ID: 1126518835

View in Genome Browser
Species Human (GRCh38)
Location 15:49565725-49565747
Sequence TGATAGTTAAAGATCTTCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 61}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126518831_1126518835 19 Left 1126518831 15:49565683-49565705 CCTGTAAATGTTACCTTACAAGG 0: 1
1: 6
2: 34
3: 168
4: 457
Right 1126518835 15:49565725-49565747 TGATAGTTAAAGATCTTCGGTGG 0: 1
1: 0
2: 0
3: 3
4: 61
1126518829_1126518835 27 Left 1126518829 15:49565675-49565697 CCCTGGAACCTGTAAATGTTACC 0: 15
1: 81
2: 218
3: 433
4: 824
Right 1126518835 15:49565725-49565747 TGATAGTTAAAGATCTTCGGTGG 0: 1
1: 0
2: 0
3: 3
4: 61
1126518833_1126518835 6 Left 1126518833 15:49565696-49565718 CCTTACAAGGCAAAAGCATATTG 0: 1
1: 0
2: 0
3: 17
4: 235
Right 1126518835 15:49565725-49565747 TGATAGTTAAAGATCTTCGGTGG 0: 1
1: 0
2: 0
3: 3
4: 61
1126518830_1126518835 26 Left 1126518830 15:49565676-49565698 CCTGGAACCTGTAAATGTTACCT 0: 19
1: 86
2: 283
3: 613
4: 1222
Right 1126518835 15:49565725-49565747 TGATAGTTAAAGATCTTCGGTGG 0: 1
1: 0
2: 0
3: 3
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126518835 Original CRISPR TGATAGTTAAAGATCTTCGG TGG Intronic
901934511 1:12618317-12618339 TGACAGTTAAAGTTGTTGGGAGG + Intergenic
903644940 1:24889512-24889534 TGCTAGATAAAGAACTTGGGTGG - Intergenic
903872056 1:26442985-26443007 TGTTAGTTAGATATCTTGGGTGG + Intronic
918162306 1:181912729-181912751 TGAAAATAAAAGATCGTCGGAGG + Intergenic
918891204 1:190271658-190271680 TGATATTTAAAGAACTGTGGTGG - Intronic
920899314 1:210091098-210091120 TGATATTTAAAGATGTTAAGTGG - Intronic
921705098 1:218313506-218313528 TGAGAGGTAAAGATTTTTGGAGG + Intronic
1066279133 10:33898102-33898124 TAATAGTTAAAGACCTTGGAGGG - Intergenic
1069190744 10:65485203-65485225 TTATAGTTATAGACCTTAGGAGG - Intergenic
1070501766 10:77079299-77079321 TGATTGTTAAAAATCTTCCTGGG - Intronic
1077944411 11:6879338-6879360 TTATAGTTATCGATCTTCTGAGG - Intergenic
1090336448 11:125971094-125971116 TGATAATTAACGTTCTCCGGTGG + Intronic
1099294933 12:80818250-80818272 TGATAGTGAAAGAACTTCATGGG - Intronic
1101817793 12:108159022-108159044 TGATGGTTAAAGACCTTCTGTGG + Intronic
1103014979 12:117487310-117487332 TGTTAGTCAAAGATCATGGGTGG - Intronic
1106197676 13:27508289-27508311 TGAAGCTTAAAGATGTTCGGTGG - Intergenic
1107515848 13:41128609-41128631 TGATAGTTAAAGAACATAAGTGG - Exonic
1108798309 13:54061203-54061225 TGAAAGTTAGAGAGCTTAGGAGG + Intergenic
1110694135 13:78467658-78467680 TCATAGCTAAAAATCTTGGGAGG - Intergenic
1113162390 13:107396505-107396527 TGATATTTAAAGCACTCCGGGGG + Intronic
1119966297 14:78920041-78920063 GGATAGCTAATGATCTTCTGTGG + Intronic
1126140225 15:45431419-45431441 TGAAATTTAAAGTTCTTCAGTGG + Intronic
1126518835 15:49565725-49565747 TGATAGTTAAAGATCTTCGGTGG + Intronic
1140352727 16:74278405-74278427 AGAAAGATAAAGAGCTTCGGTGG + Intergenic
1163099463 19:15085510-15085532 TGATAGGTACAGATGTTCTGAGG - Intergenic
929012562 2:37459831-37459853 TGATAGTAAAAGGTCATTGGTGG + Intergenic
929077355 2:38089032-38089054 TGATAGTTAAATAACTTAAGTGG + Intronic
931327007 2:61237047-61237069 GGATAGTTGAAAATCTTCAGTGG - Intronic
932441667 2:71741182-71741204 TGCTAGTTAAGTATCTTAGGTGG + Intergenic
939658588 2:144858932-144858954 TGATATTTAAAGATATCCGTGGG - Intergenic
1169177369 20:3529112-3529134 TGATATTTAAAGATTTTCAGAGG - Intronic
952237162 3:31492170-31492192 TGATATTTAAAGATCTACCATGG - Intergenic
952274318 3:31862433-31862455 TGATAGTTAAAGTTCTAGGGTGG - Intronic
959192795 3:103137005-103137027 TCATATTTAGAGATCTTCAGAGG + Intergenic
964902266 3:161673749-161673771 TGATTTTTAAAGAACTTCAGAGG - Intergenic
965309864 3:167115440-167115462 TGATAGTTGAAGATGTGGGGAGG - Intergenic
973710337 4:53623694-53623716 TGATAGTTATAAATTCTCGGTGG - Intronic
977616364 4:99091121-99091143 TGAGAGTTAAAGATTCTTGGGGG + Intergenic
990872462 5:60447221-60447243 TGATAGTTGTAGATTTTCAGAGG - Intronic
993278723 5:85897730-85897752 TGATAATTAAAGATATTCATCGG + Intergenic
993902194 5:93592044-93592066 TGATAATTCAAGAACTTCTGAGG - Intronic
994069132 5:95578664-95578686 AGATAGTTAATCATCTTCAGTGG + Intronic
994228646 5:97286165-97286187 TGATAGTAATAAATCATCGGTGG - Intergenic
1003125127 6:3349680-3349702 TGATATTTAAAGCACTTGGGTGG - Intronic
1006205305 6:32336139-32336161 TGATGGTTGAAAATCTTCAGAGG + Intronic
1010159499 6:72835773-72835795 TAATGGTTAAAGAGCTTGGGAGG - Intronic
1011464535 6:87641878-87641900 TGATATTTAAAGATCTACTTAGG + Intronic
1014144133 6:117977849-117977871 TGATAGGGAAAGATTTTCAGAGG + Intronic
1014983909 6:127978964-127978986 TCATAGTTAAAGCTGTTCTGGGG - Intronic
1018534034 6:164799837-164799859 TGACAGTTATATATCTTCGAAGG - Intergenic
1018604508 6:165583454-165583476 TTACAGTTAAAGATCTTGAGAGG + Intronic
1019125217 6:169834481-169834503 TGATAATAAAAAAGCTTCGGTGG + Intergenic
1020441826 7:8225067-8225089 TAATCATTACAGATCTTCGGGGG + Intronic
1021345309 7:19520090-19520112 TTATAGTTAAATATCTTCTAAGG - Intergenic
1024779717 7:52833799-52833821 TGATACTTAAACAACTTCTGTGG - Intergenic
1034128336 7:148694081-148694103 TGATACTTAAGAATCTTTGGTGG + Intergenic
1035205781 7:157293021-157293043 TGAGACCTAAAGATCCTCGGCGG + Intergenic
1037298798 8:17430134-17430156 TGAGAGTTAAATATCTGCTGTGG - Intergenic
1041773048 8:61493612-61493634 TGATACTTAAAGTTATTTGGGGG + Intronic
1046988716 8:120423919-120423941 TGGTAGTTAAAAATCTTCTAAGG + Intronic
1052855994 9:33406944-33406966 TGAGAGTTAAAGACCTTCCTGGG - Intergenic
1056818601 9:89820316-89820338 TCATAGCTAAATATCTTGGGTGG - Intergenic
1057848964 9:98549776-98549798 TGCTATTTAAGGATCTTCTGTGG - Intronic
1199988619 X:152970700-152970722 TGATACTTTGAGATCTTAGGTGG + Intronic
1201669423 Y:16500675-16500697 TGATATTTGAAGCTCTTCAGAGG - Intergenic