ID: 1126523643

View in Genome Browser
Species Human (GRCh38)
Location 15:49624808-49624830
Sequence GTTTCACGTTAGCATCAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 54}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126523643_1126523647 20 Left 1126523643 15:49624808-49624830 CCTGTCTGATGCTAACGTGAAAC 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1126523647 15:49624851-49624873 GAAAACAAAACTGCCATCTCTGG 0: 1
1: 0
2: 2
3: 26
4: 326
1126523643_1126523644 -2 Left 1126523643 15:49624808-49624830 CCTGTCTGATGCTAACGTGAAAC 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1126523644 15:49624829-49624851 ACCATTGCATTCCTAATATCTGG 0: 1
1: 0
2: 2
3: 12
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126523643 Original CRISPR GTTTCACGTTAGCATCAGAC AGG (reversed) Intronic
918788239 1:188792415-188792437 TTTTTAAGTAAGCATCAGACAGG + Intergenic
919541604 1:198853631-198853653 GTCTCACTCTATCATCAGACTGG + Intergenic
1071887032 10:89962497-89962519 ATTTCACTTCAGCATCAGTCTGG - Intergenic
1092777231 12:11954329-11954351 GTTTCAGGTTTGCATCAGGAAGG - Intergenic
1093225070 12:16473113-16473135 TCTTCACTTTAGCATGAGACAGG + Intronic
1093510868 12:19926532-19926554 TTTTCCTGTTAGAATCAGACTGG + Intergenic
1095830172 12:46577311-46577333 CTTTGACGTTAGAGTCAGACAGG + Intergenic
1106664809 13:31840723-31840745 ATGTCATGTTAGCATCAGAAAGG - Intergenic
1109103799 13:58222635-58222657 GTTTTAGGTTAGCATTAGATTGG - Intergenic
1110597318 13:77333725-77333747 GTTTCAAATTAGCTTCAGCCTGG + Intergenic
1126523643 15:49624808-49624830 GTTTCACGTTAGCATCAGACAGG - Intronic
1126771962 15:52066973-52066995 GTGTCATGAGAGCATCAGACAGG + Exonic
1129355345 15:74987152-74987174 GTCTCACTTTGTCATCAGACTGG - Intronic
1132731698 16:1366095-1366117 GTTACACGTTATCATGAGGCTGG - Intronic
1135491014 16:22909533-22909555 TTTGCACGTTATCATCACACAGG + Intronic
1141090644 16:81128131-81128153 ATTTCACATTAGCCTCAGGCCGG - Intergenic
1149496978 17:57125134-57125156 GTTCCACGTTATCTTCACACTGG - Intergenic
1149676961 17:58473676-58473698 TTCTCACGTTAGAAGCAGACTGG - Intronic
1157587531 18:48814290-48814312 GTTGCACGTTAGAATCAGCTGGG + Intronic
929090245 2:38209240-38209262 GTTTCAAGTAAGGATGAGACTGG + Intergenic
937807078 2:126159013-126159035 GTTTCAAGTGAGCTTCAGATGGG - Intergenic
940378293 2:152983409-152983431 TTTTCACATAAGCAACAGACAGG - Intergenic
946146708 2:217736517-217736539 GTTTCACTTTAGCAATATACTGG - Intronic
1169847865 20:10015264-10015286 GTTGCACGTTAGAATCATCCAGG - Intronic
1175161307 20:57009863-57009885 GTTTCGCCTGAGGATCAGACAGG - Intergenic
953319120 3:41956170-41956192 ACTTCACCTTAGCATCTGACTGG + Intronic
961297490 3:125898380-125898402 GTTTCACGTTACAATGTGACTGG + Intergenic
971649352 4:29252593-29252615 TTTTCACGTTATCATCAGTTTGG - Intergenic
976778019 4:88727707-88727729 GTTTGACGATAAAATCAGACTGG + Exonic
978387459 4:108190421-108190443 GTTTCATGTGGCCATCAGACAGG - Intergenic
991483291 5:67106776-67106798 GTCTCACTTTACCAGCAGACAGG + Intronic
996491011 5:124096435-124096457 ATTTCACATTATCATCAGCCAGG + Intergenic
1007042636 6:38738395-38738417 GTTTCACATCAGCATCACAGTGG + Intronic
1008890782 6:56487168-56487190 GTTTCAGGTTGTCATCAGCCAGG + Exonic
1011106215 6:83784568-83784590 TTTTCACATTGGCATAAGACAGG - Intergenic
1012655366 6:101811234-101811256 GTTTCTCATTATCATCACACAGG + Intronic
1012979970 6:105819003-105819025 GTTTCATGTTAGAATTAGTCAGG + Intergenic
1015240923 6:131022328-131022350 GTGTCACGTTACCATGTGACAGG - Intronic
1017435200 6:154409113-154409135 TTTTCACTTTAGCATAATACAGG + Intronic
1017521624 6:155207784-155207806 GTTTCAGGTAAGCATGAGAAAGG - Intronic
1020360777 7:7324402-7324424 GTCTCAGGTCAGCATCACACTGG - Intergenic
1020419841 7:7989845-7989867 CTTTCACTTTAGAATGAGACAGG - Intronic
1034752729 7:153586200-153586222 TTTTCCACTTAGCATCAGACAGG + Intergenic
1040629975 8:49199038-49199060 GTTTCACAATAGGATCACACAGG - Intergenic
1042080787 8:65048424-65048446 GTTGCACATTAGAATCAGATGGG - Intergenic
1049987516 9:965611-965633 GTTTCCAGTTAGCAGCTGACTGG - Intronic
1051733727 9:20176052-20176074 GTTTCATGGAAGCATGAGACTGG - Intergenic
1052361525 9:27566057-27566079 CTTTCAGGTTAGTATCAAACTGG + Intronic
1053382076 9:37657273-37657295 GTTACAAGTCAGCATCAGACAGG - Intronic
1053481053 9:38416702-38416724 GTCTCATGTTATCCTCAGACTGG + Intronic
1055452162 9:76440738-76440760 GTTGCACGTTAGAATCAGCTGGG + Intronic
1058881589 9:109290043-109290065 GTTTGAAGTTACCATCGGACAGG - Intronic
1058939550 9:109800412-109800434 GTTTAACGTTAGCCCAAGACCGG + Intronic
1187387758 X:18863814-18863836 GCTACACATTAGCATCAGCCAGG + Intergenic
1190023915 X:46904401-46904423 GTTTCACGCTTGGGTCAGACAGG - Intergenic
1191240022 X:58180223-58180245 TTTTCACTATAGCATCAAACAGG - Intergenic
1196248276 X:113427086-113427108 GTTTCAAATTAGCATCATACAGG + Intergenic