ID: 1126524521

View in Genome Browser
Species Human (GRCh38)
Location 15:49636160-49636182
Sequence TTGTTGTAGCATGTATCAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 1, 2: 5, 3: 30, 4: 209}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126524520_1126524521 29 Left 1126524520 15:49636108-49636130 CCTTTTTTTGGTTTGGCTTTCTC 0: 2
1: 0
2: 7
3: 65
4: 696
Right 1126524521 15:49636160-49636182 TTGTTGTAGCATGTATCAATAGG 0: 1
1: 1
2: 5
3: 30
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126524521 Original CRISPR TTGTTGTAGCATGTATCAAT AGG Intronic
900877701 1:5357014-5357036 TAATTTTAGCATTTATCAATGGG + Intergenic
901043168 1:6378336-6378358 TTGCTGTAAAATGTATCACTGGG - Intronic
901160912 1:7176126-7176148 TTGTTTTAACATGAATCAAGAGG - Intronic
901246935 1:7739182-7739204 TTGTTTTAGGTTGCATCAATGGG - Intronic
901463410 1:9405232-9405254 TTGTTGTCCCATCTATCAAACGG - Intergenic
902822626 1:18952536-18952558 ATGTTGTAGCATGTATTTGTAGG - Intronic
909245261 1:73273242-73273264 TTGTTCTAGCAGGTAGTAATTGG + Intergenic
910241920 1:85095995-85096017 TTGCTGGAGGCTGTATCAATGGG + Exonic
914862038 1:151394731-151394753 TTTTTGTAGCATTTATCCTTTGG - Intergenic
915710771 1:157896161-157896183 ATGTTGTTACATGCATCAATAGG + Intronic
915846617 1:159272935-159272957 TTTTTGTAGCAATTATGAATGGG - Intergenic
916692689 1:167205837-167205859 TTGTTATAACATGTCTAAATGGG - Intergenic
916697557 1:167254888-167254910 ATGTTGTAGAATGAATAAATAGG - Intronic
917397190 1:174606058-174606080 TTGTTATAACATGTCTAAATAGG - Intronic
918710754 1:187726210-187726232 ATATTGTTGCAGGTATCAATAGG + Intergenic
919036014 1:192309583-192309605 ATGTTGTTGCATGTAGCAAGAGG + Intergenic
919557597 1:199078796-199078818 GTGTTGTAACATGTATTAATAGG - Intergenic
921118337 1:212115352-212115374 TTGTTATAAAATGTATAAATCGG + Intergenic
921980691 1:221255192-221255214 ATGTTGTAGCATAAATCAGTAGG - Intergenic
922549994 1:226487751-226487773 TTGTTGTAGCTTTTGTAAATGGG + Intergenic
924370982 1:243349371-243349393 TTGTTGCAGGAAGTAGCAATAGG - Intronic
1065138763 10:22700241-22700263 GTGGTGTAGGATGTATGAATTGG - Intronic
1065621119 10:27582882-27582904 TTATTGTTGCATGTATCAATAGG + Intergenic
1067152936 10:43751470-43751492 TTGTTTTAGGATGTATCACTTGG + Intergenic
1068421757 10:56803303-56803325 TTGTTATAACATGTCTGAATAGG - Intergenic
1068733005 10:60380675-60380697 TTGCTGTTGGATGTATCACTGGG + Intronic
1068797199 10:61096536-61096558 TTGTTATAACATGTCTAAATAGG - Intergenic
1068914369 10:62412669-62412691 TTGTTGTAGCAATTGTGAATGGG - Intronic
1069322104 10:67184896-67184918 TTGTTGTAACATGTCAGAATGGG - Intronic
1070120397 10:73570708-73570730 TTGTACTGGCATTTATCAATAGG + Intronic
1075423023 10:122318299-122318321 ATGTTGTTGCATGTATCAGTAGG + Intronic
1076325002 10:129614232-129614254 GTGTTGTAGCACGTGTCAAAAGG + Intronic
1079044591 11:17089907-17089929 TTGTTGTAGCTTGTATACAGTGG - Exonic
1079570823 11:21941814-21941836 TTATTGTAACATATATCCATAGG - Intergenic
1080053250 11:27878610-27878632 TTGTTGAAGCATGAATGAAAAGG - Intergenic
1080556653 11:33423184-33423206 TTGTTGTAACATGTTTCAATAGG + Intergenic
1080893394 11:36428495-36428517 TTGTTGGAGCATGAATGGATGGG + Intronic
1082948406 11:58785821-58785843 TTGTTATAACATGTATGAAAAGG - Intergenic
1093956676 12:25228444-25228466 GTGTTGTAGCATGTATATACAGG - Intronic
1094305374 12:29013379-29013401 GTGTTGCTGCAAGTATCAATTGG - Intergenic
1095882677 12:47154954-47154976 TTGTTTTAGCAGGAATCCATGGG + Intronic
1096949560 12:55452448-55452470 TTCTTGTACAATATATCAATGGG + Exonic
1098466493 12:70792788-70792810 TTGTTGTAACATGTCTGAACAGG + Intronic
1098632805 12:72744921-72744943 TTTTTGTGGCAATTATCAATAGG - Intergenic
1098803788 12:74995957-74995979 TTGTTGGAGCATTTACCACTTGG - Intergenic
1100787304 12:98091935-98091957 TTGTTATAGCATGTCTGAACAGG - Intergenic
1105359735 13:19697433-19697455 TTGTAACAGCATGTATCAAGGGG - Intronic
1106498267 13:30302783-30302805 TTCATGTATCATGTATCATTTGG + Intronic
1106902114 13:34364519-34364541 TTGTTGAAGCAGGTACCATTTGG + Intergenic
1108173572 13:47769241-47769263 TTTTTGTAGCAATTATGAATGGG + Intergenic
1108206891 13:48099300-48099322 TTGTTATAACATGTATGAACAGG - Intergenic
1108215758 13:48182642-48182664 TTGTTATAGCATGTCTGAACGGG + Intergenic
1109836790 13:67869519-67869541 TTCTTGTATGATGTATCAAAAGG - Intergenic
1110346530 13:74454255-74454277 TTTTTATAGCTTGTATCTATTGG - Intergenic
1113998380 14:16116126-16116148 TTTTTGTAGAATGTACAAATGGG + Intergenic
1114942280 14:27628066-27628088 TTGTTGTAACATGTCTAAACAGG - Intergenic
1114963377 14:27923219-27923241 TTGTTATAACATGTCTCAACAGG + Intergenic
1115175363 14:30556275-30556297 TTTTTGCAGCATGTATTAAGTGG + Intergenic
1116278227 14:42865406-42865428 TTGTTTTAGCATGTATGTGTGGG + Intergenic
1116301888 14:43193540-43193562 TTTTTGTAGCAATTATGAATGGG - Intergenic
1116426836 14:44800695-44800717 TTGTTATAACATGTATGAACAGG + Intergenic
1116612689 14:47097152-47097174 TAGTTGTAGCATATCTAAATAGG - Intronic
1117238384 14:53802563-53802585 TTTTTGTAGCAATTGTCAATGGG - Intergenic
1118500135 14:66354552-66354574 CTGTTGTAGCATCAATCAGTAGG - Intergenic
1120058851 14:79957941-79957963 TTTTTGTAGCAATTATGAATGGG - Intergenic
1122164685 14:99813354-99813376 TTGTTGTAGAAAATATCATTTGG + Intronic
1124874284 15:33577007-33577029 TCTTTGTAGCAAGTATTAATGGG - Intronic
1126484296 15:49162298-49162320 AGGTTGTTGCATGTATCAGTTGG + Intronic
1126524521 15:49636160-49636182 TTGTTGTAGCATGTATCAATAGG + Intronic
1127159086 15:56161909-56161931 TTTTTGTAGAATTTAACAATGGG - Intronic
1129627378 15:77216350-77216372 TTGTGATAGCATGTCTGAATGGG + Intronic
1137050429 16:35707510-35707532 TTGTTGTAGAATCTATGAAGGGG + Intergenic
1137334985 16:47539512-47539534 TTGTTGAAGAATGTATCTATTGG + Intronic
1138168644 16:54827903-54827925 AGGTTGTTGCATGTATCAGTAGG + Intergenic
1138844373 16:60547562-60547584 TTGTTGTAGCATAAATTAATGGG - Intergenic
1140301414 16:73761224-73761246 TTTTTGTAGCAATTATGAATGGG - Intergenic
1149195288 17:54112204-54112226 TTGTTGTGACATGTCTGAATGGG + Intergenic
1149617303 17:58012074-58012096 TTGTTATAACATGTATGAACAGG + Intergenic
1150303114 17:64062771-64062793 TTGGAGGAGCATGTATGAATAGG - Intronic
1153149334 18:2072701-2072723 TTGTTGTGGTATGTAAGAATAGG + Intergenic
1153399213 18:4665121-4665143 ATGTTGAAGCATGTATCAGTAGG - Intergenic
1157752440 18:50191780-50191802 TTGTTATAACAAGTATGAATGGG + Intronic
1158230769 18:55251972-55251994 TTATTGTGGAATGTATCAAATGG + Intronic
1158270001 18:55702336-55702358 TTGTTATAACATGTATGAATAGG + Intergenic
1159792116 18:72794767-72794789 TTTTTGTAAAAAGTATCAATAGG + Intronic
1160274227 18:77415922-77415944 TAGTTGTACCATTTATCATTTGG + Intergenic
1163515594 19:17761409-17761431 TTTTTGTAGCTAGTATAAATGGG + Intronic
1167998929 19:53429377-53429399 TTGAGGTAGCATTTATAAATTGG - Intronic
926788316 2:16542766-16542788 ATGTTGTTGCATGTATCAATAGG - Intergenic
928905415 2:36362516-36362538 TTGTTCTAGCTTGTTTCACTAGG + Intronic
929124187 2:38508504-38508526 TTGCTGTTGCATGTGTCAATAGG - Intergenic
929367577 2:41178766-41178788 TTTTTGTAGCAATTATGAATGGG + Intergenic
931885373 2:66611385-66611407 TTTTTGTAGCAATTATGAATGGG + Intergenic
932180515 2:69642791-69642813 TAGTTGTTGCATGTATGAATGGG - Intronic
932443455 2:71754736-71754758 GTGTTGTAGCTAGGATCAATAGG + Intergenic
932622571 2:73273772-73273794 TTTTTGTAGCTTTTATCATTTGG + Intronic
933466958 2:82664064-82664086 TTGCTGTAACATGTACAAATAGG - Intergenic
933545106 2:83699900-83699922 TTGTTGCAGGAGGTAACAATTGG - Intergenic
934126992 2:88904546-88904568 CTGTTTTAGCATGTATCAGTAGG + Intergenic
936769143 2:115890845-115890867 TCGTTGTAGCAGTTATGAATGGG + Intergenic
939592937 2:144088192-144088214 TTTTTGTAGCAGTTATAAATGGG - Intronic
941608867 2:167635584-167635606 TTTTTGTAGCAATTGTCAATGGG - Intergenic
942135798 2:172924070-172924092 TTGTTGTAGGATGGATAATTTGG - Intronic
944652829 2:201848704-201848726 ATGTTGTAGAATGTGTCAAGGGG + Intronic
945144149 2:206718960-206718982 TTGTTGAAGCATGTCTGAACAGG + Intergenic
1170162415 20:13327201-13327223 TTTTTGTAGCAATTGTCAATGGG - Intergenic
1170503661 20:17001475-17001497 ATGTTATAGCATGAATCAGTCGG - Intergenic
1172388659 20:34551260-34551282 ATGTTGTTGCAGGTATCAGTAGG - Intronic
1177846790 21:26298928-26298950 GTTTTGTATCATGTATCATTTGG + Intergenic
1178543356 21:33473871-33473893 TTCATGTAGCATCTATCAGTAGG - Intronic
1182205415 22:28619693-28619715 TTGTTGTAACATGTCTGAACAGG + Intronic
950827393 3:15838937-15838959 ATGTTGTAACATGTATTAATTGG - Intronic
951752233 3:26049661-26049683 TTGTTGTTCCATTGATCAATGGG - Intergenic
951990311 3:28669219-28669241 TTGTGGTAGCTTGTATTATTAGG + Intergenic
952015902 3:28957401-28957423 ATGTTGTATTATGTATCATTAGG + Intergenic
952941642 3:38449692-38449714 TAGTAGAAGCATGTATCAAAAGG + Intergenic
954703215 3:52463268-52463290 ATATTGTAGCATGAATCCATTGG + Intronic
955578417 3:60392139-60392161 TTGTTGTAACATGTCTGAGTAGG + Intronic
955743315 3:62115382-62115404 TTTTGGTAGCATATATCAAGAGG + Intronic
956561385 3:70579958-70579980 TTGTTGTTGCATTTTTCAAGTGG + Intergenic
956629518 3:71301963-71301985 TTGTTTTAGTATTTATAAATTGG - Intronic
957762817 3:84581363-84581385 TTGTTATAACATGTCTGAATAGG + Intergenic
959112515 3:102138636-102138658 TTGTTCTAGCATGTTGAAATAGG + Intronic
959529827 3:107421795-107421817 TTCTTGTAAAATGTATAAATGGG - Intergenic
962041295 3:131709989-131710011 TTATTGTATCATGTAGGAATAGG + Intronic
962881512 3:139581523-139581545 TTGTTGTAGCATGTATCCATAGG - Intronic
964183732 3:153917602-153917624 TTTTTGTAGCAATTATGAATGGG - Intergenic
965553460 3:169995265-169995287 TTATTGTAGAGGGTATCAATTGG + Exonic
966652594 3:182317680-182317702 TTCTTGTGGCATTTGTCAATGGG + Intergenic
967384362 3:188896744-188896766 TTGTTCTTGCATGTGTCAATTGG - Intergenic
970552230 4:17193771-17193793 TTGATGTAGCATATATGGATAGG - Intergenic
971860331 4:32093777-32093799 TTGTTGTAACATGTCTAAACAGG - Intergenic
972148356 4:36058069-36058091 TGGTTGGAGCAGGTATGAATTGG - Intronic
972304370 4:37817949-37817971 TTGTTGAAGAATGAATCACTGGG - Intergenic
972539437 4:40026418-40026440 AAGTTTTTGCATGTATCAATAGG + Intergenic
973225292 4:47776730-47776752 TTGCTGTTGCAGGTATTAATGGG - Intronic
973266602 4:48217425-48217447 TTATTGTAGCATGGTTCACTAGG - Intronic
975155894 4:71072732-71072754 TTGTTGTTGCAATTATAAATGGG + Intergenic
975206888 4:71654558-71654580 TTGTTGTAACATGTTTGAACAGG - Intergenic
976310878 4:83612100-83612122 TGGTTGTAGTATGTTTAAATTGG + Intergenic
976962839 4:91000677-91000699 TTTTTGTAGCATTTGTAAATGGG + Intronic
977024570 4:91800338-91800360 TTGTTTTCGCATTTATAAATAGG - Intergenic
977391674 4:96417721-96417743 TTGATGCAGCATGGGTCAATGGG - Intergenic
977508628 4:97934114-97934136 TTTTTGTAGCAAGTGTGAATGGG + Intronic
978007538 4:103636192-103636214 TTGTTTTAGTATGTAGCAAAAGG + Intronic
980509586 4:133767918-133767940 TTTTTGTAGCAATTATGAATTGG + Intergenic
980858642 4:138471668-138471690 TTTTGGTAGCATTTATGAATGGG + Intergenic
981193346 4:141889141-141889163 TCTTTGTAATATGTATCAATGGG - Intergenic
981764228 4:148229616-148229638 CTGTGGTAACATGTATCTATGGG - Intronic
985905739 5:2834516-2834538 TTATTTTATCATGTATTAATTGG - Intergenic
986635144 5:9813762-9813784 TTGATGTAGAATGTATAATTAGG - Intergenic
987109820 5:14675148-14675170 TTGTTATAACATGTATGAACAGG - Intronic
987889905 5:23863778-23863800 TTGTTGTAACATGTCTGAACAGG + Intergenic
988195742 5:28003252-28003274 TTTTTGTAGCAATTATGAATGGG + Intergenic
989975435 5:50580516-50580538 TTGTTATAACATGTTTCAACAGG - Intergenic
990894528 5:60683992-60684014 TTTTTGTAGCTAGTATAAATGGG - Intronic
992846206 5:80751157-80751179 TTGTTAGAGCATGTCTCAATAGG + Intronic
993151577 5:84169698-84169720 AAGTTGTTGTATGTATCAATAGG + Intronic
996491053 5:124097404-124097426 TTTTTGTAGCAGCTATGAATAGG + Intergenic
996972648 5:129390950-129390972 TTGTAGTAACAATTATCAATTGG - Intergenic
997276169 5:132593305-132593327 TTGTTATAACATGTCTGAATAGG - Intronic
997497129 5:134337884-134337906 TTGTTATAACATGTCTGAATAGG - Intronic
998346256 5:141466799-141466821 TTGTTATACCATGTCTGAATAGG - Intronic
998488446 5:142524459-142524481 GTATTGTAGCAGGGATCAATGGG - Intergenic
998597444 5:143547775-143547797 TTGTTGTAACATGTCTGAACAGG - Intergenic
1000841748 5:166228438-166228460 TTGTTATAGCATGTATTTACTGG + Intergenic
1002260357 5:177989675-177989697 TGGTTGTAACATGTATGAATAGG + Intergenic
1003322991 6:5069014-5069036 TTGTTGTAGCATGTCTGAAGAGG - Intergenic
1004386024 6:15173424-15173446 ATGTTGTAGCATGTGTCAAAAGG - Intergenic
1007289914 6:40777914-40777936 ATGTTGTAGCATGTATGAGGGGG + Intergenic
1007714063 6:43844198-43844220 ATGTTGTGGCATGTATCAGTAGG + Intergenic
1008683300 6:53897276-53897298 TTGTTTTAGCCAGAATCAATTGG + Exonic
1008865273 6:56203193-56203215 TTGGTGTATCATGAATGAATTGG - Intronic
1009601912 6:65812151-65812173 TTATTGTAGATTGTATCAGTAGG + Intergenic
1010297465 6:74216776-74216798 ATGTTCTTGCATGAATCAATAGG + Intergenic
1010709506 6:79156533-79156555 TTGTTATAACATGTATGAATAGG - Intergenic
1011214610 6:84992018-84992040 TTTTTGTAGCAATTATGAATGGG - Intergenic
1012312955 6:97750895-97750917 TTGATGTAGAATGTAGCAATTGG - Intergenic
1012688699 6:102286654-102286676 TTTTTGTAGCAATTATGAATGGG - Intergenic
1013377559 6:109532561-109532583 ATGTTACAGGATGTATCAATAGG + Intronic
1014647610 6:123993867-123993889 TAGTTGTAGCATGGTTCTATTGG - Intronic
1014676002 6:124367176-124367198 TTGTTTTATGATGTATCAAATGG - Intronic
1015419424 6:132988781-132988803 TTGTTATAACATGTATAAACAGG + Intergenic
1015645708 6:135385957-135385979 ATGTTATAGCATTTACCAATGGG + Intronic
1016432159 6:143997455-143997477 GTGTTGATGCATCTATCAATAGG - Intronic
1017067375 6:150541600-150541622 TAGTTGTAAAATGTATCCATCGG + Intergenic
1017343328 6:153352167-153352189 TTGTTATAACATGTATGAACAGG + Intergenic
1017688152 6:156934215-156934237 TTATTATAGCATGTCTCAATTGG - Intronic
1019040061 6:169096304-169096326 GTGTTGTACCATGTATCAAGAGG + Intergenic
1020566182 7:9798684-9798706 ATGTTGTCGCATGTATCAATAGG - Intergenic
1021039449 7:15843872-15843894 TTTTAATAGCATGTAACAATGGG - Intergenic
1022433511 7:30354048-30354070 TTGTTCTAGTATCTTTCAATAGG - Intronic
1023241672 7:38154661-38154683 TTGTTGTGGCAAGTGTGAATGGG - Intergenic
1026515608 7:71068407-71068429 TTGTTGTAACATGTCTGAACAGG + Intergenic
1027147360 7:75705330-75705352 ATGTTGTAGCATGTAACAGCAGG + Intronic
1028905897 7:96153745-96153767 TTTTTGTAGCATTTTTCAAAAGG + Intronic
1029897716 7:104003115-104003137 GTGTTGAGGCATATATCAATAGG + Intergenic
1030358890 7:108574329-108574351 TTGTTTTAATATGTATCCATAGG - Exonic
1030525330 7:110646332-110646354 TTCTTCTAGCATGTATAATTGGG + Intergenic
1035296552 7:157870575-157870597 TTGTTGTAACATGTCTGAACAGG - Intronic
1038789893 8:30658716-30658738 TTGTTGTTGTTTGTATTAATAGG + Intergenic
1038971495 8:32641245-32641267 TTCTTCTAGAAAGTATCAATAGG - Intronic
1040064148 8:43131027-43131049 ATGTTGTTGCATGTATTAGTAGG + Intergenic
1040520232 8:48170156-48170178 TTTTTGTAGCAATTATGAATGGG + Intergenic
1040882425 8:52220995-52221017 TTTTTATACTATGTATCAATGGG + Intronic
1042890668 8:73606904-73606926 TTATTGTTGCATGCATGAATTGG - Intronic
1042971994 8:74419354-74419376 AAGTTGTTGCATGTATCAATAGG - Intronic
1043646824 8:82531820-82531842 TTTTTGTAGCAATTATGAATGGG + Intergenic
1044602862 8:94023304-94023326 ATGTTGTTGCATGTATCAGTAGG - Intergenic
1045462811 8:102441113-102441135 TTCTTTTAGCATGGATCAATAGG + Intergenic
1045631961 8:104134962-104134984 TTGTTGTAACATGTCTGAACAGG - Intronic
1045685868 8:104711634-104711656 TTCTAATAGCATGTATTAATGGG + Intronic
1046281177 8:112034046-112034068 TTGTTATAACATGTCTGAATAGG + Intergenic
1046281861 8:112044002-112044024 TTGTTGTAGCAATTGTGAATGGG - Intergenic
1050064588 9:1745774-1745796 TTGTTGTACCTTTTATCAAATGG + Intergenic
1050761906 9:9082791-9082813 TTTTTGTAGCAATTATGAATGGG - Intronic
1055905029 9:81283593-81283615 TTATTGTATAATGTATTAATTGG - Intergenic
1055940036 9:81640809-81640831 TTGTTGTAGCCTCTAACAACTGG + Intronic
1060619379 9:125049771-125049793 TTTTTGTATCATGTCTCATTTGG - Intronic
1061645822 9:132000676-132000698 ATATTGTTGCATGTATCAATAGG - Intronic
1061689337 9:132312920-132312942 TCCTTGTAGCATGTATTAATAGG - Intronic
1185998696 X:4983968-4983990 TTCTTACAACATGTATCAATCGG + Intergenic
1188249707 X:27877217-27877239 TTGTTTCGACATGTATCAATGGG + Intergenic
1188726054 X:33583454-33583476 TTGTGGTAGCATATAGCATTTGG - Intergenic
1188836262 X:34958917-34958939 TTAATGTAGTATGTAGCAATAGG + Intergenic
1188853385 X:35160299-35160321 TTGTTGTATCAAATATGAATTGG + Intergenic
1189871576 X:45389016-45389038 TTTTTGTAGCAAGTATAAATGGG + Intergenic
1191237545 X:58146560-58146582 TTTTTGTAGAATCTATGAATTGG + Intergenic
1191722269 X:64242314-64242336 TTTTTGTAGCTAGTATAAATAGG + Intergenic
1191815264 X:65237317-65237339 TTTTTGTAGCATTTATGAATGGG + Intergenic
1193583537 X:83293768-83293790 TTATTGTAGCAATTGTCAATGGG - Intergenic
1193852485 X:86556635-86556657 TTGTTGTATCATCTATCAGATGG + Intronic
1194334896 X:92633388-92633410 ATGTTGTAGCATGTATGATTAGG + Intergenic
1194364780 X:93001721-93001743 TTGTGTTAGCAAGTATCAAAAGG - Intergenic
1195250926 X:103046281-103046303 TTGTTGTAGCTATTATAAATGGG + Intergenic
1195270521 X:103224692-103224714 TTTTTGTAGCAATTGTCAATAGG - Intergenic
1196216512 X:113058515-113058537 ATGTTGTTGCATGTATCAATAGG + Intergenic
1196284089 X:113859513-113859535 TTGTTGTAGTAATTATGAATGGG + Intergenic
1196610182 X:117705147-117705169 TTGTTGCAGCATGTAGCATAAGG - Intergenic
1196883053 X:120217139-120217161 TTTTTGTAGCAATTATAAATGGG - Intergenic
1198611434 X:138405525-138405547 TTTTTGTAGCACCTATCCATTGG + Intergenic
1199087722 X:143647799-143647821 TTCTTGAAGTATTTATCAATTGG - Intergenic
1199379887 X:147158066-147158088 TTGTTGTGGCAATTATGAATGGG - Intergenic
1199688677 X:150289431-150289453 AAGTTGTTGCATGTATCATTAGG - Intergenic
1200643374 Y:5750439-5750461 ATGTTGTAGCATGTATGATTAGG + Intergenic
1200673005 Y:6117979-6118001 TTGTGTTAGCAAGTATCAAAAGG - Intergenic