ID: 1126525864

View in Genome Browser
Species Human (GRCh38)
Location 15:49653401-49653423
Sequence AGCTGAACTGCATTCCTTTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 446
Summary {0: 1, 1: 1, 2: 16, 3: 62, 4: 366}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126525864_1126525865 15 Left 1126525864 15:49653401-49653423 CCAGAAAGGAATGCAGTTCAGCT 0: 1
1: 1
2: 16
3: 62
4: 366
Right 1126525865 15:49653439-49653461 GATCAGTGAGATTTTTGTGTTGG 0: 1
1: 0
2: 1
3: 28
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126525864 Original CRISPR AGCTGAACTGCATTCCTTTC TGG (reversed) Exonic
900715677 1:4141954-4141976 CGCAGAGCTGCCTTCCTTTCTGG - Intergenic
900815063 1:4837368-4837390 GGTTGTGCTGCATTCCTTTCTGG - Intergenic
902540959 1:17154408-17154430 GGCAGGGCTGCATTCCTTTCAGG + Intergenic
904965338 1:34368419-34368441 AGCAGGGCTGCATTTCTTTCTGG + Intergenic
905316767 1:37086972-37086994 AGCTGGACTGCATTCTCATCTGG - Intergenic
906389343 1:45400328-45400350 AGCAGGGCTGCATTCCTCTCTGG - Intronic
907031682 1:51178413-51178435 AGCGGAGCTGCAGACCTTTCTGG - Intergenic
908564934 1:65344763-65344785 AGCTGTTCTGCCTGCCTTTCTGG - Intronic
909381341 1:75002389-75002411 AGCAGGGCTGCATTTCTTTCTGG + Intergenic
909903359 1:81165943-81165965 TGCTATACTGCTTTCCTTTCTGG - Intergenic
910053043 1:82998828-82998850 AGCAGGACTGTGTTCCTTTCTGG + Intergenic
910403309 1:86858216-86858238 AACTGAAATGCCTTCCATTCAGG - Intergenic
910576287 1:88768321-88768343 GGCAGGACTGCATTCCCTTCTGG + Intronic
910752801 1:90652744-90652766 TGCTGAAATGCAGTCCTTTCTGG + Intergenic
911241141 1:95468475-95468497 AGGTGAAGTGCATTTCTTGCAGG + Intergenic
911615269 1:100004008-100004030 AGGTGAACTGCATTTCTTGTAGG + Intronic
911788080 1:101976302-101976324 AGCTGAACTGCATTGTATCCAGG + Intronic
912639396 1:111330783-111330805 TGCTGAACTGCATCTCTTTGGGG - Intergenic
914200704 1:145482443-145482465 AGGTGAAGTGCAGACCTTTCTGG - Intergenic
914319771 1:146548016-146548038 AGCAGGGCTGCATTCCCTTCTGG + Intergenic
914331287 1:146673106-146673128 AGCCGAGCTGCATTCCTTTCGGG + Intergenic
914394032 1:147247735-147247757 AGCAGAGCTGCATTCCTTTCTGG + Intronic
914457490 1:147849701-147849723 GTCTGGACTGCATTTCTTTCTGG + Intergenic
914479817 1:148055571-148055593 AGGTGAAGTGCAGACCTTTCTGG - Intergenic
915645402 1:157268411-157268433 AGCTGAAGTGCCTTCTTGTCTGG + Intergenic
916012728 1:160720581-160720603 ACCTTATCTGCATTCCTCTCTGG + Intergenic
916138988 1:161677075-161677097 ACTTGAGCTGCATTCTTTTCAGG - Intronic
916964094 1:169917491-169917513 AGCAGAACTGCACTCCTATTTGG - Intergenic
918357011 1:183714279-183714301 AGCTGAACTGCATTGTTCTCTGG - Intronic
918574066 1:186034260-186034282 AGCAGAGCTGAATTCCCTTCTGG - Intronic
918623229 1:186629150-186629172 ACCTGATCTACATTTCTTTCAGG - Intergenic
920240828 1:204548378-204548400 AGCTGAACTTGATTACTTTTAGG - Intronic
920285715 1:204877867-204877889 AGCAGAAATGCATTCCACTCCGG - Intronic
920447842 1:206033389-206033411 TGGTGAACTGCATTCCTTTCTGG + Intergenic
920662859 1:207932649-207932671 AGCAAAACTGCATTCATTTGGGG - Intergenic
921668955 1:217905526-217905548 AGCAAAGATGCATTCCTTTCTGG - Intergenic
922856002 1:228775141-228775163 AGCAGGACTGCATTCCTTTCTGG + Intergenic
922996472 1:229966244-229966266 AGCTGGGCTGCATTTGTTTCTGG - Intergenic
1062931911 10:1358968-1358990 TGCTGAAAAGCATTCCTTTATGG + Intronic
1063516445 10:6700777-6700799 AGCTGAACTTCTTTGCTTCCTGG + Intergenic
1063811862 10:9720324-9720346 AACAGGGCTGCATTCCTTTCTGG - Intergenic
1065400909 10:25300191-25300213 AGCAGGGCTGCATTCCTTTTTGG + Intronic
1065685456 10:28280099-28280121 TGCTGAACTGAATTCCTGGCTGG - Exonic
1065859628 10:29861129-29861151 AGCTGGGCTGCATTCCTTTCTGG - Intergenic
1065928674 10:30459124-30459146 GGCTGAACTGCATTCGTTGCAGG + Intronic
1066440692 10:35435980-35436002 AACCGAACTTCCTTCCTTTCTGG - Intronic
1066969483 10:42301476-42301498 AATTCAACTGCATTCCATTCAGG + Intergenic
1067361547 10:45585006-45585028 AGTAGGACTGCATTCTTTTCTGG - Intronic
1068554208 10:58439966-58439988 GGCACAGCTGCATTCCTTTCTGG + Intergenic
1068618391 10:59148271-59148293 GGCTGAACTGTGTTCCTTTTTGG - Intergenic
1069813050 10:71176613-71176635 AGCTGACCTGCAATTCTATCTGG - Intergenic
1070115168 10:73521652-73521674 AGTTGAACTGCCTTCATTCCTGG + Intronic
1073833957 10:107419296-107419318 AGCTGAGTTGCATTCCTTCAGGG - Intergenic
1075210273 10:120485072-120485094 AGCAAAGCTGCATTCCTTTCTGG - Intronic
1075280632 10:121135351-121135373 TGCTGGGATGCATTCCTTTCTGG + Intergenic
1077150981 11:1073082-1073104 AGCTGAACCCCATTCCTAACGGG - Intergenic
1078120743 11:8506485-8506507 AGCGGGGCTGCATTCCTTTCTGG + Intronic
1078930577 11:15909417-15909439 AGCAGGGCTACATTCCTTTCTGG - Intergenic
1079331373 11:19535690-19535712 AGCTGAACTCCATTCCCTGTTGG + Intronic
1079429372 11:20374424-20374446 GACAGAGCTGCATTCCTTTCTGG + Intronic
1079986588 11:27206551-27206573 GGCAGGACTGAATTCCTTTCTGG - Intergenic
1080113374 11:28594687-28594709 AGCTGAGCTGCATTCCCATCTGG - Intergenic
1080291061 11:30671795-30671817 GGCAGAATTACATTCCTTTCTGG - Intergenic
1080769893 11:35330829-35330851 AGCAGGGCTGCATTCTTTTCTGG - Intronic
1081375405 11:42352328-42352350 AGCAGGGCTGCATTCCTTTCTGG - Intergenic
1081533071 11:43977541-43977563 AGCTGAGTTGCATTTCCTTCTGG - Intergenic
1081759009 11:45564074-45564096 GGCCGGATTGCATTCCTTTCTGG + Intergenic
1082751904 11:57028617-57028639 AGCAGAGCTGTGTTCCTTTCTGG + Intergenic
1083849996 11:65359729-65359751 AGCTCACCTGCATTCCTAGCTGG + Intergenic
1084634730 11:70383950-70383972 AGCTGCACTGCACTGCTTTCTGG - Exonic
1085252516 11:75152958-75152980 ATCTGAACTTCACTCCTCTCTGG - Intronic
1085884344 11:80505183-80505205 AGCAGGACTGCATTCCTTTCTGG - Intergenic
1086143778 11:83528056-83528078 AGCTTGACTGCATTGCTATCTGG + Intronic
1086192075 11:84091785-84091807 AGCTGGACTGTATTCATTTTGGG + Intronic
1086916882 11:92540325-92540347 AGCTTTACTGCATTTATTTCCGG + Intronic
1087319855 11:96644663-96644685 AGCTGATCTGTATTGCTCTCTGG + Intergenic
1087383932 11:97445849-97445871 AGTTGATCTGCATTCCTTCTTGG + Intergenic
1087886151 11:103484981-103485003 AGCTGAACTGAGTGCCTTCCAGG - Intergenic
1088379354 11:109176024-109176046 AGTTGCACTGCCTTCCTTTTTGG - Intergenic
1090670748 11:128943483-128943505 ATCTGAGTTGCATTTCTTTCTGG - Intergenic
1091006666 11:131960052-131960074 AGCTGATTTGAATTCCTTCCAGG + Intronic
1092128588 12:6092672-6092694 TGCTGACCAGCATTCCTTCCTGG + Intronic
1092845340 12:12579794-12579816 AGCAGGGCTGCATTCTTTTCTGG + Intergenic
1093616222 12:21228753-21228775 AGCAGGGCTGTATTCCTTTCTGG - Intronic
1094320261 12:29174911-29174933 AGCTGAATGGCTTTCCTCTCTGG + Intronic
1095168634 12:39006192-39006214 GGCAGAACTGCCTTTCTTTCTGG - Intergenic
1095445689 12:42279850-42279872 GGCAGAACTGAATTCCTTGCAGG + Intronic
1095477085 12:42596536-42596558 AGCTGATCTGCACTTCCTTCAGG + Intergenic
1095545453 12:43362930-43362952 AGCAGGGCTGCATTCCTTTCTGG - Intronic
1095615651 12:44184702-44184724 AGCAGAGCTGAGTTCCTTTCTGG - Intronic
1095648733 12:44581521-44581543 AGCTAAAACTCATTCCTTTCAGG - Intronic
1095923035 12:47550111-47550133 GGCTGCACTGCATTCCATCCTGG + Intergenic
1096034034 12:48448106-48448128 ATCAGGGCTGCATTCCTTTCTGG - Intergenic
1096520021 12:52179787-52179809 AGCTGAACTGCAGACCTCTGTGG + Intronic
1098576753 12:72051440-72051462 AACAGGACTGCACTCCTTTCTGG + Intronic
1100059307 12:90553232-90553254 AGCTGAGCTGTGTTCCTATCAGG - Intergenic
1100108339 12:91205922-91205944 GGCAGGGCTGCATTCCTTTCTGG + Intergenic
1100239491 12:92697022-92697044 GGCTAGGCTGCATTCCTTTCTGG - Intergenic
1100648404 12:96557083-96557105 AACCGAGCTGTATTCCTTTCTGG + Intronic
1100792882 12:98150023-98150045 AGCTGGGCTGAGTTCCTTTCTGG + Intergenic
1100966653 12:100020730-100020752 AGCAGGGCTGCACTCCTTTCTGG - Intergenic
1101339207 12:103826572-103826594 TGCAGGACTGCATTTCTTTCTGG - Intronic
1102447801 12:113016980-113017002 AGCTGGGCTGCCTTCCTTTCTGG - Intergenic
1103157891 12:118702479-118702501 CGCAGAGCTGCATTCCATTCTGG - Intergenic
1103648076 12:122410972-122410994 AGCTGAACCTCATTCATTGCTGG + Intronic
1106062439 13:26307507-26307529 AGCAGGACTGCATTCTTCTCTGG - Intronic
1106387235 13:29299659-29299681 TGGGGAACTGCATTCCATTCAGG + Intronic
1107649348 13:42528377-42528399 ATCAGGACTGCGTTCCTTTCTGG - Intergenic
1108033092 13:46257302-46257324 AGCAGGACTGCATTGCTATCTGG - Intronic
1108204676 13:48075483-48075505 AGCAGGGCTGCATTCCTTCCTGG - Intronic
1108793152 13:53997123-53997145 AGCAGGACTGCATTTCTTTCTGG - Intergenic
1109929721 13:69198884-69198906 TGCTGGACTGCATTCCTATCTGG - Intergenic
1110139750 13:72114132-72114154 AGCCAGACTGCATTCCTTCCTGG + Intergenic
1110652046 13:77952862-77952884 AGGCAAACTGCATTCCTTTGAGG + Intergenic
1110698592 13:78520494-78520516 AGCTGGTCTACATTCTTTTCTGG + Intergenic
1111882718 13:93978225-93978247 GGCAGAGCTGCATTCCTCTCTGG - Intronic
1113057481 13:106285030-106285052 GGCAGGGCTGCATTCCTTTCTGG + Intergenic
1113472434 13:110556425-110556447 TGCAGGATTGCATTCCTTTCTGG - Intronic
1114202466 14:20535425-20535447 AGCTGAGTTGCATTCTTATCTGG + Intergenic
1114802210 14:25789772-25789794 ACTTGAACTGCAATTCTTTCTGG + Intergenic
1115544502 14:34453544-34453566 AGCTGAGCTGCCTGCCTGTCTGG + Intronic
1116834804 14:49759722-49759744 AGGTGAAGTGCATTTCTTCCAGG + Intergenic
1118888818 14:69889732-69889754 AGCAGGACTGAGTTCCTTTCTGG + Intronic
1119179541 14:72596159-72596181 AGGAGGGCTGCATTCCTTTCAGG + Intergenic
1119867766 14:77988372-77988394 ACCAGGGCTGCATTCCTTTCTGG - Intergenic
1121193617 14:92050629-92050651 AGATGAACTGTTTTCCTTTGAGG - Exonic
1121272071 14:92644439-92644461 GGAAGAACTGCATTCCTTTCTGG + Intronic
1124184079 15:27506575-27506597 AGCAGGGCTGCATTCTTTTCTGG - Intronic
1125175468 15:36817288-36817310 AGCTATTCTGCATTCTTTTCAGG - Intergenic
1125425256 15:39542395-39542417 GGTAGAGCTGCATTCCTTTCTGG + Intergenic
1126200902 15:45984729-45984751 AGCCAGACTGCATTTCTTTCTGG - Intergenic
1126277762 15:46904157-46904179 TGCTGAATTGTATTTCTTTCTGG + Intergenic
1126525864 15:49653401-49653423 AGCTGAACTGCATTCCTTTCTGG - Exonic
1127264917 15:57353417-57353439 AGCAGGGGTGCATTCCTTTCTGG - Intergenic
1128373626 15:67059547-67059569 AGCTGAACTGCCTGCCTCTCTGG + Intergenic
1129889704 15:79063830-79063852 AGCTGAACTGAGTCCCTTTTGGG - Intronic
1130620862 15:85460860-85460882 ATCTGAGCTACATTCCTTTCAGG - Intronic
1131737208 15:95346528-95346550 AGTAGAACTTTATTCCTTTCTGG - Intergenic
1131796935 15:96028771-96028793 AGCAGAAATGCTTTCTTTTCTGG + Intergenic
1133481250 16:6172888-6172910 GGCAGAGCTGCACTCCTTTCTGG + Intronic
1133899935 16:9964549-9964571 AGCAGGATTGCTTTCCTTTCCGG + Intronic
1134295703 16:12943715-12943737 AGCTGACCTCCATTCTGTTCTGG + Intronic
1136087625 16:27896823-27896845 AGCCGGACTGTGTTCCTTTCTGG - Intronic
1137744249 16:50809318-50809340 AGCTGCAATGCATTCCCTCCAGG - Intergenic
1138110979 16:54323675-54323697 AGCTGAACAGGGTTCCTTTGAGG + Intergenic
1138577077 16:57914930-57914952 AGATGACCTGCATTCATATCTGG + Intronic
1140002269 16:71037795-71037817 AGCCGAGCTGCATTCCTTTCGGG - Intronic
1140013757 16:71162061-71162083 AGCAGGGCTGCATTCCCTTCTGG - Intronic
1140732110 16:77865774-77865796 AGCTGCACTGGCCTCCTTTCAGG - Intronic
1140762587 16:78124073-78124095 AGCCAAAGTGTATTCCTTTCTGG - Intronic
1140922523 16:79552255-79552277 TGCTGAACTGCACTCCAATCTGG - Intergenic
1141035875 16:80625193-80625215 AGCAAGACTGCATTCCTTTGTGG + Intronic
1141761127 16:86029365-86029387 AGCCGAAGTGCATACATTTCCGG + Intergenic
1143365264 17:6404161-6404183 GGCAGGGCTGCATTCCTTTCTGG + Intronic
1146456191 17:33011649-33011671 AGCAGGGCTGCATTTCTTTCTGG - Intergenic
1147192538 17:38746516-38746538 AGCTGAACTGCTTTTGTTGCTGG - Intronic
1147702910 17:42407070-42407092 ACCAGAACTGCTTTCCATTCCGG + Intronic
1148625340 17:49065086-49065108 GGTAGGACTGCATTCCTTTCTGG + Intergenic
1148719336 17:49739659-49739681 AGATGAACTGGTTTCATTTCTGG + Intronic
1150990671 17:70254619-70254641 AGCAGAGCTACATTCCTTTCTGG - Intergenic
1153902020 18:9625703-9625725 AGCAGGGCTGCATTCCTTTCTGG + Intergenic
1153902217 18:9627771-9627793 AGCAGGGCTGCATTCTTTTCTGG + Intergenic
1154195989 18:12267369-12267391 AGCTGAAGAGCATTCTGTTCAGG - Intronic
1154495716 18:14958955-14958977 TTCTAAACTGCATGCCTTTCTGG - Intergenic
1156255556 18:35392462-35392484 AGCAGTGTTGCATTCCTTTCTGG - Intergenic
1157328021 18:46682920-46682942 TGCAGAACTGCATTCCTTTCTGG - Intronic
1157521748 18:48350230-48350252 AGCTTAGCTGTATTCCTTCCTGG + Intronic
1158846006 18:61443616-61443638 AGCTGATTTGCATTCTTTTGTGG - Intronic
1159687680 18:71443766-71443788 AGCAAATCTGCATTCCTTTCTGG + Intergenic
1161140673 19:2645924-2645946 AGCGGTGCTGCATGCCTTTCCGG - Intronic
1164797784 19:31048331-31048353 AGCAGGGCTGCATTCCTCTCTGG - Intergenic
1165055182 19:33171644-33171666 AACAGGACTGCATTCCTTTCAGG + Intronic
1165488246 19:36108323-36108345 AGATGAACTGTTTTCCTTCCAGG - Intergenic
925273836 2:2635226-2635248 AGCTGGTCTGCATGCCTCTCTGG + Intergenic
925388047 2:3476519-3476541 AGCTAAACTGCATCCCTCTGGGG - Intronic
925435390 2:3832990-3833012 GGCTTGGCTGCATTCCTTTCTGG + Intronic
925686922 2:6482379-6482401 AGCTGCACTGCAACCCTCTCAGG + Intergenic
926436127 2:12839839-12839861 AGCAGGACTGTACTCCTTTCTGG - Intergenic
926845122 2:17128155-17128177 AGCCTGCCTGCATTCCTTTCTGG - Intergenic
928426869 2:31186460-31186482 AGTTGAACTGCATTAATCTCTGG + Exonic
928462115 2:31484929-31484951 TGCTGAACTGCATTTCCTTGGGG - Intergenic
928807051 2:35171453-35171475 AGCAGGAATGCATTCTTTTCTGG - Intergenic
929480832 2:42306357-42306379 ATCTGAAGTGAATTCCTTTGTGG - Intronic
930386827 2:50707427-50707449 AGCTGCAGTAGATTCCTTTCAGG + Intronic
930721688 2:54644319-54644341 AAATGAGCTGCATTCCTTCCTGG - Exonic
930990988 2:57654638-57654660 AGCAGGACTGACTTCCTTTCTGG - Intergenic
933177498 2:79191971-79191993 AGCTGATCAACATTCCTTCCTGG - Intronic
933244362 2:79958596-79958618 AGGAGACCGGCATTCCTTTCTGG - Intronic
934063384 2:88317835-88317857 GGCAGAGCTGCTTTCCTTTCTGG - Intergenic
934697564 2:96410988-96411010 AGCTGAGCTGCAGCCCTTCCTGG - Intergenic
935847668 2:107184354-107184376 AGCTGAGCTGTGTTCCTTTTGGG + Intergenic
936620810 2:114095411-114095433 AGCAGAACTGCATATTTTTCTGG + Intergenic
936997228 2:118428210-118428232 AGCAGGGTTGCATTCCTTTCTGG + Intergenic
937374196 2:121324065-121324087 GGCTGAGCTGAGTTCCTTTCTGG - Intergenic
938576941 2:132613569-132613591 TGCTGAACTGCAAGCCCTTCAGG + Intronic
938738362 2:134207046-134207068 AGCAGGACTGTGTTCCTTTCAGG + Intronic
938998482 2:136706048-136706070 AGCAGAGCTGCATGCCATTCTGG - Intergenic
939379245 2:141413477-141413499 GGCCGGGCTGCATTCCTTTCTGG - Intronic
942359454 2:175156720-175156742 GGCAGAGCTGCATTCCTTTTTGG - Intronic
943070966 2:183140195-183140217 AGCAGGACTGCATTCCTTTCTGG + Intronic
943538693 2:189184474-189184496 AGCAGGGCTGCATTCCTTTTTGG + Intergenic
943745054 2:191453586-191453608 AGCTGAGCTGCGTTTCTCTCTGG - Intergenic
944944608 2:204669029-204669051 AGTGGACCTGAATTCCTTTCTGG - Intronic
945061781 2:205915722-205915744 AGCAGGGCTGCATTCCTTTCTGG + Intergenic
945165015 2:206934188-206934210 ACCTGTTCTGCATTCCTCTCAGG - Intergenic
945230942 2:207589217-207589239 AGCAGGACTGCATTCCTTCCTGG + Intronic
946150962 2:217770227-217770249 AGCAGGGCTGCATTTCTTTCTGG + Intergenic
946787806 2:223266195-223266217 AGCAGGATTGCGTTCCTTTCTGG - Intergenic
948114320 2:235482906-235482928 GGCAGGGCTGCATTCCTTTCTGG - Intergenic
1169010308 20:2244839-2244861 AGCTGACCTGAATCCCTTCCAGG + Intergenic
1169448894 20:5694611-5694633 GGCTTGACTGCCTTCCTTTCTGG + Intergenic
1169524998 20:6414802-6414824 AACAGGGCTGCATTCCTTTCTGG - Intergenic
1169775543 20:9248927-9248949 GGCAGAGCTGCTTTCCTTTCTGG + Intronic
1170243254 20:14193425-14193447 AGCTGAACTGTGTTTCCTTCTGG - Intronic
1170391077 20:15875109-15875131 AGCTAGGCTGCTTTCCTTTCTGG - Intronic
1171136635 20:22700788-22700810 AACTCAGCTGCATTCATTTCTGG - Intergenic
1172593378 20:36132753-36132775 AGGTGCACTGCCTTCCTTCCGGG - Intronic
1173492719 20:43496245-43496267 AGCAGAGCTGCATTCCTTTCTGG - Intergenic
1173679994 20:44871894-44871916 AGCTGGGCTGCATTCCTTTCTGG - Intergenic
1174558096 20:51410854-51410876 AGCTGAAATCTATTTCTTTCTGG + Intronic
1175274653 20:57759951-57759973 AGCAGGGCTGCATTCCTTTCTGG + Intergenic
1176896535 21:14384907-14384929 AGCAAAGCTGCATTCCTTTCTGG + Intergenic
1177067022 21:16451674-16451696 AACACAACTGCATTCATTTCAGG + Intergenic
1177427758 21:20947138-20947160 GGCTGGACTGTGTTCCTTTCTGG - Intergenic
1178683720 21:34695126-34695148 AGCAGGGCTGCATTTCTTTCTGG + Intronic
1178792499 21:35713226-35713248 ATCAGGGCTGCATTCCTTTCTGG + Intronic
1179252580 21:39684887-39684909 GGCAGGGCTGCATTCCTTTCTGG + Intergenic
1182397684 22:30048066-30048088 AGCAGGACTGTGTTCCTTTCTGG - Intergenic
1182744449 22:32594809-32594831 GGCTAAACTCCATTCCCTTCAGG - Intronic
1182755114 22:32673051-32673073 ATCTGATGTGGATTCCTTTCTGG + Intronic
1183213053 22:36462700-36462722 AGCTATACTGCTTTCCTTTTGGG - Intergenic
1183878557 22:40805731-40805753 AGCAGAGCTGTATTCCTTTTTGG - Intronic
1184889850 22:47373008-47373030 TGCTGAACTGTATTCCATGCTGG - Intergenic
949234044 3:1787067-1787089 GGCTGAGCTGCATTTTTTTCTGG + Intergenic
949357493 3:3197536-3197558 AGCAGGTCTGCATTCCATTCTGG + Intergenic
950067495 3:10124672-10124694 AGCAGGACTGCCTTCCTTTCTGG + Intronic
950101811 3:10361791-10361813 AGCTGAATTCTATTCCTCTCTGG + Intronic
950298872 3:11856733-11856755 AGCTGAACTGCACTCCAGCCTGG - Intergenic
950902262 3:16508487-16508509 AGCTGAACTGAATTCTTATTTGG + Intronic
951203327 3:19898701-19898723 AGCTTAACTGCATAACTTTGTGG + Intronic
954831995 3:53428870-53428892 ATCAGTACTTCATTCCTTTCGGG + Intergenic
954977702 3:54712307-54712329 AGCTGAACTGTATTCCTTTCTGG + Intronic
955463221 3:59208462-59208484 AGCAGGACTGCATTCCTTTCTGG - Intergenic
955598566 3:60618953-60618975 AGCCGTACTGCATTCCTTTTTGG - Intronic
956336610 3:68171337-68171359 AGAAGGACTGCATTTCTTTCTGG - Intronic
956764315 3:72471532-72471554 AGCAGGGCTGCATTCCTTTCTGG + Intergenic
956952890 3:74302630-74302652 ATCTTAACAGCATTCCTTACTGG - Intronic
957118774 3:76061810-76061832 AGCAGGACTGAATTCCTTTCTGG + Intronic
957946493 3:87069736-87069758 GGCAGGGCTGCATTCCTTTCTGG - Intergenic
958711786 3:97725454-97725476 AGCACAACTGCATTGCTTTGGGG - Intronic
958951808 3:100425063-100425085 AGCTGACCTGCATGCCTTCTTGG + Intronic
958997580 3:100922712-100922734 GGCAGGGCTGCATTCCTTTCTGG - Intronic
959016843 3:101144308-101144330 AGCAGGGCTGCATTCCTTTCTGG - Intergenic
959592668 3:108097163-108097185 CGCTGAGCTGCTTTCCCTTCCGG + Intergenic
960723382 3:120646348-120646370 TGCTGAACCGCATTCCTCTCTGG + Exonic
960748504 3:120917991-120918013 CACAGAACTGCATTCCTTTCTGG + Intronic
960875146 3:122288308-122288330 GGCAGGGCTGCATTCCTTTCTGG - Intergenic
961580425 3:127876164-127876186 GGCAGGACTGCATTCCTCTCTGG - Intergenic
962257416 3:133882035-133882057 AGCTGGGCTACATTTCTTTCTGG + Intronic
963033915 3:141008177-141008199 AGCCAACCTGCATTCCTTTCTGG - Intergenic
963204481 3:142618494-142618516 AGCAGGACTGCGTTCCTTTCTGG + Intronic
963220425 3:142804061-142804083 AGAAGAACTGCAGTCCTTTGTGG + Exonic
963388840 3:144632009-144632031 AACTGAGCTGCATTCCTTTTTGG - Intergenic
963826321 3:149958263-149958285 AGCAGGACTGTGTTCCTTTCTGG + Intronic
964561013 3:157996697-157996719 TGCAGAGCTGCATTCCTTTCTGG + Intergenic
964813532 3:160692047-160692069 AGCAGAGCTGCATTTCTTTTTGG - Intergenic
965081952 3:164045128-164045150 AGCAGGACTGCATTCCTTTCTGG + Intergenic
965294544 3:166926879-166926901 TGAAGAACTGTATTCCTTTCAGG + Intergenic
965701959 3:171467250-171467272 ATCAGGGCTGCATTCCTTTCTGG - Intergenic
966926993 3:184651107-184651129 AGCTGGACAGGAGTCCTTTCTGG - Intronic
967354467 3:188552571-188552593 AGCAGAGCTTCGTTCCTTTCTGG + Intronic
969387321 4:6862977-6862999 AGCTGAACTGGAGACCCTTCAGG + Exonic
969521671 4:7681519-7681541 AGTGGAATCGCATTCCTTTCTGG - Intronic
970268871 4:14321352-14321374 AGCAGGGCTGAATTCCTTTCTGG + Intergenic
970493362 4:16599227-16599249 AGCAGGGCTGAATTCCTTTCTGG + Intronic
970554540 4:17217957-17217979 GGCTAGGCTGCATTCCTTTCTGG + Intergenic
970639157 4:18044479-18044501 AGCTGAGCTGCCTTTCTTTCTGG - Intergenic
970858760 4:20677936-20677958 GGCAGGGCTGCATTCCTTTCTGG - Intergenic
971285197 4:25282224-25282246 AGTAGGGCTGCATTCCTTTCTGG + Intergenic
971822000 4:31569562-31569584 AGCTGAAATTCATTACTATCTGG - Intergenic
972039887 4:34579763-34579785 GGCAGGAGTGCATTCCTTTCTGG - Intergenic
972408611 4:38769087-38769109 AGATAAATTGCAATCCTTTCTGG - Intergenic
972430471 4:38976487-38976509 AGCTGGACTGCATTCCCATCTGG - Intronic
973572340 4:52253219-52253241 AGCTGACCAGCATTTCTTCCTGG - Intergenic
975049516 4:69842878-69842900 AGCTGCACTGCATTCCAGCCTGG - Intronic
975062524 4:70020073-70020095 AGCAGGACTGAATTCTTTTCTGG + Intergenic
976044325 4:80927580-80927602 GGCAGAGCTGCATTTCTTTCCGG + Intronic
976555793 4:86449990-86450012 AGCTGGGCTGCATTTCCTTCTGG - Intronic
976650653 4:87430262-87430284 AGCAGGGCTGCATTCCTCTCTGG - Intronic
977382861 4:96298834-96298856 AGCAAAGCTGCATTCTTTTCTGG - Intergenic
977576942 4:98684966-98684988 AGCAGGGCTGCACTCCTTTCTGG + Intergenic
977633970 4:99273902-99273924 AGCTGGCCTGTGTTCCTTTCTGG - Intergenic
978719412 4:111889798-111889820 AGCTGGGCTGCATTCCTTACTGG - Intergenic
979719504 4:123882433-123882455 AGCTGAGCTGCATTTTTTTCTGG - Intergenic
981343908 4:143653258-143653280 AGCTGGACTGCATTCTCATCTGG + Intronic
981410069 4:144419369-144419391 AACTGAACTCCATACTTTTCTGG + Intergenic
982276918 4:153645328-153645350 GGCAGGGCTGCATTCCTTTCTGG + Intergenic
983302571 4:165946212-165946234 AGCAGAGCTGCATTCCATTCTGG - Intronic
984155398 4:176190518-176190540 GGCAGGGCTGCATTCCTTTCTGG + Intronic
985045046 4:185932184-185932206 AGCTGAACAGCAATGCTTGCGGG + Intronic
985241154 4:187932217-187932239 AGCATAACTGCAGTCCTTGCAGG - Intergenic
986523340 5:8644998-8645020 ACCTAAACTGCTTTCCTTTAGGG + Intergenic
986658860 5:10041332-10041354 CGCTGGGCTGCATTCCTTCCTGG + Intergenic
987228483 5:15868299-15868321 AGGAGAGCTGCATTCTTTTCTGG - Intronic
987837236 5:23177680-23177702 AGATGAACAGCAGACCTTTCAGG - Intergenic
989114515 5:37939452-37939474 GGCTGAACAGAATTCCTTTCTGG + Intergenic
990136553 5:52651925-52651947 AGTTGAAATGCATTCCCTGCAGG + Intergenic
990629300 5:57650756-57650778 AGGTGAATTGCATTCCTACCTGG - Intergenic
991383341 5:66056915-66056937 AACTCTACTGCATTCCTTTTAGG + Intronic
991553856 5:67873495-67873517 ATTTGAAATGCATTCCTATCAGG - Intergenic
991603229 5:68374114-68374136 AGAAGGGCTGCATTCCTTTCTGG - Intergenic
993161729 5:84300122-84300144 AGCAGGGCTGCATTCCCTTCTGG + Intronic
993166057 5:84356386-84356408 TCCAGAACTGCACTCCTTTCTGG + Intronic
993986868 5:94607780-94607802 AGCGGAGCTTCATTCCTTTTTGG + Intronic
995404140 5:111774764-111774786 AGCAGGGCTGCATTCCTTTCTGG - Intronic
995765248 5:115608288-115608310 AGCTGAACTGCATTGTCATCTGG - Intronic
995991918 5:118249788-118249810 AGCTAAAATGCATTTCTTGCAGG - Intergenic
997007120 5:129831090-129831112 ATCAGAACTTCATTCCTTTCTGG - Intergenic
997261566 5:132469332-132469354 AGCAGGGCTGCATTCCTTCCTGG - Intronic
998620010 5:143783236-143783258 AGCGGGGCTGCAATCCTTTCTGG - Intergenic
999218211 5:149954018-149954040 AGCAGAACTGCTGGCCTTTCCGG - Intergenic
999403513 5:151285899-151285921 GGCAGAGCAGCATTCCTTTCTGG - Intronic
1001104757 5:168843697-168843719 TGCTGTACTGCCTTCCTCTCTGG + Intronic
1002900330 6:1405404-1405426 AGCGGGACTGCATTCTTTTGGGG + Intergenic
1003790577 6:9542601-9542623 AGCTGAATTGCATTTCTTGGTGG + Intergenic
1004701191 6:18080961-18080983 AGCTGAGCTGCATTCTGGTCTGG - Intergenic
1004740930 6:18460162-18460184 AGCCGGGCTGCATTTCTTTCTGG + Intronic
1004905613 6:20234621-20234643 AGCTGGGCTACATTCTTTTCTGG + Intergenic
1005022807 6:21433807-21433829 GACTGGGCTGCATTCCTTTCTGG - Intergenic
1005153084 6:22775205-22775227 GGCTGACCTGGATTCCTTCCAGG + Intergenic
1007246245 6:40465230-40465252 GGCAGAGCTACATTCCTTTCAGG - Intronic
1008349279 6:50470927-50470949 TCCTGAACTGCAATACTTTCAGG + Intergenic
1008416709 6:51249207-51249229 AGCAAAGCTGCATTCCTTTCAGG + Intergenic
1008881553 6:56385354-56385376 GGCAGAGCTGCATTCCTTTCTGG + Intronic
1008948984 6:57133727-57133749 AGCTGCACTGCACTCCATCCTGG - Intronic
1010546262 6:77160240-77160262 AGGTGAAGTGCATTTCTTACAGG + Intergenic
1010646071 6:78389105-78389127 AGCAGGACTACATTCCTTTCTGG + Intergenic
1010812622 6:80317347-80317369 AACAGAGCCGCATTCCTTTCTGG + Intronic
1012037118 6:94156419-94156441 AACAGAGCTGCATTCCCTTCAGG + Intergenic
1012435560 6:99211653-99211675 GGCAGGGCTGCATTCCTTTCTGG + Intergenic
1012738759 6:102985685-102985707 AGAAGAACTGCATTTCTTTCTGG - Intergenic
1013388278 6:109654815-109654837 AACTGAGCTGCATCACTTTCTGG - Intronic
1013945580 6:115718366-115718388 AGCAGGGCTGTATTCCTTTCTGG - Intergenic
1014391776 6:120873119-120873141 AGAAGAGCTGCATTCCTTTGGGG + Intergenic
1014851955 6:126351562-126351584 AGATTAACTGCATTTTTTTCTGG + Intergenic
1014911829 6:127104014-127104036 AGATGAACAGCTTTCTTTTCTGG + Intergenic
1015873684 6:137801749-137801771 AGCCAGGCTGCATTCCTTTCTGG + Intergenic
1017533575 6:155322315-155322337 AGCAGGGCTGCCTTCCTTTCTGG - Intergenic
1017815224 6:158011334-158011356 AGCAGAACTTCATTCTCTTCTGG - Intronic
1017934344 6:158991574-158991596 AGCTGAATTGCAGTCCTATCTGG - Intronic
1018145755 6:160886648-160886670 AGTTGAATGGCTTTCCTTTCTGG - Intergenic
1018598535 6:165511912-165511934 AGGTGAAGTGCATTTCTTACAGG + Intronic
1019068554 6:169323087-169323109 ACCTGAACTGCATTTCTGTTGGG - Intergenic
1020018971 7:4850755-4850777 GGCTGGGCTGCGTTCCTTTCTGG - Intronic
1020744481 7:12064669-12064691 AGCAGGGTTGCATTCCTTTCTGG - Intergenic
1021160316 7:17264518-17264540 AGCAGAGCTGCATTCCTTTTTGG - Intergenic
1021620276 7:22544435-22544457 AGCAGGACTGCATTCCTTTCTGG + Intronic
1021947203 7:25739803-25739825 AGCTGAGAAGTATTCCTTTCTGG + Intergenic
1021969837 7:25954607-25954629 AGCAGGGGTGCATTCCTTTCTGG + Intergenic
1022349321 7:29552554-29552576 GGCAGGACTGCATTCCTTTATGG + Intergenic
1022407550 7:30105438-30105460 TGCACTACTGCATTCCTTTCTGG + Intronic
1022658898 7:32347815-32347837 GGCTGGACTGCATTCTTATCTGG - Intergenic
1023500607 7:40845349-40845371 AGCTGAGATGCATTCCATTTTGG + Intronic
1024189766 7:46994203-46994225 AGCGCCACTGCATTCCATTCTGG - Intergenic
1024934911 7:54702195-54702217 AGCTGACCTGGAGTCCTTTGGGG + Intergenic
1025946703 7:66110231-66110253 AGCTGGGCTGCAGTCCTTTCTGG + Intronic
1026088353 7:67280646-67280668 AGCGCCACTGCATTCCATTCTGG + Intergenic
1026173907 7:67978711-67978733 GGCAGAGCTGCATCCCTTTCTGG - Intergenic
1026241363 7:68578219-68578241 AGCACCACTGCACTCCTTTCTGG + Intergenic
1026725900 7:72869681-72869703 AGCGCCACTGCATTCCATTCTGG - Intergenic
1027273851 7:76539496-76539518 AGCGCCACTGCATTCCATTCTGG - Intergenic
1027327297 7:77058548-77058570 AGCGCCACTGCATTCCATTCTGG - Intergenic
1027839203 7:83286179-83286201 AGATGAATTGCATTCTTATCTGG - Intergenic
1027958734 7:84916729-84916751 AGCTGAAGTGCATGGCTTACAGG - Intergenic
1028266298 7:88730690-88730712 AGGTGAAGTGTATTTCTTTCGGG + Intergenic
1028527643 7:91803030-91803052 GGCACAGCTGCATTCCTTTCTGG + Intronic
1028534164 7:91873233-91873255 AGCAAGGCTGCATTCCTTTCTGG + Exonic
1028668814 7:93377299-93377321 AGAGGAAATGCAGTCCTTTCAGG + Intergenic
1028720754 7:94028047-94028069 AGCAGGACTGCATTCCTTCCTGG - Intergenic
1029699179 7:102235296-102235318 GGCTGAACTGCATCCCTTAGGGG + Intronic
1029719548 7:102354071-102354093 AGCGCCACTGCATTCCATTCTGG - Intergenic
1029753067 7:102555187-102555209 AGCGCCACTGCATTCCATTCTGG + Intronic
1029771018 7:102654279-102654301 AGCGCCACTGCATTCCATTCTGG + Intronic
1030548402 7:110927684-110927706 AGCAAAGCTGCATTCTTTTCTGG - Intronic
1031452388 7:121937708-121937730 AGCTAAACTTCATTCCCTTAGGG + Intronic
1033183581 7:139204286-139204308 GGCAGGACTGCATTCCTTTCTGG - Intergenic
1033214017 7:139481205-139481227 AGTGGGGCTGCATTCCTTTCTGG - Intronic
1033982135 7:147178410-147178432 GGCAGGACTACATTCCTTTCTGG - Intronic
1037072070 8:14663040-14663062 GGCAGAACTGCATTTCTTTCTGG - Intronic
1037134947 8:15449462-15449484 ATCTGACCAGCATTCCTTCCTGG - Intronic
1037397023 8:18453864-18453886 AGCTGGACTGCATGACTTTAAGG - Intergenic
1039101469 8:33946527-33946549 AGCAGGACTGCATTCCCTTCTGG + Intergenic
1039211758 8:35224626-35224648 AGATTGACTGCATTTCTTTCAGG + Intergenic
1040793099 8:51256759-51256781 AGCCGAGCTGCATTCCCATCTGG + Intergenic
1041636075 8:60146521-60146543 AGCTGGGCTGCATTCCTTTCTGG + Intergenic
1043669574 8:82865202-82865224 TGCCGGACTGCATTCCTTTTAGG + Intergenic
1044875240 8:96658868-96658890 GGCAGGACTGCATCCCTTTCTGG - Intronic
1045099754 8:98832488-98832510 AACTGACCAGCATTCCTTTCTGG - Intronic
1045568614 8:103346849-103346871 AGCTCAACTGCACTCCAGTCTGG + Intergenic
1045635200 8:104178184-104178206 GGCAGGACTACATTCCTTTCTGG + Intronic
1045684179 8:104694129-104694151 AGCTTAGCTGAATGCCTTTCTGG - Intronic
1046358751 8:113122712-113122734 ATCAGAGCTGCATTCCTTTCTGG - Intronic
1047809712 8:128395386-128395408 TAATGAACTGCATTTCTTTCTGG - Intergenic
1047919316 8:129617529-129617551 AGCAGGGCTGCATTCCTTTCTGG - Intergenic
1048444950 8:134486283-134486305 AGATGAACTGCCTTCACTTCGGG + Intronic
1050982233 9:12035227-12035249 ATCAGGGCTGCATTCCTTTCTGG - Intergenic
1051303752 9:15684687-15684709 TGCTGAACTGAATGCATTTCTGG - Intronic
1051880441 9:21834505-21834527 AGCACGGCTGCATTCCTTTCTGG + Intronic
1053155890 9:35778977-35778999 AGCTCAACTGCATTCCTCAATGG - Intergenic
1056104845 9:83336906-83336928 AACTGATCAGCATTCCTTCCTGG + Intronic
1056479075 9:86982593-86982615 GGCAGAGTTGCATTCCTTTCTGG - Intergenic
1056888101 9:90463573-90463595 AGCTGAGCTCCATGCCTTTGAGG + Intergenic
1058962447 9:110005066-110005088 TGGTGAGCTGCATTCCTTTGGGG + Intronic
1059765004 9:117375819-117375841 AGCAGGGCTGCATTCCCTTCTGG + Intronic
1061429035 9:130519496-130519518 AGCTGATCTGCACGCCTCTCAGG + Intergenic
1185789986 X:2921923-2921945 AGCCGAGCTGCATTCCTCACAGG - Exonic
1186081192 X:5934569-5934591 GGCAGGGCTGCATTCCTTTCTGG - Intronic
1186296245 X:8151769-8151791 AGCTGCACTGCATTTCCATCGGG + Intergenic
1186489329 X:9959343-9959365 AGCAGAGCTGTGTTCCTTTCTGG + Intergenic
1186554085 X:10538655-10538677 AGCAAAACTGGATTCCTTTTTGG + Intronic
1186644348 X:11490441-11490463 AGCTGAGCTGCATTTCTCTCTGG - Intronic
1186676059 X:11818577-11818599 AGCAGGGCTGCATTCCTTTCTGG - Intergenic
1186965710 X:14784313-14784335 AGCAGAGCTGCATTCCTTTCTGG + Intergenic
1187791562 X:22955922-22955944 AACTGACCAGCATTCCTTCCTGG + Intergenic
1187800668 X:23059277-23059299 AGCAGGGCTGCATTCCTTTTTGG + Intergenic
1188138481 X:26519168-26519190 AGCAGGGCTACATTCCTTTCTGG - Intergenic
1188247973 X:27856961-27856983 AGCTGCACTGCATCCTTCTCTGG + Intergenic
1188518376 X:31011699-31011721 ATCAGAACTTCATTCCTTTATGG - Intergenic
1190487577 X:50943044-50943066 AGCTGACCTGAAATCCTTTTGGG - Intergenic
1192851748 X:74963841-74963863 GGCTGAGGTGCATTCCTTTCTGG + Intergenic
1193079979 X:77397290-77397312 AGCAGGGCTGCATTCATTTCTGG + Intergenic
1193090796 X:77492305-77492327 AGCAGAACTGTGTTCCTTTTTGG + Intergenic
1193409878 X:81149652-81149674 AGGTGAATTGTATTTCTTTCAGG - Intronic
1194581980 X:95684595-95684617 GGCAGAGCTGCATTCCTTTCTGG - Intergenic
1195491399 X:105474300-105474322 AGCAGGGCTGCATACCTTTCTGG - Intronic
1195543524 X:106089301-106089323 AGCTGACCTGAATGGCTTTCAGG - Intergenic
1195622764 X:106973854-106973876 GGCAGGGCTGCATTCCTTTCTGG - Intronic
1196057336 X:111369812-111369834 TGCTGAAGGGCATTCTTTTCTGG + Intronic
1196123545 X:112075917-112075939 AGCAGGACTGCCTTCCCTTCTGG - Intronic
1196579740 X:117364756-117364778 AGCAGGGCTGCATTCCTTTCTGG + Intergenic
1196595430 X:117540615-117540637 AGCAGAGCTGTATTCCTTTTTGG + Intergenic
1196900709 X:120380175-120380197 AGCTGCACTGCATTCCAGCCTGG + Exonic
1196936767 X:120738114-120738136 AGCTGGCCTGCTTTCCTTTTTGG + Intergenic
1198053729 X:132973853-132973875 AGCTGAAAGGCATACATTTCTGG - Intergenic
1198476779 X:137002029-137002051 AGCTGAACTGAATGCCTTCCAGG + Intergenic
1199480513 X:148293471-148293493 AGCCTCACTGCCTTCCTTTCAGG + Intergenic