ID: 1126512954

View in Genome Browser
Species Human (GRCh38)
Location 15:49501292-49501314
Sequence CAAAATGCTGATACTGATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 53, 2: 80, 3: 73, 4: 224}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126512954 Original CRISPR CAAAATGCTGATACTGATAT GGG Intronic
901486619 1:9567710-9567732 TAAAATGCAGATTCTGATGTAGG - Intronic
906760568 1:48373410-48373432 AAAAATTCTGATAGCGATATGGG - Intronic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
909097461 1:71305570-71305592 CAAAATGCTGGGATGGATATTGG + Intergenic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
909236019 1:73153345-73153367 GAAAATGCTGATAGTGATAATGG - Intergenic
909241986 1:73224742-73224764 CAAAATGCAGATACCAATAGCGG - Intergenic
909752459 1:79179593-79179615 CAAAAGCCTGATAGTGATATGGG - Intergenic
911407731 1:97463659-97463681 AAAAATGCTGATAATGATAAGGG + Intronic
912121607 1:106478856-106478878 CAAAATGCTGATGATGATATGGG + Intergenic
912267508 1:108173766-108173788 CAAAATGCTGATAGTAATATGGG + Intronic
915369836 1:155339526-155339548 CAAAATGCTGATAATCATTGTGG - Intronic
916517212 1:165530477-165530499 CAAAATGTTAATAGTGATAATGG + Intergenic
917652619 1:177093952-177093974 ATAAATACTGATACTGATGTTGG + Intronic
918484541 1:185015465-185015487 CAAAATGCTAGTACTAATAAGGG - Intergenic
918547343 1:185700129-185700151 CAAAATGCAGATTCTGATTCAGG + Intergenic
919409787 1:197228546-197228568 CAAAATGCTGATAGTAATATTGG - Intergenic
920927780 1:210358837-210358859 CAAAATGCTGAGAGTGAAAAGGG + Intronic
921274084 1:213500292-213500314 CAAAATGAAGATGGTGATATTGG - Intergenic
921387373 1:214584236-214584258 CAAAGTGCTGCTAGTGATACTGG + Intergenic
921616547 1:217274553-217274575 CAGAATGCTGAAACTGAAATAGG + Intergenic
921996673 1:221426661-221426683 CAAAATGCTGATAATGATAATGG - Intergenic
922950576 1:229555588-229555610 CAAAATGCTGAGACAGATGGAGG + Intronic
923440107 1:234009782-234009804 CAATCTGCTGATAGTCATATTGG - Intronic
924397544 1:243639385-243639407 CATCATCCTGATACTGAGATAGG + Intronic
1063820560 10:9830329-9830351 CATAATGCTTATACTTATCTGGG + Intergenic
1064335144 10:14433640-14433662 CAAAATCCTGAAACTGAAAGTGG + Intronic
1065166188 10:22980175-22980197 AAAAATGCTGATAATAATTTAGG - Intronic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1068233839 10:54206400-54206422 TAAAATTCTGATAGTGATAAAGG + Intronic
1071235009 10:83635043-83635065 TCAAAAGCTGATTCTGATATAGG - Intergenic
1071324921 10:84504187-84504209 CTAAATGCTCATATTTATATGGG - Intronic
1072147016 10:92650668-92650690 CAAAAATCTGATATTGATAAGGG + Intronic
1072296103 10:94010847-94010869 CAAAATACTGATAGAAATATGGG - Intronic
1072366694 10:94718617-94718639 CAAATTGCTGCTCCTGATAGTGG - Intronic
1072857729 10:98967159-98967181 CAAAAAGCTGATATAGATAATGG + Intronic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073670518 10:105582553-105582575 CAAGATTCTGATAATGATATTGG + Intergenic
1074075865 10:110123959-110123981 CCAAATGCTGTTATTGATACAGG + Intronic
1077736923 11:4801083-4801105 CAAAATGCTGATAGAAATATGGG - Intronic
1078393275 11:10955140-10955162 CAAAATGCTGATAGGGATATGGG + Intergenic
1078441001 11:11367779-11367801 TAAATTTCTGATACTGAAATAGG - Intronic
1078836509 11:15035338-15035360 CAAACTGCTGCTACTGATTCGGG - Intronic
1079559520 11:21804561-21804583 CAAAATCCTAACAGTGATATGGG - Intergenic
1079707443 11:23638295-23638317 CAAATTGCTGATAGTGATATGGG - Intergenic
1079838742 11:25367547-25367569 CAAAATGGTGATAATTATATGGG - Intergenic
1080204986 11:29717886-29717908 CAAAATGCTGATAATAATATGGG - Intergenic
1080997171 11:37618383-37618405 CAAAATACTGATAGTAACATGGG + Intergenic
1081122757 11:39286521-39286543 CAAAATACTGATAGCGATATGGG - Intergenic
1082733212 11:56825391-56825413 CAAAATGCTGATAGTAATATGGG - Intergenic
1083078073 11:60062267-60062289 CAAAATGCTGCCACTGGAATTGG + Intronic
1086992082 11:93314431-93314453 TAAAATGCTGATAGTGATATGGG - Intergenic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1088158582 11:106840173-106840195 AAAAATGATGATATTGTTATTGG + Intronic
1088563874 11:111146877-111146899 TAAAAAGTTGATATTGATATAGG + Intergenic
1088726570 11:112642602-112642624 CAAAATCATAATAATGATATGGG - Intergenic
1090506603 11:127321514-127321536 TAAAATGCTGATAGTGTTATGGG - Intergenic
1090607268 11:128434093-128434115 CATAATTCTCATACTGGTATAGG - Intergenic
1092486003 12:8902533-8902555 CAAAATGCTGATAGCGATATAGG - Intergenic
1093726428 12:22516152-22516174 CAAGACACTGATTCTGATATAGG + Intronic
1094421250 12:30273439-30273461 CAAAATGCTGATAGTAATATGGG - Intergenic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1095521804 12:43075559-43075581 CAAATTGCTGATGCTGCTAGAGG - Intergenic
1096118764 12:49072480-49072502 AAAGAGGCTGATACTGCTATAGG - Intergenic
1096662006 12:53131493-53131515 CAAAATGCTGACACAGATGGAGG + Intergenic
1096960340 12:55570708-55570730 CAAAATACTGATAGCAATATGGG - Intergenic
1097343751 12:58468239-58468261 AAAAATGGTGATAGTGATATGGG - Intergenic
1098305714 12:69100530-69100552 AAAAATGTAGACACTGATATGGG + Intergenic
1098741663 12:74179832-74179854 CAAAATGCTTACAGTGATACGGG - Intergenic
1099307676 12:80978164-80978186 AAAAATGCTGATTCTGATGGGGG + Intronic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099495611 12:83342710-83342732 CAAAATGCTGATAGTGGTATGGG + Intergenic
1099607848 12:84828251-84828273 CAAAATGCTAATACTGATATGGG + Intergenic
1099655168 12:85479921-85479943 CAAAATGCTGGTAGTGATATGGG - Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1100778885 12:98002776-98002798 TAAAATGCTGTTACTGACATTGG - Intergenic
1101190359 12:102326181-102326203 TAAAATGCTGATAGTGATATGGG + Intergenic
1101525607 12:105526290-105526312 CAAAGTGAAGAAACTGATATTGG + Intergenic
1101526465 12:105535651-105535673 CAAAATGCTGATAGGGATATGGG - Intergenic
1104142609 12:126003367-126003389 CAAAATGCTGATAGTGATGTAGG + Intergenic
1104390790 12:128389190-128389212 CAAATTCCAGATACTGATCTGGG + Intronic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1107013746 13:35692725-35692747 CAAAATGCTGTGACTGAGTTGGG + Intergenic
1109359703 13:61280214-61280236 CAAAATGCTAATAGTGATATTGG + Intergenic
1110007662 13:70293249-70293271 CAAAATGTTGATGGTGATATGGG + Intergenic
1110822759 13:79935673-79935695 GAAAATGCTGATAATCATAATGG - Intergenic
1111221242 13:85207840-85207862 CAAAGTGCTGATAGTGATATGGG + Intergenic
1112453625 13:99536523-99536545 CAAAGTGATGACACTGATTTGGG + Intronic
1112859015 13:103807793-103807815 CAAAATGCTGGTAGTTACATGGG + Intergenic
1112861455 13:103833063-103833085 CAAAATACTGATACTGATATTGG + Intergenic
1113344520 13:109463120-109463142 AAATATGCTGATACTTATATTGG + Intergenic
1113597217 13:111541815-111541837 TGAAATGCAGATACTGATCTAGG + Intergenic
1113714827 13:112496031-112496053 CTCAATGCTGCTGCTGATATGGG - Intronic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114917271 14:27284740-27284762 CAAAATGCTGATAAAGATTTTGG + Intergenic
1114961278 14:27893089-27893111 CAAAATGTTGATAATCATATGGG + Intergenic
1115713553 14:36076698-36076720 CAAAAAGCAGAGCCTGATATAGG - Intergenic
1115884551 14:37956690-37956712 AAAAAAATTGATACTGATATAGG - Intronic
1116147848 14:41098975-41098997 CAAAATGCTGATAGCAATATGGG + Intergenic
1116784036 14:49268240-49268262 CAAAATGCTGATAGTGATTTGGG + Intergenic
1116904509 14:50391948-50391970 CAAAGTGGAGATAATGATATGGG - Intronic
1119114084 14:72002251-72002273 CCAAATGCTGATAAAGAAATTGG + Intronic
1119446696 14:74670675-74670697 CAAAATTATGAAACTGATCTGGG - Intronic
1120072723 14:80122036-80122058 CAAAATGCTGATAGAAATATGGG + Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1120799874 14:88676000-88676022 CAAAATGCTGATGATGACACAGG - Intronic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1123827176 15:24093734-24093756 CACAATGCTGATAGTGACATGGG - Intergenic
1123841782 15:24254613-24254635 CACAATGCTGATAGTGACATGGG - Intergenic
1123861159 15:24468067-24468089 CACAATGCTGATAGTGACATGGG - Intergenic
1124087712 15:26567027-26567049 CAAAATGCTAAAAATAATATTGG + Intronic
1125295508 15:38198618-38198640 AAAAATGCTGATACTGTGACTGG - Intergenic
1126234344 15:46365315-46365337 CAAAACCCAGATAATGATATTGG - Intergenic
1126459650 15:48901419-48901441 CATAATTCTTATACTGACATAGG - Intronic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1128906912 15:71475497-71475519 TAAAATGCAGATCCTGATTTAGG + Intronic
1130762233 15:86832664-86832686 CAAAATGCTGACAGTGATATGGG - Intronic
1131410101 15:92200401-92200423 CAAAATGCTGATAGAAATATGGG + Intergenic
1131453657 15:92566408-92566430 CAAAATGCTCATAGAAATATGGG - Intergenic
1131587506 15:93712027-93712049 CAACCTGGTGATACTGATTTTGG - Intergenic
1131657674 15:94478504-94478526 AAAAATGCTGAAATTGATACTGG - Intronic
1136662808 16:31780059-31780081 CAAAATGCTGGTAGTGATATGGG + Intronic
1137462619 16:48679371-48679393 CAAATTGATGATACTGAGGTGGG + Intergenic
1137928612 16:52565323-52565345 CAACATGCTGACACTGAACTTGG + Intergenic
1139041240 16:63001518-63001540 CAAAATGCTGATAGTAATGTGGG + Intergenic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1139398285 16:66658572-66658594 CAAAATCCTGATACCCACATTGG + Intronic
1140468063 16:75197912-75197934 CAAAATGCGGATGCTGAGGTGGG - Intergenic
1142909981 17:3080656-3080678 CAAAATGTTGAAAGTGATAATGG - Intergenic
1143862946 17:9904635-9904657 CGAGATGCTGATATTGATAGAGG - Intronic
1147839782 17:43363049-43363071 CAGAATACGGATACTGATGTGGG + Intergenic
1149025004 17:52017343-52017365 CAAAATGCTGATAGAAACATTGG + Intronic
1150989944 17:70245553-70245575 TAAAATGATGATAATGATAATGG - Intergenic
1151387558 17:73764425-73764447 CAAGATGCCCATGCTGATATTGG - Intergenic
1152048501 17:77954821-77954843 CACTATGCTGATAATAATATTGG - Intergenic
1154468073 18:14669146-14669168 CAAATAGCTGAGACTAATATAGG + Intergenic
1156105812 18:33659028-33659050 GTATATGCTGATACTGAAATAGG + Intronic
1156178196 18:34572468-34572490 CAAAAAGATGATAATAATATTGG - Intronic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1156274330 18:35568498-35568520 CAAAATGAGGAAATTGATATTGG - Intergenic
1157194549 18:45610198-45610220 CAAAATACAGATTCTGTTATGGG + Intronic
1158911244 18:62065049-62065071 CCAAAGGCTGATACTGATGCAGG + Intronic
1166017420 19:39993266-39993288 TAAAATGCTGATAGTGATAACGG + Intronic
1166619628 19:44284506-44284528 CATATTTCTGATACAGATATAGG + Intronic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
925638535 2:5965658-5965680 CAAAATGCCGATAGTGATATGGG - Intergenic
927019782 2:19004697-19004719 TGAAATGCTCAGACTGATATGGG - Intergenic
927056384 2:19369286-19369308 GGAAATGCTGATGCTGAGATGGG - Intergenic
929081501 2:38126948-38126970 CAAAATGCTCATAGTGATATGGG + Intergenic
929612688 2:43283485-43283507 CAAAATGCTGACAGTGATATGGG + Intronic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
930952243 2:57156868-57156890 AAAAATGCTGATAGAGATATGGG - Intergenic
931453512 2:62388359-62388381 CAGAATGCTGAGACTGAGGTGGG - Intergenic
931621534 2:64215539-64215561 CAAAATGCAGAGACTGCTATTGG + Intergenic
933046104 2:77539308-77539330 CAAAATGCTGATTGTGATATGGG + Intronic
935330051 2:101970342-101970364 CAAAATGCAGATAGAAATATGGG - Intergenic
936850889 2:116896334-116896356 AAAAATGCTGATAGTGATATAGG - Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
936974725 2:118207690-118207712 TAAAGTGCTGATTCTGATTTAGG + Intergenic
937659697 2:124416691-124416713 TAAAATGGTGATAATGATAATGG + Intronic
938283045 2:130080844-130080866 CAAGCTGCTCACACTGATATTGG - Intronic
938356141 2:130651273-130651295 CAAGCTGCTCACACTGATATTGG + Intronic
938432565 2:131258055-131258077 CAAGCTGCTCACACTGATATTGG + Intronic
939482770 2:142770371-142770393 CAAAATGCTGATAGTGACATGGG + Intergenic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940621644 2:156120989-156121011 CAAAATGCTAATAGTGATATGGG + Intergenic
941357254 2:164509723-164509745 TAAAATGCAGATACTGATTCAGG - Intronic
941570359 2:167162117-167162139 CCGAATGCTGATAATGATACAGG - Intronic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
941774781 2:169381131-169381153 CAACATGATAAAACTGATATAGG + Intergenic
941797996 2:169622555-169622577 CAGATTGCTGAAACTGATAAGGG - Intronic
943223583 2:185140695-185140717 CAAAAAGCCGATAGTGATGTGGG - Intergenic
943719241 2:191185757-191185779 CATAATGAGGATACTGACATTGG + Intergenic
944048999 2:195445226-195445248 AAAAAAGTTGATACTGATTTTGG - Intergenic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
947889731 2:233606326-233606348 CAAAACGCTGATAAAAATATGGG - Intergenic
1170304838 20:14926919-14926941 CAAATTGATGATAATTATATTGG + Intronic
1170725164 20:18919682-18919704 CACAATGCTGATAGTGATATGGG + Intergenic
1171940349 20:31322890-31322912 CAAAATGCTGACACAGAGAGAGG + Intergenic
1173323519 20:42010746-42010768 CAAAATGCTGACAGTGATAATGG - Intergenic
1173657550 20:44710857-44710879 TAAAATGCAGATCCTGATAGTGG + Intergenic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1176704231 21:10099171-10099193 TAAAATGATAATACTAATATTGG - Intergenic
1176806442 21:13488504-13488526 CAAATAGCTGAGACTAATATAGG - Intergenic
1177348897 21:19909756-19909778 CCAAATGTTTATACTGATGTAGG + Intergenic
1177394180 21:20511550-20511572 TAAAATGCTGATAGTGATATGGG - Intergenic
1177604557 21:23360804-23360826 CAAAACGCTGATAGTGATACGGG - Intergenic
1177614664 21:23501168-23501190 CAAAATGCTGGTAGTGATATGGG + Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1177754475 21:25329455-25329477 TAAAATGATGATTCAGATATAGG - Intergenic
1177992730 21:28058182-28058204 CTAAATGCTGACAATGATATGGG + Intergenic
1178143882 21:29716492-29716514 CAAAATGCTGATAGTAATGTGGG + Intronic
1178149665 21:29779842-29779864 CAAAATGTAGATAGTGAGATTGG + Intronic
1178948851 21:36969414-36969436 CAAAATGCAGACGCTGATTTGGG - Intronic
1179156464 21:38855975-38855997 CAAAATGCTGATAATAATAGGGG + Intergenic
1179306333 21:40156710-40156732 CACAATGGTGGTAGTGATATAGG + Intronic
1179566006 21:42249632-42249654 CAAAATGATGATGCTGATGATGG - Intronic
1180685776 22:17665327-17665349 CAAAATGCTGACAGTGATATGGG - Intronic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
951168385 3:19508736-19508758 TAAAATGCAGATTCTGACATGGG - Intronic
951394526 3:22149129-22149151 TAAAATGCAGATTCTGATACAGG - Intronic
951503366 3:23415345-23415367 AAAAATACTGATACAGACATAGG - Intronic
952389062 3:32864478-32864500 CAAAAAGCAGATTCTGATCTGGG + Intronic
955675566 3:61444679-61444701 CAAAAAGCTGATGAAGATATGGG - Intergenic
957556988 3:81774709-81774731 CAAAATGAAGAAACTGACATTGG - Intergenic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
958493466 3:94809926-94809948 CAAAATCCTGATTCTTATGTAGG + Intergenic
958551524 3:95620010-95620032 CAAAATGGTGATTCTGAAATTGG + Intergenic
958813877 3:98894443-98894465 CAAATTGCTGGCACTGATTTAGG + Intronic
959124169 3:102270245-102270267 TATAATGCTGATAATGTTATTGG + Intronic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
962139564 3:132774272-132774294 CAATATCTTGATAGTGATATGGG - Intergenic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963433805 3:145242550-145242572 CAACATGCTGATAGTGATAAGGG - Intergenic
963539566 3:146567790-146567812 CAAAATGATGATAGTGATATGGG - Intergenic
964076786 3:152701462-152701484 CAGAATGCTCATAGTGATAGTGG - Intergenic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
965232713 3:166073438-166073460 AAAAATGCTGATAGAAATATGGG - Intergenic
965326460 3:167310228-167310250 CAAAATGCTTATAGTGATAATGG - Intronic
965349305 3:167594280-167594302 CAAAATGTTCATAGTGATATGGG + Intronic
966012894 3:175103179-175103201 TAAAATGCTGCTTCAGATATAGG + Intronic
966075783 3:175935602-175935624 CAAAATGCAGGTAGTGATATGGG + Intergenic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
970058516 4:12002438-12002460 CAAAATGGTGATTCTAATAATGG + Intergenic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970656053 4:18230880-18230902 CAAAATAATGATACTAAAATAGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
971546205 4:27890522-27890544 CAAAATGTTGATAGTGATATGGG + Intergenic
972896022 4:43620928-43620950 CAAAATGCTGATAGTAATATGGG - Intergenic
973072045 4:45873891-45873913 GACAATGCTGGTACTGAAATGGG - Intergenic
973131451 4:46653509-46653531 CACAATGGTGGTACTGGTATTGG + Intergenic
973539345 4:51920632-51920654 CTAAATGCTGATGAGGATATAGG - Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
974185089 4:58435211-58435233 AGAGATGCTGATACTGATATTGG - Intergenic
974637921 4:64589675-64589697 CAGAATGCTGATAGTGATATGGG + Intergenic
974702562 4:65470919-65470941 CAAAATTCAGATATTGTTATAGG - Intronic
974724105 4:65777061-65777083 CAAAATTCTGATAATGATACGGG + Intergenic
975489358 4:74971520-74971542 CAAAATGCTGTTAATAAAATAGG - Intronic
975891904 4:79039754-79039776 CAGACTGCTTATATTGATATTGG + Intergenic
976023718 4:80662556-80662578 CAAAATGCTGCTACTTAATTTGG + Intronic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
978595076 4:110368704-110368726 AAAAATGCTGATAATGAAACTGG - Intronic
979060987 4:116059935-116059957 CAAAGTGCTGATAGTGATGTGGG - Intergenic
979125708 4:116969397-116969419 CAAAATGCTAATAGTGCTATTGG - Intergenic
979423857 4:120540163-120540185 CAAAATGCTTATAGTCATGTTGG - Intergenic
979942173 4:126775335-126775357 CAAAACACTGAAAGTGATATTGG - Intergenic
980731818 4:136833585-136833607 CAAAAGCCTGGTAGTGATATGGG + Intergenic
981343249 4:143647051-143647073 TAAAATGTTGATAGTGATATGGG + Intronic
981355372 4:143783941-143783963 CAAAATGCTGGTAGAAATATGGG + Intergenic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
981412066 4:144443373-144443395 CAAAATGCTGTTAGTAATACGGG - Intergenic
981503193 4:145474189-145474211 CAAAATGCTAATAGTGATATGGG - Intergenic
981842887 4:149132918-149132940 TAAAATGCTGATAGTGATATGGG + Intergenic
982210281 4:153029194-153029216 CAAAATGCTGATAGAAATATGGG - Intergenic
982262835 4:153510117-153510139 CCAAAGGCTGATACTAATTTGGG - Intronic
982512373 4:156299254-156299276 CAAAATGGAGATACTCATCTTGG - Intergenic
982762231 4:159299075-159299097 CAAAACCCTGACAATGATATGGG + Intronic
982894378 4:160899316-160899338 CCAAATGTTGATACTGGTATTGG + Intergenic
983320427 4:166190070-166190092 GAAAATGCTGATAATGATATGGG + Intergenic
983379032 4:166967892-166967914 CAAAATGCTGATAGTGATGTGGG + Intronic
983660360 4:170125563-170125585 TAAAATGCTGATAATGATATTGG + Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
984131358 4:175879139-175879161 CAAAATGCTAATAATGATATGGG - Intronic
984512358 4:180694017-180694039 CAAAATACTAATAGTGATATAGG - Intergenic
985127555 4:186709993-186710015 AAGAATGTTGATACTTATATTGG - Intronic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
986165356 5:5267868-5267890 CAAAGATCTGATTCTGATATGGG - Intronic
986447485 5:7835169-7835191 AAAAATGCTGACACAGAGATAGG + Intronic
986537426 5:8805375-8805397 CAAAATGCTGATAGTAATATGGG + Intergenic
986911693 5:12565592-12565614 CAAAATGTCGATAATGATATTGG - Intergenic
987459955 5:18197400-18197422 CAAAATGCTGAAAGAAATATGGG + Intergenic
987533209 5:19148797-19148819 CAAAATGCTGATAGTGACGAGGG - Intergenic
987748098 5:22003963-22003985 CAAAGTGCTGAGACAGAAATGGG - Intronic
987918647 5:24249435-24249457 CAAAATGCTGACAGTGACATGGG - Intergenic
988009510 5:25464379-25464401 CATAATGCTGATAGTAATATGGG + Intergenic
988038849 5:25861985-25862007 CAAAATGCTGATAGTAATATGGG - Intergenic
988076760 5:26363821-26363843 CAATATGCTGATAGTGATAAGGG + Intergenic
988456307 5:31390007-31390029 CAAAATGCTAATAGTGATATGGG - Intergenic
988876866 5:35456644-35456666 CAAAATGCTGATGGTGATAGGGG + Intergenic
988995522 5:36711358-36711380 GAAAATGCTGCTATTGAAATGGG - Intergenic
989319087 5:40114150-40114172 TAAAATGCTGATACTGTGTTAGG + Intergenic
989501963 5:42178059-42178081 TGAAATGCTAATAGTGATATGGG - Intergenic
989677025 5:43984164-43984186 CAAAATGCTGACAGTGACATGGG - Intergenic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
990075844 5:51844583-51844605 CAAAATGCCAATAGGGATATAGG - Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
991074707 5:62522178-62522200 CAAAATGCTGATCTTGAAGTTGG - Intronic
991186487 5:63814842-63814864 CAAAATGCTGATAGTGACATGGG + Intergenic
992504060 5:77368089-77368111 CTAAATGCTGCTACTGAAAATGG - Intronic
992822288 5:80509437-80509459 CAAAGTGCTGATACTTAAAGAGG - Intronic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
993792625 5:92225203-92225225 CAAAATACTGATAGTGAGATGGG - Intergenic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994342016 5:98641379-98641401 CCATATGCTGTTACTAATATTGG - Intergenic
994849569 5:105036671-105036693 CAAAACCCTGATAGTGATATGGG - Intergenic
995211964 5:109550959-109550981 CAAAATGCTGATAGCCATATGGG + Intergenic
995591386 5:113703947-113703969 CAAAATGAAGATATTGAAATGGG - Intergenic
995779893 5:115763660-115763682 CAAAATGGTTTTAGTGATATGGG - Intergenic
996775997 5:127133320-127133342 AAAAATGCTGCTACAGACATGGG + Intergenic
1000205604 5:159055496-159055518 TAAATTGCTCATTCTGATATGGG - Intronic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1000768416 5:165319765-165319787 CAAAAAGCTGATAGTGATATGGG - Intergenic
1000788141 5:165571317-165571339 GAAAATGTTGATAATGATGTGGG - Intergenic
1003798236 6:9630197-9630219 CCAAATGCTGATAGTGACATGGG + Intronic
1004324043 6:14657468-14657490 CACAATGCTGATAGGGCTATTGG - Intergenic
1006003626 6:30986058-30986080 CAAAATGTTGATACTGGGCTGGG - Intronic
1006344060 6:33465786-33465808 CAAAATGCTGATAGCAATATGGG + Intergenic
1006508931 6:34511312-34511334 GAAAATGCAGATTCTGATGTGGG + Intronic
1008284012 6:49627405-49627427 CAAAATGGTGATAGTGAGATGGG - Intronic
1008379812 6:50828257-50828279 CAAATTGCTCTTACTAATATTGG + Intronic
1009635004 6:66253751-66253773 CCAAATGCTGATAATGATATGGG - Intergenic
1009710119 6:67307579-67307601 CACAACGCTGATAGTGATAATGG + Intergenic
1009732082 6:67621728-67621750 AAAAATACTGATAATGATATGGG + Intergenic
1010134174 6:72531223-72531245 CAAAATGCTGATATTGTAACTGG + Intergenic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1010713966 6:79207029-79207051 TAAAATGGGGATACAGATATTGG - Intronic
1011819454 6:91234356-91234378 TAAAATGCAGATGATGATATTGG - Intergenic
1012084365 6:94805243-94805265 CAAAGTCCTTATAATGATATAGG - Intergenic
1012120993 6:95366685-95366707 CAAAATACTGATAGTGATATGGG - Intergenic
1012191555 6:96286748-96286770 CTCAGTGCTGAAACTGATATAGG + Intergenic
1012569001 6:100699691-100699713 CAAAATGCTGATAATGATTTGGG + Intronic
1012765499 6:103362467-103362489 CAAAATGCTCATAGTGATATGGG + Intergenic
1013838312 6:114359328-114359350 CCAAAGCCTGATGCTGATATAGG + Intergenic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1014939149 6:127417851-127417873 AAAAATGCTAATCCAGATATAGG + Intergenic
1015239511 6:131007621-131007643 CAAAATGCTGATAGTAATATGGG + Intronic
1016876365 6:148869661-148869683 ATAAATGCTGATGCTGATTTAGG - Intronic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1020933269 7:14427337-14427359 CAAACTGCTGATAGTGATATGGG - Intronic
1021207470 7:17801732-17801754 TCAAATGCTGATACTCATTTAGG - Intronic
1023253448 7:38290249-38290271 CTAATTGCTGACACTGATATGGG + Intergenic
1023514610 7:40988555-40988577 TAAAATGTGGATACTGATACTGG + Intergenic
1024383614 7:48726149-48726171 CAATATGCTGATAATGATATGGG - Intergenic
1026456443 7:70576435-70576457 CAAAATGCAAGTGCTGATATGGG - Intronic
1026532980 7:71215845-71215867 CAAAATGCTTGTATTGAGATAGG + Intronic
1027789534 7:82621190-82621212 TACAATGGTGATACAGATATAGG - Intergenic
1028205759 7:88014823-88014845 CCAAATGCTGATCCTCAGATTGG + Intronic
1028906220 7:96156914-96156936 CAAAATAATTATACTGATGTAGG + Intronic
1028979542 7:96952221-96952243 CACAATGCTAATACTGTTAGGGG - Intergenic
1029952433 7:104601509-104601531 CAGAATGATGAGACAGATATAGG + Intronic
1031261928 7:119532438-119532460 CAAAATTCTGATAGTGATGTGGG + Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1032660239 7:133975255-133975277 ATAAATGATGACACTGATATGGG + Intronic
1032927473 7:136624044-136624066 GAAAATGCTGATTCTGGTTTAGG + Intergenic
1032946596 7:136860677-136860699 CAAAATGCTTTTAATGTTATGGG + Intergenic
1033620777 7:143060491-143060513 AAAAATGCAGATTCTGATTTAGG + Intergenic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1034942778 7:155242333-155242355 AAAACTGCTGATCCTGAAATAGG - Intergenic
1036893878 8:12615122-12615144 CAAAATGCTGATGGTTATATGGG - Intergenic
1038880541 8:31606076-31606098 CAAAATGCTGATAGTAATAAGGG - Intergenic
1039315250 8:36364586-36364608 TAAAATGCAGATTCTGATTTCGG - Intergenic
1040540120 8:48346346-48346368 CAAAATGCTGATGGTGATAGGGG + Intergenic
1042558032 8:70050374-70050396 AAAAATACTGATACTGCTGTAGG - Intergenic
1043694665 8:83203887-83203909 CAAAATGCTGATGGTGATATGGG + Intergenic
1043910879 8:85862528-85862550 TAAAATGCAGATTCTGATCTGGG - Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044127104 8:88472209-88472231 CAAAATGCTGAGAGTGATATGGG - Intergenic
1044252393 8:90019248-90019270 TAAAATATTGATACTGATGTAGG + Intronic
1044326821 8:90868437-90868459 CAAAATGTCCATAGTGATATGGG + Intronic
1044945338 8:97384056-97384078 CCCAATGCCTATACTGATATAGG - Intergenic
1045050589 8:98320677-98320699 CAAAATGCTGATAGCAATACGGG - Intergenic
1045120748 8:99031656-99031678 GAAAATGCTGATATTGATGACGG - Intronic
1045730431 8:105232663-105232685 CCAAATGCTGGCAATGATATGGG - Intronic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1046134129 8:110004471-110004493 CAAAATGCTGATAGTGATGTGGG - Intergenic
1046326034 8:112647921-112647943 CCATATGCTGATACTGCTACAGG - Intronic
1046571603 8:115973137-115973159 AAAAGTGCTGATAATCATATAGG + Intergenic
1046668917 8:117036246-117036268 CAAAATGCTGACAGTGATATGGG - Intronic
1047894564 8:129352301-129352323 TAATATGATGATACTGATAATGG + Intergenic
1048699932 8:137077441-137077463 CAAAATGTTGATAATGATATGGG + Intergenic
1048726231 8:137388068-137388090 CACAATGCTGATAGTGATATGGG - Intergenic
1048806452 8:138245905-138245927 CAAATTGCTGATAGTGATATGGG + Intronic
1050660210 9:7876197-7876219 CAAAATGCTTATAGTAATATGGG + Intronic
1050890625 9:10819845-10819867 AAAAATGCTGAGAGTGATATGGG - Intergenic
1050897368 9:10900201-10900223 CAAAATGATGATAGTGATATGGG - Intergenic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1052220715 9:26018288-26018310 TAAAATGCTGATAATGATATGGG - Intergenic
1052364435 9:27596155-27596177 AAAAATACTGATACTGTTATGGG - Intergenic
1052635430 9:31097742-31097764 CCAAATGCTGACAATGATATAGG + Intergenic
1053641494 9:40086194-40086216 TAAAATGATAATACTAATATTGG - Intergenic
1053764642 9:41379280-41379302 TAAAATGATAATACTAATATTGG + Intergenic
1054322373 9:63683445-63683467 TAAAATGATAATACTAATATTGG - Intergenic
1054543257 9:66290437-66290459 TAAAATGATAATACTAATATTGG + Intergenic
1055174510 9:73300395-73300417 CAAAATGCTGATAATGATACGGG - Intergenic
1056010826 9:82328166-82328188 AAAAATGCTGAATCAGATATGGG + Intergenic
1056336858 9:85579679-85579701 TTAAATTGTGATACTGATATAGG + Intronic
1057032493 9:91786652-91786674 CAAAATGTTGACTCTGTTATGGG - Intronic
1057285435 9:93749742-93749764 CAAACTGCTGATAGTGATATGGG - Intergenic
1058419679 9:104821710-104821732 AAAAATGCTCATACTAAAATTGG - Intronic
1058722156 9:107773933-107773955 CAAAATGCTGACAGTTATATGGG - Intergenic
1058756621 9:108088663-108088685 CAAGATGCTGATGCTGAAAATGG - Intergenic
1058846278 9:108962745-108962767 CATGATGCTGATGCTGATAGAGG + Intronic
1059570175 9:115425833-115425855 CTAACTGCTGATAATGATATGGG - Intergenic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059582435 9:115566408-115566430 CAAAATGCTGATAATGATACAGG + Intergenic
1059847810 9:118300970-118300992 CCAAATTCTGATACTGATACTGG - Intergenic
1059917171 9:119116958-119116980 CAAAATGTTGATAGAAATATGGG + Intergenic
1202789267 9_KI270719v1_random:69272-69294 TAAAATGATAATACTAATATTGG - Intergenic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1187278260 X:17835531-17835553 CAAATTGCAGATACAGATCTTGG - Intronic
1188053064 X:25510192-25510214 CAAAATGCTGATAATGATAATGG - Intergenic
1188255605 X:27959209-27959231 CAAAATGCCAAAACTGAGATGGG - Intergenic
1188749163 X:33884559-33884581 CAAAATGCTGATGGTTATATGGG + Intergenic
1189071390 X:37867288-37867310 CAGAATGCTGATAGTGATATGGG - Intronic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1189872161 X:45395227-45395249 AAATATGCTGATAGTCATATTGG + Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1191760806 X:64646452-64646474 CAAAATGTTGATAGTAATATGGG + Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192866881 X:75143376-75143398 CAAAATGCTGATAATGATAATGG - Intronic
1192934990 X:75849954-75849976 AAAAATGCTGATAATGATATGGG - Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1193628088 X:83844291-83844313 CTAAATGCTGATAAAAATATGGG - Intergenic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1194418948 X:93649034-93649056 CCAAATGGTGATGGTGATATGGG + Intergenic
1194947286 X:100084147-100084169 GGAAATCCTGATACTGATTTTGG + Intergenic
1195355493 X:104035840-104035862 CATATAGCTGATACTCATATGGG - Intergenic
1196028954 X:111074781-111074803 CAAAATGCTGATGGAGATGTGGG + Intronic
1197385343 X:125795037-125795059 CAAAATGCTGATAGTAATATGGG + Intergenic
1197392302 X:125882939-125882961 CAAAATGCAGACAGTAATATGGG + Intergenic
1198569189 X:137937314-137937336 CAAAATGCTGATAGAAATATGGG + Intergenic
1198588470 X:138149197-138149219 CAAAATGCTGATAGAAATATGGG + Intergenic
1199156840 X:144559771-144559793 CTAAATGGTGTTATTGATATGGG - Intergenic
1199264195 X:145811122-145811144 CAAAATGCTGATGATTATTTTGG - Intergenic
1199413996 X:147558714-147558736 TAAAATGCTGATACTTATCTAGG + Intergenic
1200052231 X:153440360-153440382 CACAATGCTGATACTGTTCCTGG + Intergenic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic