAGATGG - Intergenic
1090675064 11:128984297-128984319 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1090860984 11:130652169-130652191 CCTGGGAGGCGGAGCTTGCAGGG - Intergenic
1090891466 11:130926805-130926827 CCCGGGAGGCGGAGCTTGCAGGG + Intergenic
1091103983 11:132901102-132901124 CCCGGGAGGCGGAGGTTACAGGG + Intronic
1091268196 11:134287083-134287105 CCCGGGAGGCGGAGCTTGCAGGG + Intronic
1091356021 11:134938393-134938415 ACTGGGAGGTGGGGCCTAGTGGG - Intergenic
1091557670 12:1587159-1587181 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
1091564568 12:1639211-1639233 CCCGGGAGGCGGAGCTTGCAGGG - Intronic
1091678182 12:2506721-2506743 CATGGGAGGCGGTGCCTTGAGGG - Intronic
1091794543 12:3290473-3290495 CCCGGGAGGCGGAGCTTGCAGGG - Intergenic
1091801319 12:3326420-3326442 CCTGGGAGGAGTTGCCTGGAGGG + Intergenic
1091943119 12:4508892-4508914 CCTGGGGGGAGGAGCCAAGATGG + Intronic
1092200866 12:6581876-6581898 CCCGGGAGGCGGAGACTGGAAGG - Intronic
1092348601 12:7737153-7737175 CCCGGGAGGCGGAGGCTGCAGGG + Intronic
1092624392 12:10310707-10310729 CCTGGGAGGCGGAGGTTGAAGGG + Intergenic
1092650546 12:10630308-10630330 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
1093009758 12:14094126-14094148 GTTGGGAGGCGGAGCCTAATGGG - Intergenic
1093056737 12:14563440-14563462 CCTGGGAGGCGGAGGTTGCACGG + Intronic
1093107327 12:15104360-15104382 CCTGGGAGGCAGAGGCTGCAGGG - Intergenic
1093543045 12:20310407-20310429 CTTGGGAGGCTGAGGCAAGAGGG + Intergenic
1093615319 12:21215072-21215094 CCTGGTTGGAGGAGCCAAGATGG - Intronic
1093796696 12:23321619-23321641 CCTGGGAGGAGGAGCCAACCTGG - Intergenic
1094209962 12:27878463-27878485 CCTGAGAGGCGGAGCTCACAGGG + Intergenic
1094593324 12:31841655-31841677 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
1094654727 12:32409362-32409384 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1094733088 12:33200552-33200574 CCAGAGAGGAGGAACCTAGAGGG + Intergenic
1094820576 12:34221000-34221022 CTTGGGAGGCTGAGCCTGGAGGG - Intergenic
1095203390 12:39411632-39411654 CTTGGGAGGCTGAGGCAAGAGGG - Intronic
1095417275 12:41990579-41990601 CCTGGGAGGCTGAGGCCAGAGGG - Intergenic
1095691673 12:45096282-45096304 CCTGGGAGGCGGAGGCAAGATGG + Intergenic
1095718101 12:45370843-45370865 ATTGGGAGGAGGAGCCAAGATGG + Intronic
1096348816 12:50876726-50876748 CCTGGGAGGCGGAGCTTCCAAGG + Intronic
1096367154 12:51037796-51037818 CCTGGGAGGCTGAGGCAGGAGGG + Intergenic
1096723338 12:53540837-53540859 CTTAGGAGGCTGAGCCTAGGAGG - Intronic
1096834785 12:54342930-54342952 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1096847358 12:54414769-54414791 CCTGGGAGGCGGAGCTTGCAGGG + Intronic
1096921191 12:55087389-55087411 CCTGGGGGGAGGAGCCAAGATGG - Intergenic
1096922496 12:55102265-55102287 TCTTGGAGGAGGAGCCAAGATGG - Intergenic
1097116493 12:56701264-56701286 CTTGGGAGGCTGAGGCTGGAAGG - Intergenic
1097199402 12:57265708-57265730 CCTGGGAGGCTGAGGCTGTAAGG - Intronic
1097692709 12:62748165-62748187 CCCGGGAGGCGGAGCTTGCAGGG + Intronic
1098259859 12:68657478-68657500 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1098294238 12:68987607-68987629 CCTGGGAGGTGGAGCTTGCAGGG + Intergenic
1098294543 12:68991039-68991061 CCTGGTAGACTGAGCCAAGATGG + Intergenic
1098372941 12:69779423-69779445 AATGGGAGGAGGAGCCAAGATGG - Intronic
1099172383 12:79380500-79380522 CTTGGGAGGCTGAGGCAAGAGGG - Intronic
1099841748 12:87975299-87975321 CCTGGGGGAAGGAGCCAAGATGG - Intergenic
1100057931 12:90536600-90536622 ACTGGAAGGAGGAGCCAAGATGG + Intergenic
1100914998 12:99410591-99410613 CCTGGGAGGGGGAGCTTGCAGGG + Intronic
1100924759 12:99532434-99532456 CCTGGGAGGCGGAGCTTGCAGGG - Intronic
1101011681 12:100457156-100457178 CCCGGGAGGCGGAGCTTGCAGGG + Intergenic
1101119699 12:101565907-101565929 CCTGGGAGGCGGAGGCTACAGGG + Intergenic
1101172271 12:102110391-102110413 CTTGGGAGGCGGAGGTGAGAGGG + Intronic
1101794574 12:107960920-107960942 CCTGGGAGGTGGAGCTTGCAGGG + Intergenic
1101892047 12:108725909-108725931 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1102243122 12:111337957-111337979 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1102750051 12:115285119-115285141 CTTGGGGGGAGGAGCCAAGATGG + Intergenic
1103092922 12:118110391-118110413 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1103204085 12:119114738-119114760 CCTGGGAGGCGGAGATTGCAGGG - Intronic
1103710132 12:122906329-122906351 CCCGGGAGGCGGAGCTTGCAGGG + Intergenic
1103752428 12:123174446-123174468 CCCGGGAGGCGGAGCTTGCAGGG - Intronic
1103906646 12:124331136-124331158 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1104287028 12:127432782-127432804 TCTGGGAGCCGGAGTCTAGGAGG - Intergenic
1104294135 12:127496239-127496261 CCTGTGAGGAAGAGCCAAGAAGG - Intergenic
1104388290 12:128370129-128370151 CCTGGGGGCCTGAGCTTAGATGG + Intronic
1104550232 12:129750159-129750181 CCTGGGAGGTGGAGCATGCAGGG - Intronic
1104556042 12:129800698-129800720 CCAGGGAGGAGGAGCCAAGATGG + Intronic
1105025421 12:132845380-132845402 CCTGGGAGGCGGAGCTTGCAGGG + Intronic
1105338441 13:19496783-19496805 TCTCGGAGGAGGAGCCAAGATGG + Intronic
1105383211 13:19906197-19906219 CCTGGGAGGTGGAGGTTACAGGG + Intergenic
1105562945 13:21512521-21512543 CCTGGGAGGCGGAGCTCGCAGGG - Intronic
1105570716 13:21600870-21600892 TCTGGGAGGCGGAGCTTGCAGGG - Intronic
1105745803 13:23375757-23375779 CCTGGCAGGCGGAGCCTGGTGGG - Intronic
1105768632 13:23586180-23586202 CCTGGGAGGCGGAGCTTGCAGGG + Intronic
1106019396 13:25900113-25900135 GCTGGGAGGCAGAGCTGAGAGGG + Intronic
1106660549 13:31795223-31795245 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1107000613 13:35539838-35539860 CCCGGGAGGCGGAGCTTGCAGGG + Intronic
1107002104 13:35559853-35559875 CCCGGGAGGCGGAGCTTGCAGGG + Intronic
1107168658 13:37314076-37314098 CCTGGGAGAGGGAGCCAAGATGG + Intergenic
1107297139 13:38921495-38921517 CCTGGGGGGTGGAGCAAAGAGGG + Intergenic
1107489844 13:40870580-40870602 TCTAGGAGGAGGAGCCAAGATGG - Intergenic
1107533907 13:41309918-41309940 CCTGGGAGGCGGAGGTTACAGGG + Intergenic
1107541507 13:41393549-41393571 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
1107639234 13:42424877-42424899 CTTGGGGGGAGGAGCCAAGATGG + Intergenic
1107939554 13:45371794-45371816 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1109565773 13:64114854-64114876 CCTGGGAGGCGGAGATTGCAGGG - Intergenic
1110173746 13:72532566-72532588 CCCGGGAGGCGGAGCTTGCAGGG - Intergenic
1110328242 13:74241952-74241974 CCTGGGGGGAGGAGCCAAGATGG - Intergenic
1110648831 13:77919446-77919468 CCCGGGAGGCGGAACCCAGCTGG + Exonic
1111226367 13:85276921-85276943 CCCGGGAGGCGGAGCTTGCAGGG + Intergenic
1111286162 13:86095043-86095065 CCTGGGAGGCGGAGGTTGCAGGG + Intergenic
1111917058 13:94372196-94372218 ACTGGGGGGAGGAGCCAAGATGG + Intronic
1112173630 13:96999096-96999118 CTTGGGAGGCTGAGGCGAGAGGG + Intergenic
1112511118 13:100010375-100010397 CCCGGGAGGCGGAGCATGCAGGG - Intergenic
1112558197 13:100488528-100488550 CCTTGGAGGCTGAGGCTGGAGGG + Intronic
1113019386 13:105866254-105866276 CCTGGGAGGCAGAGATTACAGGG + Intergenic
1113935702 13:113994552-113994574 TCTGGGAGGCCGAGGCAAGAAGG + Intronic
1113992850 14:16042048-16042070 CCTGGGTGGCGGAGCATGCAGGG + Intergenic
1115502282 14:34060384-34060406 CCCGGGAGGGGGCGCCTAGGTGG + Intronic
1115832420 14:37356915-37356937 CCTGGGGGGAGGAGCCAAGATGG - Intronic
1115841244 14:37473056-37473078 GCTGGGAGGTGGAGCCTAGTGGG + Intronic
1116203152 14:41825260-41825282 CCTGGGAGAGGAACCCTAGAGGG + Intronic
1116611545 14:47079805-47079827 CCTGGAAGGCGGAGCTTGCAGGG - Intronic
1116655288 14:47645317-47645339 CCCGGGAGGCGGAGCTTGCAGGG - Intronic
1116696670 14:48187079-48187101 CATTGGAGGAGGAGCCAAGATGG + Intergenic
1116960967 14:50968254-50968276 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
1117382359 14:55177611-55177633 CCCGGGAGGCGGAGCTTGCAGGG - Intronic
1118053231 14:62051601-62051623 ACAGGGAGGTGGAGCCAAGATGG - Intronic
1118198824 14:63653262-63653284 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
1118779708 14:68999312-68999334 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
1119156423 14:72415669-72415691 CCGGGGGGGTGGAGCCAAGATGG - Intronic
1119312090 14:73656666-73656688 CATGGGAGGCTGAGGCAAGAGGG - Intronic
1119718844 14:76877490-76877512 CCTGGGAGGCAGAGCTTGCAGGG + Intergenic
1120546775 14:85821388-85821410 CCTGGGAGGCGGAGCTTGCAGGG - Intergenic
1120737500 14:88069652-88069674 GTTGGGAGGCGGAGCCTGGTGGG + Intergenic
1121406967 14:93725082-93725104 CCTGGCAGGAGGACCCTGGAAGG + Intronic
1121497852 14:94409383-94409405 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
1121696118 14:95913806-95913828 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
1121780275 14:96617752-96617774 CTTGGGAGGAGGAGCCTGCAGGG + Intergenic
1122016854 14:98803597-98803619 GCTGAGAGGCTGATCCTAGATGG + Intergenic
1122526066 14:102385341-102385363 GCTGGGAGGTGGGGCCTAGTAGG - Intronic
1122553541 14:102563549-102563571 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
1122911841 14:104833609-104833631 CCTGGGAGGCAGAGCTTGCAGGG - Intergenic
1122913945 14:104847605-104847627 CCCGGGAGGCGGAGCTTGCAGGG + Intergenic
1122964277 14:105114162-105114184 CCCGGGAGGCGGAGCTTGCAGGG + Intergenic
1123919347 15:25059686-25059708 CCTGGGTGGTGGAACCTATAGGG - Intergenic
1124659349 15:31532856-31532878 CCTGGGAGGTGGAGCTTGTAGGG + Intronic
1124835749 15:33194732-33194754 CCTGTGGGGCGGAGCCTCGGTGG - Exonic
1125636188 15:41190395-41190417 CCTGGGAGGCGGAGCTTGCAGGG + Intronic
1125656935 15:41365794-41365816 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1125689383 15:41584255-41584277 CCTGGGAGGCGGAGGTTGCAGGG + Intergenic
1125701203 15:41685927-41685949 CCCGGGAGGCGGAGCTTGCAGGG + Intronic
1125783849 15:42297403-42297425 CTTGGGAGGCTGAGGCTAGAGGG - Intronic
1125896626 15:43308023-43308045 CCTGGGAGGCGGAGCTTCCTGGG - Intergenic
1125935035 15:43627795-43627817 CCTGGTAGGCTAAGCCTAGGAGG - Intergenic
1126038269 15:44567273-44567295 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
1126148571 15:45501230-45501252 CCTGGGAGGCGGAGCTTGCAGGG + Intronic
1126448056 15:48772333-48772355 CCTGGGAGGTTGAGGCTACAGGG + Intronic
1126503416 15:49374617-49374639 CCTGGGAGGCGGAGCCTAGATGG - Intronic
1126747339 15:51839243-51839265 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1126811512 15:52410660-52410682 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1127228965 15:56968030-56968052 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1127463931 15:59225720-59225742 CCTGGGAGGCGGAGCTTGCAGGG - Intronic
1127804613 15:62507532-62507554 CCTGGGAGGCAGAGCACAGGTGG + Intronic
1127835690 15:62789198-62789220 CCTGTGAGGCTGAGCCTCAAGGG + Intronic
1128033456 15:64502039-64502061 CCTGGGAGGCAAAGCTTATATGG - Intronic
1128047650 15:64633221-64633243 CCTGGGAGGTGGAGGCTGCAGGG - Intronic
1128051796 15:64671132-64671154 CCCGGGAGGCGGAGCTTGCAGGG + Intronic
1128130393 15:65223504-65223526 CCTGGGAGGCAGAGCTTGCAGGG - Intergenic
1128655908 15:69462011-69462033 CCTGTGCGGAGGAGCCTGGAAGG - Intergenic
1129277889 15:74459414-74459436 CCTGGGAGGCTGAGGCAGGAAGG - Intronic
1129285091 15:74518224-74518246 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
1129294396 15:74591929-74591951 CCTGGAAGGCAGAACCTGGAGGG - Intronic
1129430606 15:75498637-75498659 CCTGGGAGGCAGAGGTTACAGGG + Intronic
1129607919 15:77033777-77033799 CCTGGGAGGCAGAGGCTCGTGGG + Intronic
1130001471 15:80050971-80050993 CCTGGGAGGCTGAGGTTGGAGGG + Intergenic
1130292908 15:82620347-82620369 CCTGGGAGGCGGAGGATGCAGGG + Intronic
1130733857 15:86528091-86528113 TCTGGGGGGAGGAGCCAAGATGG + Intronic
1130883127 15:88072079-88072101 CCCGGGAGGCGGAGGTTACAGGG - Intronic
1130936525 15:88475563-88475585 CTTGGGAGGCTGAGGCTGGATGG + Intronic
1131163757 15:90127641-90127663 CCTGGGAGGAGGAGCTTGCAGGG - Intergenic
1132143008 15:99410189-99410211 CCTGGGAGGCGGAGGTTGCAGGG + Intergenic
1132323982 15:100951025-100951047 CCCGGGAGGCGGAGCTTGCAGGG + Intronic
1132331631 15:101016063-101016085 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1132622574 16:874724-874746 CCGGGGAGGCGGCGCTCAGATGG + Intronic
1132652285 16:1026950-1026972 CCAGGGAGGCCGAGCACAGATGG + Intergenic
1132670419 16:1100205-1100227 CCTGGCGGGCGGAGCCTGCACGG - Intergenic
1132712259 16:1274283-1274305 CCTGGGAGGCGGAGGCTGCAGGG - Intergenic
1132776573 16:1598380-1598402 CCTAGGAGGCGGAGCTTGCAGGG + Intronic
1133190936 16:4133326-4133348 CCTGGGAGGCAGAGGTTACAGGG - Intergenic
1133327164 16:4948852-4948874 CTTGGCAGGGGCAGCCTAGAGGG + Intronic
1133919552 16:10139901-10139923 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1133928688 16:10214439-10214461 CCTGGGAGGCGGAGGTTGCAGGG + Intergenic
1133939921 16:10300721-10300743 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
1133943419 16:10329045-10329067 CCCGGGAGGTGGAGCCGAGATGG - Intronic
1133982769 16:10645724-10645746 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
1134054184 16:11158842-11158864 CCTGGGAGGCGGAGGTTACAGGG + Intronic
1134176142 16:12008017-12008039 CCTGGGAGGCAGAGCTTGCAGGG - Intronic
1134255085 16:12603809-12603831 TCTGGGGGGAGGAGCCAAGATGG + Intergenic
1134371482 16:13630079-13630101 CTTGGGAGGCTGAGCCTGGGAGG - Intergenic
1134443252 16:14311777-14311799 CCCGGGAGGCGGAGCTTGCAGGG + Intergenic
1134564150 16:15236529-15236551 CCTGGGAGGCGGAGGTTGCAGGG + Intergenic
1134738344 16:16520170-16520192 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
1134929157 16:18191993-18192015 CCTGGGAGGCGGAGGTTGCAGGG + Intergenic
1135998728 16:27273436-27273458 CCTGGGAGGTAGAGCCCAGGAGG + Intronic
1136182419 16:28562826-28562848 CCTGGGAGGTGCAGGCTACAGGG + Intronic
1136251359 16:29007603-29007625 CCTGGGAGGCGGAGCCTAGATGG + Intergenic
1136372528 16:29845309-29845331 CATGGAAGGGGGAGGCTAGAAGG - Intronic
1136582524 16:31161768-31161790 CCTGGGAGGCGGAGGTTGCAGGG + Intergenic
1137360892 16:47814089-47814111 CCTGTGGGGTGGAGCCAAGATGG - Intergenic
1137718987 16:50616613-50616635 CCCGGGAGCAGAAGCCTAGAAGG + Intronic
1137880397 16:52039751-52039773 CCTGCGAGGTGGAGCTAAGATGG + Intronic
1138055990 16:53834098-53834120 CCTGGGAGGTGGAGCTTGCAGGG - Intronic
1138593750 16:58018300-58018322 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1138746375 16:59367484-59367506 CCCGGGAGGTGGAGCCAAGTTGG + Intergenic
1138785144 16:59836831-59836853 GCTGGGGGGTGGAGCCAAGATGG - Intergenic
1139266940 16:65648679-65648701 CCTGGGAGGCGGAGTTTGCAGGG + Intergenic
1139460451 16:67118028-67118050 CCTGGGAGGTGGAGCTTGCAGGG - Intronic
1139473228 16:67189350-67189372 CCCGGGAGGCGGAGGTTACAGGG - Intronic
1140354533 16:74293941-74293963 CCTGGGAGACGGAGGTTACAGGG + Intergenic
1140671240 16:77281108-77281130 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
1140729639 16:77844482-77844504 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1140933149 16:79646687-79646709 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
1141382202 16:83586497-83586519 TCTGGGAGTCTGAGCCGAGAAGG + Intronic
1141406014 16:83793734-83793756 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
1141452248 16:84112584-84112606 TCTGGGAGGCGGAGCTTCCAGGG + Intronic
1141586870 16:85039908-85039930 CCTGGGAGGCGGAGGGTGTAGGG - Intronic
1141718415 16:85740614-85740636 CCCGGGAGGCGGAGCTTGCAGGG + Intronic
1141765320 16:86054419-86054441 CCTGGGAGGCGGAGCTTGCAGGG + Intergenic
1141995369 16:87633721-87633743 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
1142332980 16:89467468-89467490 CTTGGGAGGCTGAGGCTGGATGG - Intronic
1142383529 16:89747621-89747643 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
1142682022 17:1555633-1555655 TCTGGGAGGGGGAGCCCAGTGGG + Intronic
1142798304 17:2326742-2326764 CTTGGGAGGCTGAGGCAAGAGGG - Intronic
1143061916 17:4208981-4209003 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
1143293854 17:5856044-5856066 CCTGGGAGGCGGAGCTTGCAGGG - Intronic
1143643412 17:8213239-8213261 CCTGGGAGGCGGAGGTTGCAGGG + Intergenic
1143733425 17:8894221-8894243 ACTGGGAGGCGGAGCATCGCAGG + Intronic
1144051522 17:11501186-11501208 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1144140943 17:12347552-12347574 ACTGGGAGGCGGAGCTTGCAGGG + Intergenic
1144456335 17:15422091-15422113 CCCGGGAGGCGGAGCTTGCAGGG - Intergenic
1144819638 17:18062996-18063018 CCTGGGAGGTGGAGCTTGCAGGG + Intronic
1145177424 17:20713208-20713230 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
1145232033 17:21180148-21180170 CCTGGGAGGCGGAGCTTGCAGGG - Intronic
1145725192 17:27114304-27114326 CCTGGGAGGCAGAGCTTGCAGGG + Intergenic
1145792213 17:27634441-27634463 CCTGGGAGGCGGAGGTGGGAGGG + Intronic
1145987049 17:29054072-29054094 CTTGGGAGGCTGAGCCCAGGAGG + Intronic
1146026170 17:29323214-29323236 CCTGGGAGTCGGAGGTTACAGGG + Intergenic
1146323900 17:31869033-31869055 CCTGGGAGGCGGAGGCTGCAGGG + Intronic
1146373847 17:32281361-32281383 CCTGGGAGGCAGCCCCTAGGAGG + Intronic
1146383644 17:32350097-32350119 GGTAGGAGGCGGAGCCAAGAAGG - Exonic
1146717437 17:35098481-35098503 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1147189211 17:38729265-38729287 CCTGGGGAGAGGTGCCTAGAGGG + Exonic
1147262766 17:39218192-39218214 GCTGTGAGTGGGAGCCTAGAGGG + Intronic
1147335715 17:39725899-39725921 CCTGGGTGGAGGAGCCCACAAGG + Intronic
1147599939 17:41739288-41739310 TTTGGGAGGCCGAGGCTAGATGG - Intergenic
1147659543 17:42110109-42110131 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
1148029869 17:44612111-44612133 CCTGGGAGGCGGAGGTTACAGGG + Intergenic
1148030949 17:44620610-44620632 CCTGGGAGGTTGAGGCTACAGGG - Intergenic
1148119217 17:45197821-45197843 CCTGGGAGCCCGAGGCCAGATGG + Intergenic
1148128649 17:45249349-45249371 CCTGGAAGGCTGAGGGTAGAGGG + Intergenic
1148281632 17:46352584-46352606 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
1148303857 17:46570523-46570545 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
1148435591 17:47681938-47681960 CCTGGGAGGCTGAGGCAGGAGGG - Intronic
1148501614 17:48095954-48095976 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1148761445 17:50003885-50003907 CCCGGGAGGCGGAGCTTGCAGGG + Intergenic
1149494676 17:57109694-57109716 CCAGGGAAGGGGAGCCCAGAGGG - Intronic
1149820561 17:59773035-59773057 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1149911980 17:60575057-60575079 CCTTGGAGGTGGAGACTGGAGGG + Intronic
1149934948 17:60795763-60795785 CCCAGGAGGCGGAGGCTACAGGG - Intronic
1149955292 17:61042780-61042802 CCTGGGAGGCTGAGGCAGGAGGG + Intronic
1149998392 17:61416798-61416820 CCTGGGGGGTTGAGACTAGAGGG + Intergenic
1150255587 17:63741770-63741792 CTGAGGAGGCGGAGCCAAGACGG - Exonic
1150317694 17:64183500-64183522 CCTGGGAGGCAGAGGTTACAGGG - Intronic
1150318073 17:64186707-64186729 CTTGGGAGGCTGAGCCCAGGAGG + Intronic
1150423425 17:65057612-65057634 TCTGGGATTCGGAGACTAGAAGG - Intergenic
1150676792 17:67250975-67250997 CCTGGGAGGCGGAGGTTGCAGGG + Intergenic
1150744350 17:67804161-67804183 CCCGGGAGGCGGAGCTTGCAGGG + Intergenic
1151050032 17:70966998-70967020 CCTGGGAGGTGGAGCTTGCAGGG + Intergenic
1151233513 17:72701650-72701672 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
1151266870 17:72963244-72963266 CCCGGGAGGCGGAGCTTGCAGGG - Intronic
1151452760 17:74208858-74208880 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
1151674091 17:75589098-75589120 CCTGGGAAGCGGCGCCTGGCGGG - Intergenic
1151987314 17:77552232-77552254 CCTGGGAGGCGGAGGTTGCAGGG + Intergenic
1152117969 17:78400307-78400329 CCTGGGAGGCGGAGGCTGCAGGG + Intronic
1152318424 17:79594455-79594477 TGTGGGAGGCAGAGCCTGGAGGG - Intergenic
1152370032 17:79881226-79881248 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
1152402768 17:80078253-80078275 CCTGGGAGGCGGAGCTTGCAGGG + Intronic
1152538138 17:80962081-80962103 CCCGGGAGACAGAGCCTGGATGG - Intronic
1152621605 17:81367670-81367692 CCTGGGAGGCGGAGCTTGCAGGG - Intergenic
1152881930 17:82822540-82822562 CCTGGGGGCCAGATCCTAGAGGG + Intronic
1153302399 18:3602517-3602539 CCCGGGAGGCGGAGCTTGCAGGG + Intronic
1153391755 18:4569502-4569524 CCCGGGAGGTGGAGCTTACAGGG + Intergenic
1153429828 18:5004133-5004155 CCGGGGGGGAGGAGCCAAGATGG + Intergenic
1153659529 18:7314653-7314675 CCTGGGAGGCGGAGGTTGCAGGG + Intergenic
1153862855 18:9231747-9231769 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
1153923141 18:9808831-9808853 TCTGGGAGGCAGAGCCCAGCTGG + Intronic
1154005184 18:10521277-10521299 TCTGGGAGGCTGAGGCAAGAGGG + Intergenic
1154133136 18:11752685-11752707 TCTGGGCCGCGGAGCCCAGACGG + Intronic
1154156975 18:11951484-11951506 TCTGGGAGGCGGAGGCAAGCTGG - Intergenic
1154177197 18:12093386-12093408 CCTGGGAGGCGGAGCTTGCAGGG - Intergenic
1154237330 18:12618175-12618197 CCTGGGAGGTGGAGCTTGCAGGG - Intronic
1155041957 18:22072247-22072269 CCTGGGAGGCGGAGGTTGCAGGG + Intergenic
1155209735 18:23590126-23590148 CCTGGGAGGCGGAGGTTGCAGGG + Intergenic
1155743776 18:29324620-29324642 CCTGGGAGGCGGAGATTGGGAGG - Intergenic
1155871432 18:31033897-31033919 CCTGGGAGGCGGAGCTTGCAGGG - Intronic
1156154175 18:34281764-34281786 GCTGGCAGTCTGAGCCTAGAGGG + Intergenic
1156475124 18:37401089-37401111 GCTGTGAGGCAGGGCCTAGATGG + Intronic
1156523807 18:37746964-37746986 CCTGGGATGAGGAGCCCTGAGGG + Intergenic
1157081427 18:44529457-44529479 CCTGGGAGGTGGAGCTTGCAGGG + Intergenic
1157751614 18:50183742-50183764 GGTGGGAGGCGGGGCCTAGTGGG + Intronic
1158286888 18:55893421-55893443 CCTGGGGGGAGGAGACAAGATGG - Intergenic
1158487916 18:57884526-57884548 GTTGGGAGGTGGAGCCTAGTGGG - Intergenic
1158778869 18:60621924-60621946 CCCGGGAGGCGGAGCTTGCAGGG + Intergenic
1158932684 18:62336455-62336477 GCATGGAGGCAGAGCCTAGAGGG + Intronic
1159125617 18:64220633-64220655 CCCGGGAGGCGGAGCTTGCAGGG + Intergenic
1159807375 18:72972538-72972560 ACTGGGGGGAGGAGCCAAGATGG - Intergenic
1159810332 18:73011725-73011747 CCTGGGAGCCGGATCCAGGAGGG + Intergenic
1160302412 18:77695386-77695408 CCTGGGAGGTGGAGGCTGCAGGG + Intergenic
1160391605 18:78538311-78538333 CCCGGGAGGCGGAGCTTGCAAGG + Intergenic
1160755370 19:754385-754407 CCTGGGAGGCAGAGCTTGCAGGG + Intronic
1160935016 19:1590508-1590530 CTTGGGAGGCTGAGCTGAGAGGG + Intronic
1161123448 19:2542986-2543008 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1161375261 19:3936680-3936702 CCGGGGAGGTGGAGCTGAGAGGG + Intronic
1161391304 19:4022440-4022462 CCTGGGAGGCGGAGCTTGCAGGG - Intronic
1161414871 19:4140358-4140380 CCTGGGAGGCGGAGTTGAGATGG + Intergenic
1161452723 19:4355409-4355431 CCCGGGAGGCGGAGCTTGCAGGG - Intronic
1161506405 19:4646196-4646218 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1161645748 19:5452254-5452276 CCTGGGAGGCAGAGCTTGCAGGG + Intergenic
1162073827 19:8171436-8171458 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
1162081976 19:8223541-8223563 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
1162227279 19:9233977-9233999 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
1162514112 19:11138069-11138091 CCTGGGAGGTGGCGGCTCGAGGG + Intronic
1162572023 19:11479646-11479668 CCCTGGGGGCGGGGCCTAGATGG + Intronic
1162716642 19:12638587-12638609 CCCGGGAGGCGGAGCTTGCAGGG + Intronic
1162759638 19:12881095-12881117 CCGGGGAGGCGGCGCAGAGAGGG - Exonic
1163072552 19:14856544-14856566 CCCGGGAGGCGGAGCTTGCAGGG - Intergenic
1163291457 19:16381845-16381867 CCTGGGATGGGGAGCCAAGCAGG + Intronic
1163352367 19:16785938-16785960 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1163440064 19:17318126-17318148 CCTGGGAGGTGGAGACTGGGAGG - Intronic
1163812367 19:19441635-19441657 CCTGGGAGGCGGAGCTTGCAAGG - Intronic
1164249560 19:23465230-23465252 CCCGGGAGGCGGAGCCTGCAGGG + Intergenic
1164639767 19:29815702-29815724 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1164954766 19:32372780-32372802 ACTGGGAGGCAGGGCCTAGTGGG - Intronic
1165224712 19:34346690-34346712 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1165287573 19:34854556-34854578 CCCGGGAGGTGGAGGCTATAGGG - Intergenic
1165834437 19:38745550-38745572 CCAGGGAGGCTGACCCTGGAGGG + Intronic
1166011440 19:39945720-39945742 CCCGGGAGGCGGAGCTTGCAGGG - Intergenic
1166090392 19:40504591-40504613 CCCGGGAGGCGGAGCTTGCAGGG + Intronic
1166130899 19:40744885-40744907 CCTGGGAGGAGGAACCAAGGTGG + Intronic
1166348367 19:42180834-42180856 CTTGGGAGGCTGAGGCAAGAGGG - Intronic
1166557582 19:43711133-43711155 CCTCGGAGGCGGAGGCTGCAGGG + Intergenic
1166704663 19:44902012-44902034 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
1166784923 19:45361999-45362021 CCCAGGAGGCGGAGTCGAGATGG - Intronic
1167078397 19:47263006-47263028 CTTGGGAGGCTGAGCCTGGGAGG + Intronic
1167167148 19:47806144-47806166 CCCGGGAGGCGGAGGCTACAGGG + Intronic
1167232595 19:48294771-48294793 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
1167672060 19:50859130-50859152 CCTGGGAGGAGGGGCCTAGAGGG + Intronic
1167674808 19:50877543-50877565 CCTGGGAGGAGGGGCCGGGAGGG + Intronic
1167770312 19:51510631-51510653 CCTGGGAGGTGCTGCCAAGAGGG + Intergenic
1167846429 19:52168763-52168785 CCTGGGAGGCGGAGATTGCATGG - Intronic
1167911242 19:52703665-52703687 CCTGTGAGGCGGAGCTTGCAGGG - Exonic
1167957097 19:53074592-53074614 CCTGGGAGGCAGAGCTTGCAGGG + Intronic
1168116497 19:54223773-54223795 CCCGGGAGGCGGAGGCTTCAGGG + Intronic
1168119479 19:54243551-54243573 CCCGGGAGGCGGAGGCTGCAGGG + Intronic
1168168782 19:54573057-54573079 CCTGGGAGGCGGAGGCTGCAGGG - Intronic
1168214313 19:54913990-54914012 CCCGGGAGGCGGAGGCTGCAGGG + Intronic
1168289243 19:55349003-55349025 CCTGGGAGGCGGGGACAAGGGGG + Intergenic
1168308205 19:55447616-55447638 CCTGGGAAGCAGAGCCCAGCAGG - Intergenic
1202632545 1_KI270706v1_random:13975-13997 AATGGGAGGAGGAGCCAAGATGG - Intergenic
924997837 2:380045-380067 CCTGGGAGGCGGAGGTTGCAGGG + Intergenic
925229958 2:2224741-2224763 CCCGGGAGGCGGAGCTTGCAGGG + Intronic
925611339 2:5705677-5705699 CCAGGGTGGAGGAGCCGAGAAGG + Intergenic
925941627 2:8826006-8826028 CCTGGGAGGCGGAGCTTGCAGGG + Intronic
926083237 2:10005530-10005552 CATGGGAGGGGGAGGCCAGAGGG - Intergenic
926091869 2:10056364-10056386 CCTGGGAGGCGGAGGGTGCAGGG + Intergenic
926163928 2:10506309-10506331 CCTGGGAGGCGGAGGTTACAGGG + Intergenic
926225127 2:10961729-10961751 CCTGGGAGGCGGAGGGGAGGCGG - Intergenic
926230751 2:11002118-11002140 CTGGGGAGGAGGAGCCAAGATGG - Intergenic
926248681 2:11140297-11140319 CCCGGGAGGCGGAGCTTGCAGGG + Intronic
926702245 2:15811329-15811351 CCTCGGAGGAGGAGCCTGGTGGG + Intergenic
926708641 2:15856999-15857021 CCCGGGAGGCGGAGCTTGCAGGG + Intergenic
927065212 2:19464232-19464254 CCCGGGAGGCGGAGCTTGCAGGG - Intergenic
927283819 2:21335934-21335956 CCTGCGGGGTGGAGCCAAGATGG + Intergenic
927447834 2:23181055-23181077 TGTTGGAGGTGGAGCCTAGAGGG + Intergenic
927908201 2:26877040-26877062 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
928119803 2:28575644-28575666 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
928206192 2:29285636-29285658 CCTGGGAGGCGGAGATTGCAGGG - Intronic
928274048 2:29882616-29882638 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
928462208 2:31485457-31485479 CCTGGGAGGGAGATCCCAGACGG - Intergenic
928764971 2:34635308-34635330 CTTGGGGGGTGGAGCCAAGATGG + Intergenic
928831198 2:35486280-35486302 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
929078260 2:38096186-38096208 TCTGGGAGGCTGAGCTCAGAAGG - Intronic
929264121 2:39899478-39899500 GATGGGAGGCGGAGCCCAGGTGG - Intergenic
929371966 2:41236373-41236395 CCTGGGAGGCGGAGGTTGCAGGG + Intergenic
929460271 2:42098156-42098178 CCTGGGAGGCAGAGGTTACAGGG + Intergenic
929474598 2:42233379-42233401 CCTGGGAGGCAGAGCTTGCAGGG - Intronic
929638407 2:43549003-43549025 CCAGGGGGGTGGAGCCAAGATGG - Intronic
930655910 2:54007047-54007069 CCAAGGAGGCGGAACCTAGGAGG + Intronic
930772790 2:55144595-55144617 CCTGGGAGGCGGAGTTTGCAGGG - Intergenic
930784849 2:55261529-55261551 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
931216545 2:60250146-60250168 CCTGGGAGGCAGAGGCTTCAGGG + Intergenic
931294688 2:60910387-60910409 CCCGGGAGGCGGAGCTTGCAGGG + Intronic
931334320 2:61323437-61323459 CCTGGGAGGCAGAGCTTGCAGGG + Intronic
931649361 2:64454363-64454385 CCTGGCAGGCAGAGCCTGGGAGG - Exonic
931728980 2:65136358-65136380 CCTGGGAGGCTGAGGCAGGAGGG + Intergenic
932284451 2:70520436-70520458 CCTGGGAGGCGGAGATTGCAGGG + Intronic
932389834 2:71377187-71377209 CCTGGGAGGCGGAGGTTGGCTGG + Intronic
932549626 2:72754719-72754741 CTTAGGAGGCGGAGGCTAGAGGG - Intronic
932739473 2:74280758-74280780 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
933876420 2:86624718-86624740 CCCGGGAGGCGGAGCTTGTAGGG + Intronic
935443517 2:103131661-103131683 CCTAGGAGGTGGAGGCTGGAGGG + Intergenic
935550000 2:104442900-104442922 CCTGGGAGGTGGAGGCTGCACGG - Intergenic
935631310 2:105214472-105214494 ACTGGGGGGAGGAGCCAAGATGG - Intergenic
935730575 2:106062015-106062037 CCTTGGAGGCAGAGTCAAGATGG + Intergenic
935753505 2:106259662-106259684 CCTGGGAGGCAGAGCTTGTAGGG + Intergenic
935763199 2:106340822-106340844 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
935970056 2:108522603-108522625 CCCGGGAGGTGGAGCTTGGAGGG - Intergenic
936420115 2:112355263-112355285 CCCGGGAGGCGGAGCTTGCAGGG + Intergenic
936518955 2:113199899-113199921 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
936575981 2:113656148-113656170 CCAGGGGGGTGGAGCCAAGATGG + Intergenic
936685926 2:114826604-114826626 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
936697356 2:114966278-114966300 CTTGGGAGGTGGGGCCTAGAGGG + Intronic
936929944 2:117778175-117778197 TTTGGGAGGAGGAGCCAAGATGG + Intergenic
937363256 2:121243579-121243601 CACGGGAGGCAGAGCTTAGACGG - Intronic
937480942 2:122258771-122258793 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
937615784 2:123920823-123920845 GGTGGGAGGTGGAGCCTAGTGGG - Intergenic
938314854 2:130318391-130318413 CCCGGGAGGCGGAGCTTGCAGGG - Intergenic
938452377 2:131433385-131433407 CCTGGAAGGCGGAGCTTGCAGGG + Intergenic
939239448 2:139538957-139538979 CCCGGGGGGAGGAGCCAAGATGG - Intergenic
939480645 2:142743324-142743346 CCTGGGAGGTGGAGCTTGCAGGG - Intergenic
940067535 2:149646785-149646807 CCTGGGAGGCGGAGCTTGAGTGG + Intergenic
940191225 2:151042211-151042233 CCTGGGAGACGGAGTCTGGTGGG - Intronic
940331577 2:152480557-152480579 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
940332799 2:152493499-152493521 GTTGGGAGGTGGAGCCTAGTGGG + Intronic
940465827 2:154025298-154025320 CATGGGGGGAGGAGCCAAGATGG - Intronic
941140841 2:161779299-161779321 ATTGGGAGGTGGAGCCTAGTGGG - Intronic
941168268 2:162106567-162106589 CCTGGGAGGCGGAGGTTCCAGGG - Intergenic
941625840 2:167829405-167829427 TCTGGGAGGCGGAGGTTACAGGG + Intergenic
941651962 2:168101660-168101682 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
941719867 2:168801463-168801485 TTTGGGAGGCCGAGCCTAGAGGG - Intronic
942005772 2:171698458-171698480 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
942410584 2:175704860-175704882 CCTGGGGAGAGGAGCCAAGATGG - Intergenic
942993986 2:182238191-182238213 CCCGGGAGGCGGAGCTTGCAGGG + Intronic
943255831 2:185591890-185591912 CCTAGAAGGAGGAGCCAAGATGG - Intergenic
943819853 2:192306630-192306652 CCTGGGAGGCGGAGGTTGCAGGG + Intergenic
943934913 2:193903871-193903893 CCTTGGAGGTGGAGCCAAGATGG + Intergenic
944018575 2:195073525-195073547 CCTGGAGGGAGGAGCCAAGATGG - Intergenic
944316657 2:198292209-198292231 CCTGGGAGGGGCAGGTTAGAGGG - Intronic
944529046 2:200649687-200649709 TCTGGGAGGAGGAGCCAGGAAGG - Intronic
944922688 2:204432042-204432064 CCTGGGAGGTGGAGCTTGCAGGG - Intergenic
945026215 2:205622216-205622238 CATGGGTGGCTGAGCCTATACGG - Intergenic
945261080 2:207843973-207843995 CCTGGGAGGCTGAGGCTGGAGGG + Intronic
945749834 2:213767550-213767572 CCTGGGAGGTGGAGGCTGCAGGG + Intronic
945825174 2:214712880-214712902 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
945870379 2:215220240-215220262 CTTGGAAGGAGGAGCCAAGATGG + Intergenic
946019208 2:216628854-216628876 CCTGGGAGGTGGAGGTTACAGGG + Intergenic
946063499 2:216966554-216966576 CCCGGGAGGCGGAGGCTGCAGGG - Intergenic
946426130 2:219598086-219598108 GCTGGGGGGCGGAGCCTGGGGGG - Exonic
947214863 2:227740841-227740863 CACGGGAGGCTGAGCCCAGATGG + Intergenic
947258848 2:228198283-228198305 CCCGGGAGGCGGAGGTTGGAGGG - Intergenic
947282213 2:228468268-228468290 CCTGGAAGGCGGAGCTTGCAGGG - Intergenic
947397848 2:229703799-229703821 CCTGGGAGGCGGAGGTTGCAAGG + Intronic
947484509 2:230535829-230535851 CCTGGGAGGTGGAGGCTGCAGGG + Intronic
947634520 2:231673308-231673330 TCTGGGAGGCCGGGTCTAGAAGG + Intergenic
947686826 2:232094641-232094663 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
948427455 2:237896751-237896773 CTTGGGAGGCTGAGTCAAGAGGG - Intronic
948476417 2:238223423-238223445 CCCGGGAGGCGGAGCATGCAGGG - Intergenic
948710827 2:239824500-239824522 TGTGGGAGGTGGAGCCTGGAGGG + Intergenic
948727174 2:239941647-239941669 CCTGAGAGGCGGAGCTTGCAGGG + Intronic
1168826655 20:818865-818887 CCCGGGAGGCGGAGCTTGCAGGG - Intergenic
1168978970 20:1988883-1988905 CCAGGGAGGCAGAGCCAACAAGG - Intronic
1169070005 20:2720170-2720192 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1169182416 20:3581142-3581164 CTTGGGAGGCTGAGGCAAGAGGG + Intronic
1169192624 20:3667812-3667834 GCTGGCAGGCCGAGCCTAGGTGG - Intergenic
1169908842 20:10630527-10630549 CCCAGTAGGAGGAGCCTAGAGGG + Intronic
1170220135 20:13933131-13933153 CCTGCGAGGCGGAGGTTACAGGG + Intronic
1170239023 20:14141667-14141689 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
1171053931 20:21887652-21887674 CTTGGGGGGAGGAGCCAAGATGG + Intergenic
1171094435 20:22317819-22317841 CCTGGGAGGTGGAGGCTGCAGGG - Intergenic
1171225350 20:23437977-23437999 CCTGGGAGGCTGAGGCTAGGAGG - Intergenic
1171331871 20:24347229-24347251 CTTGGGAGGCTGAGCCCAGGAGG + Intergenic
1171812178 20:29753716-29753738 CCTGGGAGGCGGAGCATGCAGGG - Intergenic
1172138204 20:32702332-32702354 CCCGGGAGGCGGAGCCTGCAGGG + Intergenic
1172149213 20:32778858-32778880 CCTGGGAGTTGAAGCCTACAGGG + Intronic
1172555923 20:35841235-35841257 CTTGGGAGGCTGAGGCTGGAGGG + Intronic
1172717194 20:36973677-36973699 CCCGGGAGGCGGAGCTTGCAGGG - Intergenic
1172737563 20:37139059-37139081 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
1172760639 20:37318865-37318887 CCCGGGAGGCGGAGGCTGCAGGG - Intergenic
1172960335 20:38794616-38794638 CTTGGGAGGCTGAGGCAAGAAGG + Intergenic
1173213101 20:41052912-41052934 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
1173844402 20:46178843-46178865 CCTAAGAGGCTGAGCCTAGAGGG + Intronic
1174011846 20:47456075-47456097 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
1174264797 20:49323542-49323564 CCTGGGAGGCGGAGGTTGCAGGG + Intergenic
1174276453 20:49407956-49407978 CCTGGAAAGCGGAGGCTAGAGGG - Intronic
1174457568 20:50660578-50660600 GTTGGGAGGCGGGGCCTAGTGGG - Intronic
1174595618 20:51681075-51681097 CCTGGGAGGAGGAGAGTGGAAGG - Intronic
1174634257 20:51985624-51985646 CCCGGGAGGCGGAGCTTGCAGGG - Intergenic
1174715274 20:52750906-52750928 CCCGGGAGGCGGAGCTTGCAGGG + Intergenic
1174852778 20:54011792-54011814 CCTGGGTGGCTGAGCCAAGATGG + Intronic
1174884031 20:54311967-54311989 GCTTGGAGGTGGAGCCTAGTGGG - Intergenic
1175385908 20:58594896-58594918 CCTGGGAGGCGGAGGTTGCAGGG + Intergenic
1176053870 20:63134629-63134651 CAGGGGAGGCGGGGCCCAGAGGG + Intergenic
1176053893 20:63134682-63134704 CAGGGGAGGCGGGGCCCAGAGGG + Intergenic
1176053983 20:63134877-63134899 CAGGGGAGGCAGGGCCTAGAGGG + Intergenic
1176054030 20:63134983-63135005 CAGGGGAGGCGGGGCCCAGAGGG + Intergenic
1176054133 20:63135230-63135252 CAGGGGAGGCGGGGCCCAGAGGG + Intergenic
1176054156 20:63135283-63135305 CAGGGGAGGCGGGGCCCAGAGGG + Intergenic
1176054197 20:63135371-63135393 CAGGGGAGGCGGGGCCCAGAGGG + Intergenic
1176054253 20:63135495-63135517 CAGGGGAGGCGGGGCCCAGAGGG + Intergenic
1176157962 20:63632091-63632113 CCTGGGAGGCGGAGGTTGTAGGG + Intergenic
1176158920 20:63638733-63638755 CCTGGGAGGCGGAGGTTGTAGGG - Intergenic
1176644759 21:9339855-9339877 AATGGGAGGAGGAGCCAAGATGG - Intergenic
1177037078 21:16057539-16057561 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
1177362521 21:20091721-20091743 CCTGGGAGGCGGAGCTTGCAGGG - Intergenic
1177369189 21:20179908-20179930 CCGGGGAGGCGGAGCTTGCAGGG - Intergenic
1178272043 21:31199604-31199626 CCCGGGAGGCGGAGGTTACAGGG - Intronic
1178577233 21:33805745-33805767 CCCGGGAGGCGGAGCTTGCAGGG - Intronic
1178971216 21:37178850-37178872 CTTGGGAGGCTGAGCTGAGAGGG + Intronic
1178975424 21:37217194-37217216 CCCGGGAGGCGGAGCTTGCAGGG - Intergenic
1179499403 21:41797734-41797756 CCTGGGAGGCGGAGGCTGCAGGG + Intergenic
1180314420 22:11265471-11265493 CCTGGGTGGCGGAGCATGCAGGG - Intergenic
1180368192 22:11959378-11959400 AATGGGAGGAGGAGCCAAGATGG + Intergenic
1180377902 22:12111953-12111975 AATGGGAGGAGGAGCCAAGATGG - Intergenic
1180419611 22:12801327-12801349 AATGGGAGGAGGAGCCAAGATGG + Intergenic
1180585247 22:16882651-16882673 CCCGGGAGGCGGAGCTTGCAGGG + Intergenic
1180630631 22:17227125-17227147 CCTGGGAGGCGGAGGTTGCAGGG + Intergenic
1180698436 22:17768964-17768986 CCTGGGAGGCGGAGCTTGCAGGG + Intronic
1180758212 22:18177900-18177922 CCTGGGTGGGGGAGCCCAGTGGG + Intergenic
1180768500 22:18361692-18361714 CCTGGGCGGGGGAGCCCAGTGGG + Intergenic
1180777810 22:18500699-18500721 CCTGGGTGGGGGAGCCCAGTGGG - Intergenic
1180810536 22:18758010-18758032 CCTGGGCGGGGGAGCCCAGTGGG - Intergenic
1181010820 22:20039551-20039573 CCTGGGAGGCAGAGGTTACAGGG + Intronic
1181037585 22:20177385-20177407 CCTGGGAGGTGGAGCCCTCAGGG - Intergenic
1181043393 22:20203477-20203499 GCTGGGAGGTGGAGGCTGGAGGG + Intergenic
1181103596 22:20558028-20558050 CCTGGGAGGCGGAGCTTGCAGGG + Intronic
1181196679 22:21192265-21192287 CCTGGGCGGGGGAGCCCAGTGGG - Intergenic
1181212846 22:21300859-21300881 CCTGGGCGGGGGAGCCCAGTGGG + Intergenic
1181305384 22:21913890-21913912 CCTGGGAGACGTAGCTGAGATGG + Intergenic
1181420404 22:22793592-22793614 CCCGGGAGGCGGAGCTTGCAGGG + Intronic
1181642444 22:24210282-24210304 CCCGGGAGGCGGAGGCTGCAGGG + Intergenic
1181773009 22:25140449-25140471 CCTGGGAGGCGGAGCTTGCAGGG - Intronic
1181800518 22:25344971-25344993 TATGGGAGGTGGAGCCAAGATGG - Intergenic
1182202323 22:28586201-28586223 CCTGGGAGGCAGAGCTTGCAGGG + Intronic
1182294919 22:29307005-29307027 CCAGGGAGGCGGGGCGGAGACGG + Exonic
1182447761 22:30399437-30399459 CCCGGGAGGCAGAGCTTACAGGG + Intronic
1182656792 22:31897039-31897061 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
1183076236 22:35429059-35429081 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
1183319438 22:37156106-37156128 CCTGGGAGGCGGAGTGGAGAGGG - Intronic
1183342688 22:37290579-37290601 CCTGGGAGGCGGAGCTTGCAGGG - Intronic
1183448809 22:37879017-37879039 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1183775608 22:39962731-39962753 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1183778348 22:39982661-39982683 CCTGGGAGGTGGAGGCTGCAAGG + Intergenic
1183906910 22:41048534-41048556 CCTGGGAGGCGGAGGCTGCATGG + Intergenic
1183951771 22:41356534-41356556 CCTGGGAGGGGCAGCCTGGAGGG + Intronic
1184146921 22:42617197-42617219 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1184871797 22:47245423-47245445 CCTGGGAGGAGGTACCTAGGAGG + Intergenic
1185008435 22:48299511-48299533 CCTGGGACACGGAGCCTGGGGGG - Intergenic
1185283566 22:49988505-49988527 CATTGGAGGCGGAGCCTGGTGGG + Intergenic
1185424435 22:50757305-50757327 CCAGGGTGGTGGAGCCAAGATGG - Intergenic
1203230118 22_KI270731v1_random:102580-102602 CCTGGGCGGGGGAGCCCAGTGGG + Intergenic
1203276519 22_KI270734v1_random:90822-90844 CCTGGGGGGGGGAGCCCAGTGGG + Intergenic
949211739 3:1511380-1511402 CGTGGGAGGCAGAGGCTGGATGG - Intergenic
949283045 3:2368998-2369020 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
949311545 3:2704219-2704241 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
949344861 3:3067475-3067497 CCTGGAAGCCGCAGTCTAGAGGG + Intronic
949527198 3:4916531-4916553 TCTCGGAGGAGGAGCCAAGATGG + Intergenic
950053990 3:10011135-10011157 CCTGGGAGGCGGAGCTCTGCGGG - Intergenic
950059079 3:10054557-10054579 CCTGGGAGGCGGAGTTTGCAGGG - Intronic
950101624 3:10360273-10360295 CCTGGGATGCAGAGCCCTGAGGG - Intronic
950814698 3:15688363-15688385 CTTGGGAGGCTGAGGCAAGAGGG - Intronic
951142131 3:19175295-19175317 CCCGGGAGGCGGAGCTTGCAGGG - Intronic
951535677 3:23738376-23738398 CCTGGGAGGCAGAGGTTACAGGG + Intergenic
951585662 3:24212320-24212342 CCTGGGAGGCGGAGGTTGTAGGG + Intronic
951719273 3:25680514-25680536 CCCGGGAGGCGGAGCTTGCAGGG - Intergenic
952226350 3:31380747-31380769 CCTGGGAGGTGGAGGCTGCAGGG - Intergenic
952547287 3:34433867-34433889 CCTTGGGGGAGGAGCCAAGATGG - Intergenic
952636806 3:35542929-35542951 CCTGGGAGGCGGAGCTTGCAGGG - Intergenic
952802849 3:37313125-37313147 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
953117688 3:40009310-40009332 CCCGGGAGGCGGAGCTTGCAGGG - Intronic
953705369 3:45226321-45226343 CGCGGGAGGCGGAGCCGAGCCGG - Intergenic
954174665 3:48834616-48834638 CTTGGGAGGCTGAGGCAAGAGGG + Intronic
954198284 3:49008955-49008977 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
954212695 3:49107202-49107224 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
954376651 3:50197843-50197865 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
954504250 3:51053495-51053517 CCTGGGAGGCAGAGCTTGCAGGG - Intronic
954594988 3:51816583-51816605 CCCGGGAGGCGGAGCTTGCAGGG + Intergenic
954721425 3:52566991-52567013 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
954972869 3:54665825-54665847 CCTGGGTGGCGGAACCTGGGTGG - Intronic
955255201 3:57324577-57324599 CCTGGGGGGAGGAGCCAAGATGG + Intronic
955290776 3:57690426-57690448 CCTGGGAGGCGGAGCTTGCAGGG + Intronic
955293355 3:57713260-57713282 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
955326133 3:58010318-58010340 CAGGGGAGGCTCAGCCTAGAGGG - Intronic
955899081 3:63733307-63733329 CCTGGTGGGAGGAGCCAAGATGG + Intergenic
955966426 3:64393637-64393659 CCTGGGAAGAGCAGTCTAGATGG + Intronic
956401452 3:68884217-68884239 CCTGGGAAATGCAGCCTAGAGGG - Intronic
956713334 3:72057341-72057363 GCTGGGAGCGGGAGCCTAGCAGG + Intergenic
956823799 3:72978264-72978286 CCCGGGAGGCGGAGCTTGCAGGG + Intronic
957018598 3:75097996-75098018 ACTGGGAGGAGGAGCCAAGATGG - Intergenic
957695124 3:83626202-83626224 CCTGGGAGGCGGAGGTTGCAGGG + Intergenic
957719675 3:83977888-83977910 CCTGGGAGACGGAGGTTACAGGG - Intergenic
957944023 3:87038908-87038930 CCTGGGAGGGGGGGTATAGATGG - Intergenic
958155147 3:89747610-89747632 GCGGGGAGGAGGAGCCAAGATGG + Intergenic
958749071 3:98174080-98174102 TCAGGGAGGTGGAGCCAAGATGG + Intronic
958780638 3:98537957-98537979 CCTGGGAGGCGGAGCTTGCAGGG - Intronic
958835616 3:99141181-99141203 CCAGGGGGGAGGAGCCAAGATGG - Intergenic
958841245 3:99208594-99208616 CCTGGGAGGCGGAGCTTACAGGG - Intergenic
959067869 3:101676461-101676483 GCTGCCAGGCGGAGCCGAGAGGG - Intronic
960364322 3:116752495-116752517 CCTGGGAGGCAGAGCTTGCAGGG - Intronic
960440217 3:117677753-117677775 CCTGGGAGGCTGAGGCAGGAGGG - Intergenic
960900295 3:122547775-122547797 CCTGGGAGGCTGAGGCTTCAGGG + Intronic
962161551 3:133005644-133005666 CATGGGGGGAGGAGCCAAGATGG - Intergenic
963196123 3:142532230-142532252 ACTGGGAGGTGGAGCCAAGATGG - Intronic
963285569 3:143431556-143431578 CCTGGGAGGCGGAGCTTGCAGGG - Intronic
963621266 3:147609626-147609648 CCCGGGAGGCGGAGCTTGCAGGG - Intergenic
963699186 3:148602393-148602415 CCTGGGAGGCTGAGGGTAGCAGG - Intergenic
963700557 3:148619979-148620001 CCTGGGAGGCGGAGCTTGCAGGG + Intergenic
964422021 3:156513134-156513156 CCCGGGAGGCGGAGCCTGCAGGG + Intronic
964658334 3:159092620-159092642 CCTGGGAGGCGGAGCTTGCAGGG + Intronic
965151487 3:164982763-164982785 CATAGGAGGCTGAGGCTAGAGGG - Intronic
965528093 3:169742748-169742770 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
965763806 3:172109239-172109261 CCCGGGAGGCGGAGCTTGCAGGG - Intronic
966410972 3:179645337-179645359 CCCGGGAGGCGGAGGCTGCAGGG + Intergenic
966916049 3:184584581-184584603 CTTGGAAGGTGGGGCCTAGAGGG - Intronic
966998331 3:185307617-185307639 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
967285193 3:187862477-187862499 CATGGGGGGAGGAGCCAAGATGG + Intergenic
967379708 3:188843709-188843731 CCCGGGAGGCGGAGCTTGCAGGG + Intronic
967495771 3:190143520-190143542 CCTGGGAGGCGGAGGTTGCAGGG + Intergenic
967533590 3:190577023-190577045 CCCGGGAGGCGGAGCTTGCAGGG + Intronic
967924344 3:194634282-194634304 CCTGGGAGGCGGAGGCTGCAGGG - Intergenic
968093661 3:195912950-195912972 CCTGGGAGGCGGAGGTTGCAGGG + Intergenic
968129489 3:196184523-196184545 CCTGGGAGGTGGAGGCTGCAGGG + Intergenic
968134872 3:196214067-196214089 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1202742132 3_GL000221v1_random:65213-65235 AATGGGAGGAGGAGCCAAGATGG + Intergenic
968404022 4:323858-323880 CCTGGGAGGCTGAGGCAGGAGGG + Intergenic
968694190 4:2013833-2013855 CCCGGGAGGCGGAGGCTACTAGG - Intronic
968845568 4:3039620-3039642 CCTGGGAGGCGGAGGTTACAGGG + Intronic
969310104 4:6348050-6348072 CCGGGAAGGCGGAGCATTGAGGG - Intronic
969359483 4:6653450-6653472 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
970494168 4:16608943-16608965 TCTGGGGGGCGGGGCCAAGACGG + Intronic
971065454 4:23026938-23026960 CCTGGGAGGCGGAGCTTGCAGGG + Intergenic
971116152 4:23647754-23647776 ACTGGGGGGAGGAGCCAAGATGG - Intergenic
971636186 4:29061688-29061710 GTTGGGAGGGGGAGCCTAGTAGG - Intergenic
972183701 4:36501410-36501432 CCTGGGAGGTGGAGGCTGCAGGG - Intergenic
972258889 4:37388257-37388279 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
972327228 4:38028239-38028261 CCTGGGAGGCGGAGACTGCAGGG - Intronic
972511811 4:39773843-39773865 CCCGGGAGGCGGAGCTTGCAGGG + Intronic
972535900 4:39999646-39999668 CCCGGGAGGCGGAGCTTGCAGGG + Intergenic
973311123 4:48711071-48711093 GCTGGGGGGAGGAGCCAAGATGG + Intronic
973362171 4:49175946-49175968 AATGGGAGGAGGAGCCAAGATGG - Intergenic
973398925 4:49620914-49620936 AATGGGAGGAGGAGCCAAGATGG + Intergenic
973907692 4:55547140-55547162 CCGGGGAGGCGGGGCCTGGTCGG + Intergenic
974114972 4:57568329-57568351 TCCGGGAGGAGGAGCCAAGATGG - Intergenic
974320249 4:60338376-60338398 CCCGGGAGGCGGAGCTTGCAGGG - Intergenic
974387079 4:61215625-61215647 CCCGGGAGGCGGAGCTTGCAGGG - Intronic
974443272 4:61945944-61945966 ACTAGGAGGAGGAGCCAAGATGG - Intronic
974610974 4:64214877-64214899 CTTGGGAGGCTGAGTTTAGAGGG + Intergenic
975154877 4:71059839-71059861 CCTCGGGGGAGGAGCCAAGATGG - Intergenic
976171027 4:82304563-82304585 CCCGGGGGGCGGAGCCTGCAGGG - Intergenic
976225738 4:82794723-82794745 CCTGGGAGGTGGAGCTTGCAGGG - Intronic
976660756 4:87537800-87537822 CCTGGGAGGCGGAGGTTGCAGGG + Intergenic
977104122 4:92858631-92858653 CCTGGGAGTCGGAGCTTGCAGGG - Intronic
977975258 4:103256273-103256295 CCTGCGAGGAGGAGCCAAGATGG - Intergenic
978593718 4:110354482-110354504 CCTGGGAAGCAGAGCTGAGAGGG - Intergenic
978659032 4:111100758-111100780 TCTTGGAGGTGGAGCCAAGATGG - Intergenic
978736120 4:112086460-112086482 TCTTGGAGGAGGAGCCAAGATGG + Intergenic
978787904 4:112630440-112630462 CCTGGGAGGCAGAGGCTTCAGGG + Intronic
978837069 4:113163686-113163708 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
978864861 4:113495149-113495171 ACTGGGGGGAGGAGCCAAGATGG - Intronic
979108239 4:116715404-116715426 CCTGGGAGGCGGAGCTTGCAGGG + Intergenic
979275310 4:118809047-118809069 CCTGGGAGGCAGAGCTTGCAGGG - Intronic
979589889 4:122465977-122465999 CTTGGGGGGTGGAGCCAAGATGG - Intergenic
979601664 4:122592308-122592330 AATGGGAGGCGGGGCCTAGTGGG - Intergenic
979614510 4:122727318-122727340 CCTGGGAGGCGGAGCTTGCAGGG - Intergenic
979890472 4:126085801-126085823 CCTGGGAGGCGGAGGTTGTAAGG + Intergenic
980130935 4:128815123-128815145 ACAGGGAGGCGGAGCTTACAGGG - Intronic
980130939 4:128815140-128815162 ACAGGGAGGCGGAGCTTACAGGG - Intronic
980130943 4:128815157-128815179 ACAGGGAGGCGGAGCTTACAGGG - Intronic
980130948 4:128815174-128815196 CCCGCGAGGCGGAGCTTACAGGG - Intronic
980269146 4:130562106-130562128 TCTTGGAGGTGGAGCCTAAAGGG + Intergenic
980881351 4:138712829-138712851 CCTGGGAGGCGGAGGTTGCAGGG + Intergenic
981200722 4:141976199-141976221 CCTGGGAGGCAGAGCTTGCAGGG + Intergenic
981478818 4:145214683-145214705 CTTGGGAGGCTGAGGCAAGAGGG - Intergenic
981520208 4:145652975-145652997 CCTGGGAGGCTGAGGCAGGAGGG - Intronic
981618007 4:146663283-146663305 CATAGGAGGAGGAGCCAAGATGG + Intergenic
981634658 4:146863044-146863066 CCTGGGAGGTGGAGCTTGCAGGG + Intronic
981732207 4:147911436-147911458 CCCGGGAGGCGGAGCTTGCAGGG - Intronic
982034830 4:151335267-151335289 CCTGGGAGGCGGAGGTTGCAGGG + Intergenic
982097150 4:151933641-151933663 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
982220533 4:153121273-153121295 CCTGGGAGGCGGAGCTTGCGTGG + Intergenic
982229214 4:153193205-153193227 CCTGGGAGGCAGAGCTTGCAGGG - Intronic
982349597 4:154400225-154400247 CCCGGGAGGCGGAGCCTGCAGGG + Intronic
982718645 4:158836738-158836760 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
983156060 4:164350746-164350768 GTTGGGAGGAGGAGCCAAGATGG + Intronic
983446317 4:167857878-167857900 CCGGGGGGGAGGAGCCAAGATGG + Intergenic
984152615 4:176152857-176152879 CCTGGGAGGCGGAGGTTGCACGG + Intronic
984407374 4:179350435-179350457 CCCGGGAGGCGGAGCTTGGAGGG + Intergenic
984913609 4:184699734-184699756 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
984969521 4:185175340-185175362 CCCGGGAGGCGGAGGTTACAGGG - Intronic
985249769 4:188012239-188012261 CCCGGGAGGCGGAGCTTGCAGGG + Intergenic
985259953 4:188106123-188106145 CCCGGGAGGCGGAGCTTGCAGGG - Intronic
985286183 4:188338024-188338046 CCCGGGAGGCGGAGCTTGCAGGG + Intergenic
985318304 4:188681422-188681444 CCCGGGAGGCGGAGCTTGCAGGG + Intergenic
985334206 4:188873713-188873735 CCCGGGAGGCGGAGCTTGCAGGG + Intergenic
985345691 4:189002086-189002108 CCTGGGAGGCCGTGCCCAGCGGG - Intergenic
1202759516 4_GL000008v2_random:97414-97436 AATGGGAGGAGGAGCCAAGATGG - Intergenic
985765410 5:1776951-1776973 CCTGCGAGGCTGAGCCCAGGAGG - Intergenic
986332653 5:6728659-6728681 GCTGGGCGGCAGAGCCCAGAGGG + Intronic
986978165 5:13416494-13416516 CCGAGGAGGAGGAGCCAAGATGG + Intergenic
987228002 5:15863645-15863667 CCTGGGAGGTGGGGCCTAGTGGG + Intronic
987624325 5:20378245-20378267 CCCGGGAGGCGGAGCTTTCAGGG - Intronic
987793322 5:22596192-22596214 TCTGGGAGGCCGAGACTGGATGG + Intronic
988431624 5:31125746-31125768 CCTGGGAGGCGGAGGCTGCAGGG - Intergenic
989255224 5:39358907-39358929 CCCGGGAGGCGGAGCTTACAGGG + Intronic
989527782 5:42473304-42473326 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
989550864 5:42734711-42734733 CTTGGGAGGAGGAGCCAAGATGG + Intergenic
989593599 5:43135072-43135094 CCTGGGAGGCGGAGGTTGGGGGG - Intronic
989599633 5:43189289-43189311 CCCGGGAGGCGGAGCTTGCAGGG + Intronic
989779199 5:45243985-45244007 CTTGGGGGGAGGAGCCAAGATGG - Intergenic
990041865 5:51386582-51386604 CCAGGGAAGTGCAGCCTAGATGG + Intronic
990492768 5:56318827-56318849 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
990761968 5:59139575-59139597 CTTGGGAGGCAGAGCCTGGGAGG - Intronic
991093309 5:62713595-62713617 CCCGGGAGGCGGAGCTTCCAGGG - Intergenic
991555360 5:67889601-67889623 CCTGGGGGGAGGAGCCAAGATGG + Intergenic
992533385 5:77673264-77673286 ACAGGGAGGAGGAGCCTTGAAGG - Intergenic
992773507 5:80070258-80070280 CCTGGGAAGCTGAGCCTGGCAGG - Intronic
992908140 5:81368214-81368236 CCCGGGAGGCGGAGCTTGCAGGG + Intronic
993685296 5:90929640-90929662 CCTGGGGGGAGGAGCCAATATGG - Intronic
993871611 5:93261032-93261054 ACTAGGAGGAGGAGCCAAGATGG + Intergenic
993917491 5:93761067-93761089 CCCGGGGGGTGGAGCCAAGATGG + Intronic
994173138 5:96680277-96680299 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
994508663 5:100675152-100675174 CCTGGAAGGCGGAGGCTGCAGGG - Intergenic
994580006 5:101629656-101629678 CCCGGGAGGCGGAGCTTGCAGGG + Intergenic
994692882 5:103039331-103039353 CCCGGGAGGCGGAGCTTGCAGGG + Intergenic
994845149 5:104979521-104979543 GTTGGGAGGTGGAGCCTAGTGGG - Intergenic
994882822 5:105519256-105519278 CATGGGAGGAGGAGCCAAGATGG - Intergenic
995604546 5:113837787-113837809 CCCGGGAGGCGGAGCTTGCAGGG + Intergenic
996514467 5:124354738-124354760 CCTGGGAGGCGGAGCTTGCAGGG - Intergenic
996667954 5:126082637-126082659 CCTGGGAGGCTGAGCTTGCAGGG - Intergenic
996730056 5:126708035-126708057 CCTGGGAGGCGGAGGTTGTAGGG + Intergenic
996816504 5:127579577-127579599 CCTGGGAGGCTGAGGTGAGAAGG + Intergenic
997325855 5:133020366-133020388 CCTGGGAGGCAGAGGCTGCAAGG + Intronic
997872883 5:137520681-137520703 CGTGGGAGGCGGAGGTTACAGGG - Intronic
997958131 5:138296679-138296701 CCTGGGAGGCGGAGCTTGCAGGG - Intronic
998382352 5:141734920-141734942 CCTTGGAGGTGGAGCCAGGATGG + Intergenic
999567525 5:152881494-152881516 TCTGGGAGGAGGATCCTGGAAGG + Intergenic
999757753 5:154677737-154677759 CCTGGGAGGAGGAGGCTGCAGGG + Intergenic
1000189199 5:158892411-158892433 CCCGGGAGGCGGAGGCTTCAGGG + Intronic
1000538620 5:162510697-162510719 CCCGGGAGGCGGAGCTTGCAGGG + Intergenic
1000761183 5:165226582-165226604 CCCGGGAGGCGGAGCTTGCAGGG + Intergenic
1001190514 5:169626360-169626382 CTTGGGAGGCTGAGGCAAGAGGG + Intergenic
1001436630 5:171704396-171704418 CCTGGGAGCTGGAGCCAGGAAGG - Intergenic
1001625153 5:173126214-173126236 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1002904074 6:1434732-1434754 GCTGGGGGGAGGAGCCAAGATGG - Intergenic
1002943998 6:1743465-1743487 CCCGGGAGGCGGAGCTTGCAGGG + Intronic
1003481741 6:6540616-6540638 CTTGGGAGGCTGAGGCTGGAGGG - Intergenic
1003862447 6:10334771-10334793 CCTGGGAGGCGGAGGTTGCAGGG + Intergenic
1003941230 6:11029150-11029172 CCTGGGAGGCGGAAGCTGTAGGG + Intronic
1004015244 6:11726327-11726349 GTTGGGAGGGGGAGCCTAGTGGG + Intronic
1004522233 6:16372838-16372860 CCTGGGAGACAGAGGCTATAGGG + Intronic
1004547921 6:16616462-16616484 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1004650427 6:17602104-17602126 CCTGGGAGGCGGAGGCTGCAGGG - Intronic
1005081491 6:21960796-21960818 CCTGGGAGGCGGAGGTTGCAGGG + Intergenic
1005302447 6:24483989-24484011 CCCGGGAGGCGGAGCTTGCAGGG - Intronic
1005656424 6:27943282-27943304 CCAAGGAGGAGGAGCCAAGATGG + Intergenic
1005829476 6:29659034-29659056 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
1005883321 6:30075927-30075949 CCTAGGAGGCGGTCACTAGAGGG + Intergenic
1005886617 6:30102203-30102225 CCTGGGAGGCGGAGCTCCAACGG - Intergenic
1006879888 6:37330312-37330334 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1007336523 6:41158808-41158830 GATGGGAGGCGGTGCCGAGAGGG - Intronic
1007339321 6:41180452-41180474 CCTGGGAGGCGGAGGTTACAGGG + Intergenic
1007646314 6:43384322-43384344 CCTGGGAGGCAGAGCTTGCAGGG - Intergenic
1007779817 6:44246398-44246420 CCGGAGAGGCGGAGCCTCGCGGG + Intronic
1007881761 6:45176058-45176080 CTTGGGGGGAGGAGCCAAGATGG + Intronic
1007897756 6:45379788-45379810 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
1008117471 6:47568666-47568688 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
1009291494 6:61888635-61888657 CCCGGGAGGCGGAGCTTGCAGGG - Intronic
1010173024 6:72994668-72994690 CATGGGAGGAGGAGCCAAGATGG - Intronic
1010245372 6:73657344-73657366 CCCAGGAGGTGGAGCCTACAGGG - Intergenic
1011107992 6:83803752-83803774 CTTAGGAGGAGGAGCCAAGATGG - Intergenic
1011153195 6:84298802-84298824 CCCGGGAGGCGGAGCTTGCAGGG - Intergenic
1011296873 6:85835499-85835521 CCTGGGGGGTGGAGCCAAGATGG - Intergenic
1011340279 6:86306588-86306610 CCAGAGAGGAGGAACCTAGAGGG + Intergenic
1011627062 6:89291293-89291315 CCTGTGTGGAGGAGGCTAGACGG - Intronic
1011671356 6:89686347-89686369 CCTGGGAGGCGGAGATTGCAGGG + Intronic
1011693164 6:89888034-89888056 CCTGGAAGGCGGGGCCTGTAGGG + Intergenic
1011994346 6:93566134-93566156 CCCGGGAGGCGGAGCTTGCAGGG + Intergenic
1011999696 6:93637591-93637613 CCTGGGGGGAGGAGCCAAGATGG - Intergenic
1012251615 6:96987002-96987024 ACTGGGGGGTGGAGCCAAGATGG - Intronic
1012434812 6:99204278-99204300 CTTGGGAGGAGGAGCCAAGATGG + Intergenic
1012512741 6:100023037-100023059 CCTGGGAGGCTGAGTGAAGAGGG + Intergenic
1013131023 6:107232927-107232949 CTTGGGAGGCTGAGCCCAGGGGG - Intronic
1013161457 6:107549189-107549211 CCCGGGAGGCGGAGCTTGCAGGG + Intronic
1013304889 6:108838682-108838704 CTGGGGAGGCGGAGGCGAGAGGG + Intergenic
1013497551 6:110713354-110713376 CCCGGGAGGCGGAGCTTGCAGGG + Intronic
1013783198 6:113751245-113751267 CCTGGGAGGCGGAGCTTGCAGGG + Intergenic
1013982448 6:116147908-116147930 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
1014063756 6:117102128-117102150 CAAGGGAGGAGGAGCCAAGATGG + Intergenic
1014076750 6:117244749-117244771 CCTAGGGGGAGGAGCCAAGATGG + Intergenic
1014140889 6:117940722-117940744 CCTGGGAGGTGGAGGCTGCAGGG - Intronic
1014867228 6:126547419-126547441 CCCGGGAGGCGGAGCTTGCAGGG + Intergenic
1015064959 6:129013359-129013381 CCCGGGAGGCGGAGCCTGCAGGG + Intronic
1015179453 6:130346082-130346104 GTTGGGAGGAGGAGCCAAGATGG + Intronic
1015253941 6:131156848-131156870 CCCGGGAGGCGGAGCTTGCAGGG - Intronic
1016004344 6:139074600-139074622 CCTGGGAGGCGGAGCTTGCAGGG - Intergenic
1016355841 6:143217582-143217604 CCTGGGAGGTGGAGGCTGCAGGG - Intronic
1016664109 6:146614974-146614996 CCCGGGAGGCGAAGCCTGCAGGG - Intronic
1016749195 6:147613854-147613876 GCTGGGAGGCGGAGCCACGGAGG - Intronic
1017108964 6:150914219-150914241 CCTGGGAGGCGGGGGTTACAGGG + Intronic
1017371199 6:153711110-153711132 CGTGGGAGGTGGAGCCTGGTGGG - Intergenic
1017501097 6:155023697-155023719 CCTTGCAGGCGGAGCCTCCAAGG + Intronic
1017814598 6:158007716-158007738 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1018733234 6:166668964-166668986 CCTGGGAGGTCGAGGCTACAGGG - Intronic
1019284670 7:217491-217513 CCTGGGGGGCGGTGCTGAGATGG + Intronic
1019367314 7:641026-641048 CCCGGGAGGCGGAGCTTGCAGGG - Intronic
1019380414 7:719113-719135 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1019506183 7:1392686-1392708 CCTGGGAGCCAGGGCCTGGAGGG + Intergenic
1019535645 7:1528448-1528470 CCTGGGAGGTGGAGGCTACAGGG + Intergenic
1019558884 7:1646103-1646125 CCTGGGAGGCAGAGGCTGCAGGG - Intergenic
1019652214 7:2166133-2166155 CCTGGGAGGCGAGGTCTGGATGG - Intronic
1019683053 7:2363381-2363403 CCTGGGAGGTTGAGCCTGGGAGG + Intronic
1019822890 7:3259168-3259190 CCTGGGAGGCTGAGGCCGGAGGG - Intergenic
1019935185 7:4250417-4250439 CCCAGGAGGCGGAGGTTAGAGGG - Intronic
1020166973 7:5814922-5814944 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1021158754 7:17245536-17245558 CCTGGGAGGCCGAGGCTGCAGGG + Intergenic
1021222869 7:17993347-17993369 CCTGGGAGACCGAGCCTTCAGGG - Intergenic
1021561013 7:21968647-21968669 CCTGGGAGGCGGAGGCTGCAGGG + Intergenic
1021622803 7:22564791-22564813 CCTGGGAGTCTGAGCCTTGGAGG - Intronic
1021646712 7:22796197-22796219 CCTGGGAGGCGGAGCTTGCAGGG - Intergenic
1022361431 7:29663358-29663380 CCTGGGAGGCGGAGGCTGCAGGG - Intergenic
1022699955 7:32750362-32750384 CCTGGGAGGCGGAGGCTACAGGG + Intergenic
1022775978 7:33527756-33527778 CCCGAGAGGAGGAGCCAAGATGG - Intronic
1023217457 7:37879222-37879244 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1024237658 7:47410080-47410102 CCTGGGAGAAGGAGCCTCCAGGG + Intronic
1024318931 7:48046097-48046119 CCTGGGACGCAGGGCCTGGAGGG + Intronic
1024962649 7:54993955-54993977 CCTGGGAGGCAGAGCTTGCAGGG - Intergenic
1025034408 7:55584523-55584545 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
1025104578 7:56160696-56160718 ATTGGGAGGTGAAGCCTAGAGGG - Intergenic
1025123965 7:56330114-56330136 CCCAGGAGGCGGAGCTTGGAGGG - Intergenic
1025736244 7:64149420-64149442 CCTGGGAGGCGAAGGCTGCAAGG + Intronic
1025755717 7:64337828-64337850 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1025966606 7:66278705-66278727 CCTGGGAGGCGGAGCTTGCAGGG + Intronic
1026326860 7:69318044-69318066 CTTGGGAGGCTGAGGCAAGAGGG - Intergenic
1026587432 7:71667873-71667895 CCTGGGAGACGGAGGTTACAGGG - Intronic
1026668988 7:72370576-72370598 CCCGGGAGGCGGAGCTTAGAAGG + Intronic
1026731957 7:72919588-72919610 CTTGGGAGGCTGAGCCTGGGAGG - Intronic
1026818996 7:73534196-73534218 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
1027145847 7:75693993-75694015 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1027252885 7:76410106-76410128 CCTGGGAGGCGGAGGATGCAGGG - Intronic
1027260560 7:76461900-76461922 GCGGGGAGCCGGAGCCTAGCTGG + Intronic
1027311939 7:76960013-76960035 GCGGGGAGCCGGAGCCTAGCTGG + Intergenic
1027392956 7:77723856-77723878 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
1027658309 7:80958983-80959005 CCCGGGAGGCGGAGCTTGCAGGG - Intergenic
1027759389 7:82258901-82258923 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1027987091 7:85307262-85307284 CCCGGGAGGCGGAGCTTGCAGGG - Intergenic
1028065150 7:86375394-86375416 CCTTGGGGGTGGAGCCAAGATGG + Intergenic
1028137588 7:87238655-87238677 ACTCGGAGGAGGAGCCAAGATGG + Intergenic
1028521030 7:91731006-91731028 CCTGGGAGGCCGAGGCTGGCGGG - Intronic
1029044496 7:97613653-97613675 TGTGGGAGGAGGAGCCAAGATGG + Intergenic
1029258054 7:99282720-99282742 GCTGGGAGGCTGAGGCGAGAGGG + Intergenic
1029636209 7:101785938-101785960 CTTGGGAGGCTGAGACAAGAGGG + Intergenic
1029861357 7:103575951-103575973 CCTGGAAGGCGGAGGTTACAGGG - Intronic
1030457701 7:109794980-109795002 TGTGGGAGGTGGAGCCAAGATGG + Intergenic
1030637128 7:111963190-111963212 TCTAGGAGGAGGAGCCAAGATGG + Intronic
1030658176 7:112191196-112191218 CTTGGGAGGCGGAGGCAGGAGGG - Intronic
1030912313 7:115265807-115265829 CCTGGGAGGCGGAGGTTGTAAGG - Intergenic
1031801191 7:126248294-126248316 CCTGGGAGGCGGAGCTTGCAGGG - Intergenic
1032206945 7:129874383-129874405 CCTAGGAGGCGTAGCCTGCAGGG - Intronic
1032208464 7:129890453-129890475 CCTGGGAGGCGGAGGTTGTAGGG - Intronic
1032557605 7:132853544-132853566 CCTGGGAGGCGGAGGTTGTAGGG + Intronic
1032762148 7:134953398-134953420 CCTGGGAGGCAGAGGTTAGCTGG + Intronic
1033504463 7:141986096-141986118 GCTGGGGGGAGGAGCCAAGATGG - Intronic
1033690984 7:143736867-143736889 TCTGGGAGGCCGAGGCTAGGTGG - Intergenic
1034329812 7:150272764-150272786 CCTGGGAGGTGGAGGCTACAGGG - Intronic
1034624203 7:152480059-152480081 CCTGGGAGGCGGAGGTTGTAGGG - Intergenic
1034668244 7:152837098-152837120 CCTGGGAGGTGGAGGCTACAGGG + Intronic
1035031409 7:155863458-155863480 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
1035107504 7:156454508-156454530 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
1035171372 7:157019199-157019221 CACGCGAGGCGGAGCCTAGCTGG + Intergenic
1035178719 7:157073779-157073801 GTTGGGAGGTGGAGCCTAGTGGG - Intergenic
1035459490 7:159030265-159030287 CCCGGGAGGCGGAGCTTGCAGGG + Exonic
1035482801 7:159201141-159201163 CCCGGGAGGCGGAGCTTGCAGGG - Intergenic
1035935626 8:3834735-3834757 TCTCGGAGGTGGAGCCAAGATGG + Intronic
1036184365 8:6611692-6611714 CCCGGGAGGCGGAGCTTGCAGGG - Intronic
1036395926 8:8371334-8371356 CCCGGGAGGCGGAGCTTGCAGGG - Intronic
1036689865 8:10938409-10938431 GCTGGGGGGAGGAGCCAAGATGG - Intronic
1037271386 8:17134518-17134540 CCTGGGAGGTGGAGCTTGCAGGG - Intergenic
1037407845 8:18562811-18562833 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
1037521459 8:19684088-19684110 CCTGGGAGGCGGAGATTGCAGGG + Intronic
1037695989 8:21224346-21224368 ACTGGGAGACACAGCCTAGAAGG - Intergenic
1037759206 8:21730739-21730761 CCTGGGAGGTGGGACCTTGAGGG - Intronic
1038193221 8:25343072-25343094 CCTGGGAAGCAGAGGTTAGAGGG - Intronic
1038327847 8:26586025-26586047 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
1038345783 8:26731173-26731195 CCTGGGAGGAGGAGGCTGCAGGG + Intergenic
1038921513 8:32090394-32090416 CCTGTGAGGCGGAGGCTGCAGGG - Intronic
1039318037 8:36394590-36394612 ACTGGGGGGAGGAGCCAAGATGG - Intergenic
1039473703 8:37828560-37828582 CCCGGGAGGCGGAGGCTGCAGGG - Intronic
1039498585 8:37999737-37999759 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
1039565831 8:38552033-38552055 CCTGGGAGGCGGAGGTTGCAGGG + Intergenic
1039767570 8:40647058-40647080 TCTGGGGGGAGGAGCCAAGATGG + Intronic
1040098940 8:43480067-43480089 CATGAGAGGTGGAGCCAAGATGG + Intergenic
1040591817 8:48799912-48799934 CATGGGGGGAGGAGCCAAGATGG - Intergenic
1040625939 8:49150104-49150126 CCTGGGAGGTGGAGGTTACACGG + Intergenic
1040906012 8:52470419-52470441 GCTGGGAGGTGGGGCCTAGTGGG + Intergenic
1041308564 8:56489749-56489771 CTTGGGAGGCTGAGGCAAGAGGG + Intergenic
1041541003 8:58984705-58984727 CCCGGGAGGCGGAGCTTGCAGGG + Intronic
1042242215 8:66675676-66675698 CCTGGGAGGCGGAGATTGCAGGG - Intronic
1042314703 8:67413192-67413214 CCTGGGAGGCGGAGGTTGCAGGG + Intergenic
1042332616 8:67596018-67596040 ACTGGGGGGAGGAGCCAAGATGG - Intronic
1042332697 8:67597272-67597294 CCTGGGAGGCGGAGTTTGCAGGG - Intronic
1042487073 8:69357416-69357438 CCTGGGAGGAGGAGCCAAGATGG - Intergenic
1042826496 8:72985213-72985235 CCTGGGAGGTGGAGGCTGCAGGG + Intergenic
1043271083 8:78334440-78334462 GCTGGGAGGCGGGGCCTAGTGGG - Intergenic
1043321279 8:78989391-78989413 CCTGGGAGGCGGAGCTTGCAAGG + Intergenic
1043454066 8:80396303-80396325 CTCGGGAGGCTGAGCCTAGGAGG - Intergenic
1043461563 8:80465657-80465679 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
1043555582 8:81427208-81427230 CCAGGGGGGAGGAGCCAAGATGG + Intergenic
1044268520 8:90211828-90211850 GTTGGGAGGTGGAGCCTAGTGGG - Intergenic
1044693001 8:94896657-94896679 CCGGGGAGACGGAGCCTCGCGGG + Exonic
1044746450 8:95375717-95375739 GCTAGGAGGAGGAGCCAAGATGG - Intergenic
1044883109 8:96744485-96744507 ACTAGGAGGAGGAGCCAAGATGG - Intronic
1045326074 8:101118780-101118802 CCTTGGAGCTGGAGCCCAGAGGG + Intergenic
1045456075 8:102380316-102380338 CCTGGGAGGCTGAGACTGCAGGG + Intronic
1045461225 8:102427413-102427435 CCTGGCAGGCGGAGCGGAGCAGG - Intergenic
1046494942 8:115000990-115001012 CCTGGGAGGCGGAGCTTGCAGGG + Intergenic
1046626261 8:116579526-116579548 CCTGGGAGGCGGAGGTTGCAGGG + Intergenic
1046704372 8:117434313-117434335 CCCGGGGGGTGGAGCCAAGATGG + Intergenic
1046930922 8:119841065-119841087 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1046997972 8:120545266-120545288 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
1047149452 8:122244415-122244437 CCGGGGGGGAGGAGCCAAGATGG + Intergenic
1047191515 8:122682953-122682975 CCCGGGAGGCGGAGCTTGCAGGG + Intergenic
1047209762 8:122831909-122831931 CTTGGGAGGTGGTGCCTAGCGGG + Intronic
1047460050 8:125054741-125054763 CCCGGGAGGTGGAGCCTGCAGGG + Intronic
1048077313 8:131085816-131085838 GCTGGGAGGTGGAGCCTAGTGGG + Intergenic
1048162358 8:132032829-132032851 ACTGGGAGGCTGAGCCTGGGGGG - Intronic
1048486499 8:134852569-134852591 CCTGGGAGGTCGAGGCTACAGGG + Intergenic
1048627010 8:136196204-136196226 CTTGGGGGGAGGAGCCAAGATGG - Intergenic
1048849268 8:138629230-138629252 CCTGGGAGGCAGAGACTGCAGGG - Intronic
1048854785 8:138677101-138677123 TGTGGGAGGAGGAGCCTAAAGGG + Intronic
1049195360 8:141312810-141312832 CCACGGAGGTGGAGGCTAGAGGG + Intergenic
1049277103 8:141725363-141725385 CCTGGCAGGCAGAGCCCAGCAGG - Intergenic
1049614220 8:143569182-143569204 CCTGGGAGGCGGGGCCTGGGAGG + Intronic
1049614262 8:143569289-143569311 CCTGGGAGGGAGAGACTGGAAGG + Intronic
1049614294 8:143569364-143569386 CCTGGGAGGGAGAGACTGGAAGG + Intronic
1049897249 9:119510-119532 CCCGGGAGGCGGAGCTTGCAGGG - Intergenic
1049997270 9:1045243-1045265 CCCGGGAGGCGGAGCTTGCAGGG - Intergenic
1049999382 9:1060065-1060087 CCCGGGAGGCGGAGCTTGCAGGG + Intergenic
1050020472 9:1279522-1279544 CCCGGGAGGCGGAGCTTGCAGGG - Intergenic
1050057154 9:1667735-1667757 CCCGGGAGGCGGAGCTTGCAGGG - Intergenic
1050070665 9:1809476-1809498 CCCGGGAGGCGGAGCTTGCAGGG + Intergenic
1050083598 9:1940910-1940932 CCCGGGAGGCGGAGCTTGCAGGG + Intergenic
1050110568 9:2211358-2211380 CCCGGGAGGCGGAGCTTGCAGGG - Intergenic
1050116852 9:2272033-2272055 CCCGGGAGGCGGAGCTTGCAGGG - Intergenic
1050205825 9:3195223-3195245 CCCGGGAGGCGGAGCTTGCAGGG + Intergenic
1050244058 9:3669376-3669398 CCCGGGAGGCGGAGCTTGCAGGG - Intergenic
1050435086 9:5600402-5600424 CCTGGGAGGCGGAGGTTGCAGGG + Intergenic
1050488997 9:6167302-6167324 CCCGGGAGGCGGAGCTTGCAGGG + Intergenic
1050500747 9:6295352-6295374 GCTGGGAGGTGAAGCCAAGATGG + Intergenic
1052245531 9:26329683-26329705 CCTGGGAGGCTGGGCATTGATGG - Intergenic
1052513374 9:29450388-29450410 CCTTAGAGGAGGAGCCAAGATGG + Intergenic
1052836997 9:33258218-33258240 CCTGGCAGGCAGAGGCTACAGGG + Intronic
1052926806 9:34023966-34023988 CCTGGGAGGCGGAGTCTGCAGGG + Intronic
1053221778 9:36318594-36318616 CCTGGGAGGCAGAGGTTACAGGG + Intergenic
1053233972 9:36435703-36435725 CCCGGGAGGCGGAGCTTGCAGGG - Intronic
1054961424 9:70974461-70974483 CCCGGGAGGCGGAGCTTGCAGGG + Intronic
1055215006 9:73848751-73848773 CCAGGGAGGCGGAGCTTGCAGGG + Intergenic
1055646842 9:78369110-78369132 CCTGGGAGGCGGAGGTTGCAGGG + Intergenic
1055718434 9:79144543-79144565 CCCGGGAGGCGGAGCTTGTAGGG - Intergenic
1056861802 9:90192186-90192208 ACTGGGGGGTGGAGCCAAGATGG + Intergenic
1057329067 9:94095086-94095108 CCTGAGGGGAGGAGCCAAGATGG - Intronic
1057615245 9:96583792-96583814 CCCGGGAGGCGGAGCTTGCAGGG - Intronic
1057621399 9:96639168-96639190 CCCGGGAGGCGGAGCTTGCAGGG - Intergenic
1057747254 9:97762140-97762162 TCAGGTAGGTGGAGCCTAGAGGG + Intergenic
1057844055 9:98508274-98508296 CTGGGGAGGAGGAGCCAAGATGG + Intronic
1058118219 9:101108157-101108179 CCTGAGGGGAGGAGCCAAGATGG - Intronic
1058484196 9:105427009-105427031 CCTAGGAGGCGGAGGTTGGAGGG - Intronic
1058815518 9:108679567-108679589 CCTGGGAGGCGGAGGTTGCAAGG - Intergenic
1059429868 9:114243531-114243553 CCTGGGAGGCCCGGCCTGGATGG + Exonic
1060396340 9:123319441-123319463 CCTCGGAGGGAGAGCATAGAGGG - Intergenic
1060605030 9:124906035-124906057 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
1060843745 9:126817549-126817571 CCTGGGAGGCGGAGCTTGCAGGG - Intronic
1061118013 9:128626888-128626910 CCTGGGAGGTTGAGGCTACAGGG - Intronic
1061142248 9:128774418-128774440 CCTGGGAGGCGGAGCTTGCAGGG + Intergenic
1061156128 9:128862898-128862920 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1061376295 9:130226637-130226659 GCTGGGAGGAGGAGGCTGGAAGG + Intronic
1061474009 9:130850997-130851019 CCCGGGAGGCGGAGCTTGCAGGG - Intronic
1061754319 9:132802291-132802313 CCTGGGAGGAGTAGCAAAGAAGG - Intronic
1061762327 9:132859342-132859364 CCTGGGAGGCTGAGCCTGGGAGG - Intronic
1061797582 9:133097174-133097196 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
1061822918 9:133238562-133238584 CGGGGGAGGCGGGGCCGAGAAGG + Intergenic
1061966969 9:134020447-134020469 CCTGGGAGGCTGAGGCAGGAGGG - Intergenic
1062455357 9:136634547-136634569 CCTGGGAGGCGGAGGCTGCTGGG - Intergenic
1062632380 9:137470132-137470154 CTTGGGAGGCGGAGGCAGGAGGG - Intronic
1062633010 9:137474943-137474965 CCTGGGAGGCGGAGCTTGCAGGG + Intronic
1203743644 Un_GL000218v1:24595-24617 CCTGGGAGGTGGAGCTTGCAGGG + Intergenic
1203362726 Un_KI270442v1:231580-231602 CCTGGGAGGCGGAGCATGCAGGG - Intergenic
1203710761 Un_KI270742v1:95137-95159 AATGGGAGGAGGAGCCAAGATGG + Intergenic
1203540293 Un_KI270743v1:82309-82331 AATGGGAGGAGGAGCCAAGATGG - Intergenic
1185460250 X:329967-329989 CCCGGGAGGCGGAGCTTGCAGGG - Intergenic
1185642714 X:1597440-1597462 CCTGGGAGGCGGTCCCTGGGAGG + Intronic
1185648783 X:1633712-1633734 CCCGGGAGGCGGAGCTTGAAGGG - Intronic
1185713500 X:2322997-2323019 CCTGGGAGGCGGAGATTGCAGGG - Intronic
1185774568 X:2792204-2792226 CCTGGGAGGCGGAGTTCAGTTGG + Intronic
1185879570 X:3729167-3729189 CTTGGGAGGCTGAGCCTGGGAGG - Intergenic
1185906654 X:3939830-3939852 CCCGGGAGGCGGAGGTTGGAGGG - Intergenic
1185972707 X:4682297-4682319 CCTGGGAGGCAGAGGCTGCACGG + Intergenic
1186018427 X:5226027-5226049 CCTGGGAGGCGGAGCTTGCAGGG + Intergenic
1186091793 X:6056398-6056420 CCTGGGAGGCGGAGGTTGTAGGG + Intronic
1186436384 X:9546436-9546458 CCCGGGAGGCGGAGCTTGCAGGG + Intronic
1186719430 X:12287319-12287341 CCTGGGAGGCTGATCCTATCAGG - Intronic
1186799265 X:13077086-13077108 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
1186897911 X:14023453-14023475 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1186923440 X:14306636-14306658 CCCGGGAGGCGGAGCTTGCAGGG + Intergenic
1187105445 X:16236838-16236860 CCTGGGGGGGGCAGCCAAGATGG - Intergenic
1187115867 X:16350055-16350077 CCTGGGAGGCGGAGGCTGCAGGG - Intergenic
1187116742 X:16360073-16360095 ACTGGGAGGGGCAGCCAAGATGG + Intergenic
1187351355 X:18520810-18520832 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1187973417 X:24681219-24681241 CCCGGGAGGCGGAGCTTGCAGGG + Intergenic
1188525478 X:31083445-31083467 CTTGGGGGGTGGAGCCAAGATGG - Intergenic
1188791056 X:34408560-34408582 CCTGGGAGGCGGAGCTTGCAGGG + Intergenic
1188857985 X:35221416-35221438 CCAGGGGGGAGGAGCCAAGATGG + Intergenic
1189788299 X:44579484-44579506 CTTGGGAGGCTGAGGCGAGAGGG + Intergenic
1189847805 X:45152280-45152302 CCTGGGAGGCGGAGGTTGCAGGG + Intronic
1190080920 X:47356257-47356279 CCCGGGAGGCGGAGCTTGCAGGG - Intergenic
1190272409 X:48876255-48876277 CTTGGGAGGCTGAGCTTAGGAGG + Intergenic
1190616801 X:52242388-52242410 CCCGGGAGGCGGAGACTGCAGGG + Intergenic
1190853520 X:54270179-54270201 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1191023927 X:55893393-55893415 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
1191039809 X:56067428-56067450 CATGAGAGGCAGTGCCTAGATGG + Intergenic
1191098091 X:56695881-56695903 CAGGGGAGGAGGAGCCAAGATGG + Intergenic
1191123192 X:56926967-56926989 CCTGGGAGGGAGCTCCTAGAAGG - Intergenic
1191698979 X:64019268-64019290 CTCGGGAGGAGGAGCCAAGATGG - Intergenic
1192055155 X:67766408-67766430 GGTGGGAGGCGGAGCATGGAGGG - Intergenic
1192458743 X:71299689-71299711 CCTGGGAGGCGGAGGTTGCAGGG - Intronic
1192668722 X:73116906-73116928 ACAGGGAGGAGGAGCCAAGATGG + Intergenic
1192884153 X:75319639-75319661 CATGGGGGGTGGAGCCAAGATGG - Intergenic
1193051426 X:77103532-77103554 ACTTGGAGGTGGAGCCAAGATGG - Intergenic
1193303931 X:79926796-79926818 CTTGGGAGGAGGAGCCAAGATGG + Intergenic
1193395884 X:80982788-80982810 ACTGGGGGGAGGAGCCAAGATGG - Intergenic
1193699671 X:84745538-84745560 CCTGGGAGGCGGAGGCTACAGGG - Intergenic
1193931751 X:87561850-87561872 TCTGGGAGGTGGGGCCTGGATGG - Intronic
1194880960 X:99251854-99251876 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
1195089052 X:101441104-101441126 CCCGGGGGGTGGAGCCAAGATGG - Intronic
1195832345 X:109072719-109072741 TCTGGGGGGTGGAGCCAAGATGG - Intergenic
1196717287 X:118823929-118823951 CCTGCAAGGCGGAGACCAGAAGG + Exonic
1196761157 X:119202279-119202301 CCTGGGAGGCGGAGGTTGCAGGG - Intergenic
1196804261 X:119570810-119570832 CCCGGGAGGCGGAGGTTACAGGG - Intergenic
1197220992 X:123913392-123913414 CCTGGGAGGCGGAGGTTGCAGGG + Exonic
1197319568 X:125010736-125010758 CCTGGGAGGTGGAGCTTGCAGGG + Intergenic
1197365059 X:125553922-125553944 CCTGGGAGGCGGAGGTTGCAGGG + Intergenic
1197450025 X:126600942-126600964 CCTGGGAGGCGGAGGTTGCAGGG + Intergenic
1197927641 X:131663949-131663971 ACTGGGAGGAGGAGCCAAGATGG + Intergenic
1198060670 X:133042642-133042664 CCTTGGAGGAGGGGCCAAGATGG - Intronic
1198231805 X:134696955-134696977 CCCGGGAGGCGGAGCTTGCAGGG + Intronic
1199724648 X:150568580-150568602 CGTGGGGGGCGGACCCCAGAGGG + Intergenic
1199764785 X:150933256-150933278 CCTAGGAGGCGGAGGCTGCAGGG + Intergenic
1200633004 Y:5612181-5612203 GCTAGGAGGAGGAGCCAAGATGG - Intronic
1201118577 Y:10855649-10855671 AATGGGAGGAGGAGCCAAGATGG - Intergenic
1201380438 Y:13370980-13371002 CCTGGGAGGTGGAGGCTGCAGGG + Intronic
1201418927 Y:13776715-13776737 TATGGGAGGAGGAGCCAAGATGG - Intergenic
1201494341 Y:14576706-14576728 CATGGGGGGTGGAGCCAAGATGG - Intronic
1201517509 Y:14833862-14833884 ACTGGTAGGTGGAGCCAAGATGG - Intronic
1201671057 Y:16520518-16520540 CCTGGGAAGTGGAGGCTATAGGG + Intergenic
1201717993 Y:17066945-17066967 TCTGGGAGGAGGAGCCAAGATGG - Intergenic
1201968949 Y:19770720-19770742 CCTGGGAGGTGGAGCTTGCAGGG - Intergenic