ID: 1126525877

View in Genome Browser
Species Human (GRCh38)
Location 15:49653694-49653716
Sequence AATAGCTTGTAGATGTCTTA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 131}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126525877 Original CRISPR AATAGCTTGTAGATGTCTTA AGG Exonic
908302965 1:62780300-62780322 AATACCTTGTAGACTTCTAAAGG - Intergenic
909932679 1:81516168-81516190 AATAGCTAGTCGATGTTTTAAGG + Intronic
910029067 1:82694201-82694223 AATATTTTCTAGTTGTCTTATGG - Intergenic
910567818 1:88665062-88665084 AATAGCTTGGAGTAGTATTATGG + Intergenic
912564073 1:110572614-110572636 CACAGCTTGTAGATGTAATAGGG + Intergenic
915500170 1:156310527-156310549 AACAGCGTGTACATATCTTAGGG + Intronic
916777735 1:167985660-167985682 AATAGGATGTAGATATCTTTGGG + Intronic
923399808 1:233605734-233605756 AATAGTTTGTATATATTTTAAGG + Intergenic
1063882492 10:10545330-10545352 AATAGAATGTTGATGTCTCAGGG - Intergenic
1066599367 10:37087871-37087893 ATTAGCTTATAGATATCTTGTGG + Intergenic
1067180595 10:43983030-43983052 AAGAGCTGGTAGATGGTTTAGGG + Intergenic
1068042748 10:51846745-51846767 AATTGCTTGAAGATGTTTTGAGG + Intronic
1071002849 10:80850596-80850618 TATTGCTGGTAGATGTATTAAGG + Intergenic
1072774007 10:98170960-98170982 AATAGCTTTCAGATGACCTATGG + Intronic
1086042268 11:82493945-82493967 AATATCTTGCAGATGTCCTCTGG + Intergenic
1087229971 11:95650063-95650085 CATATCTTGTAGATGTAGTAAGG - Intergenic
1088845891 11:113666750-113666772 AACAGCATGTAGATGGATTATGG + Intergenic
1088946588 11:114519454-114519476 AATAGCTTGTAAACATCTTGAGG - Intergenic
1095821336 12:46481964-46481986 AATAGGTTGAAAGTGTCTTAGGG - Intergenic
1098660064 12:73082180-73082202 AGTAGCTTGTACATAGCTTATGG + Intergenic
1098746990 12:74251098-74251120 ATTTCCTTGTAGATGTCTTTAGG - Intergenic
1099472274 12:83066077-83066099 ATTAGATTGTACATTTCTTAAGG - Intronic
1107852295 13:44582124-44582146 TATAGCTTTTAGATGTCATCTGG + Intergenic
1109753571 13:66728141-66728163 AATAGCATTGAGATGTCTTTAGG - Intronic
1110572067 13:77015683-77015705 AATATTTTGTAAATGTTTTAGGG + Intronic
1111528331 13:89503072-89503094 TATAGCTTAGAAATGTCTTAAGG + Intergenic
1111598250 13:90438368-90438390 AAAATCTTGTAGATGTCACAGGG - Intergenic
1114928065 14:27430393-27430415 AATAACTTCCAGATGTGTTAAGG + Intergenic
1117106749 14:52405300-52405322 AATAGCTTTGAGAGGACTTAAGG + Intergenic
1121380922 14:93465417-93465439 ACCAGCTTGTAAATTTCTTAAGG - Intronic
1125863664 15:43022098-43022120 AATAGGTTTTTGATGTCTTCAGG + Intronic
1126525877 15:49653694-49653716 AATAGCTTGTAGATGTCTTAAGG + Exonic
1128407594 15:67358884-67358906 AATAGCTTGGAAATCTCTTAAGG - Intronic
1128852959 15:70980320-70980342 AATAACTTGTAAAAGTTTTAGGG - Intronic
1128945234 15:71815193-71815215 AATAGCCAGTAGATGCCTGAAGG - Intronic
1130768334 15:86896972-86896994 AATAGCTTTTATATTTCTTGAGG + Intronic
1130780193 15:87028928-87028950 AAGATGTTGTACATGTCTTATGG + Exonic
1130870086 15:87963838-87963860 AATAGCTTATAGGGGTCATACGG + Intronic
1137084821 16:36106289-36106311 AATATGTTGTAGAAATCTTAGGG + Intergenic
1137815444 16:51393713-51393735 AGTAGCTTGATGATTTCTTAAGG - Intergenic
1139047959 16:63085948-63085970 AATATATTTTATATGTCTTATGG - Intergenic
1145693614 17:26769659-26769681 AATATATTGTAGAAATCTTAGGG - Intergenic
1146340757 17:32018008-32018030 AAGAGATTGTAGATGTCAGATGG + Intronic
1146850106 17:36214650-36214672 AATAGGATGTGGATGTCTTGGGG - Intronic
1148174750 17:45553739-45553761 AAGAGATTGTAGATGTCAGATGG - Intergenic
1148296621 17:46509288-46509310 AAGAGATTGTAGATGTCAGATGG + Intergenic
1150405968 17:64900650-64900672 AAGAGATTGTAGATGTCAGATGG - Intronic
1150784940 17:68154584-68154606 AAGAGATTGTAGATGTCAGATGG - Intergenic
1153897760 18:9582716-9582738 AATAGTCTGTAGTTTTCTTATGG - Intronic
1156409365 18:36812862-36812884 GATAGCTTGTTGATGTGTTTGGG + Intronic
1156588927 18:38464065-38464087 AGTGGTTTGTAGATGTCTTCTGG - Intergenic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
1166426327 19:42681671-42681693 AATGTCTACTAGATGTCTTAAGG - Intronic
926653162 2:15368727-15368749 AATTGCCTGTAGATGTCACAGGG - Intronic
929283424 2:40108411-40108433 AATAACTTGCAAATATCTTAGGG + Intronic
931946813 2:67318321-67318343 AATAGCATGTAAATTTCTTTAGG - Intergenic
933408489 2:81894039-81894061 AAAAGCCTGTAGAGGTCATAGGG + Intergenic
939455378 2:142428057-142428079 AATAGCTGGAATATGTCTGAGGG + Intergenic
941406555 2:165096421-165096443 TATAGGTTCTAGATTTCTTATGG - Intronic
942098734 2:172557260-172557282 AACAGCTTGTAAAAGTTTTATGG - Intronic
942762551 2:179416676-179416698 AATAGTTTGGAGATTTCTCAAGG + Intergenic
944341356 2:198604818-198604840 AAAAAGTTGTAGATGTCTTCAGG + Intergenic
944569817 2:201033123-201033145 AATAGCTTTTTGATTTCTAAAGG - Intronic
944972224 2:205006371-205006393 AATAGCATGGAGATTTCTTAAGG - Intronic
1169313159 20:4565267-4565289 AATCTCTTGTGGATGTCTTAAGG - Intergenic
1169990052 20:11492482-11492504 AATTTCTTGTTTATGTCTTAAGG + Intergenic
1174253927 20:49240030-49240052 AATAGATTATAGATTACTTAGGG + Intronic
1177452716 21:21292252-21292274 AATAATTTGTACATGTTTTATGG + Intronic
1179266118 21:39805266-39805288 AAGTGCTTGTTGATGTCTTTGGG + Intergenic
1181577041 22:23801822-23801844 ATTAAGTTGTAGATGTCTTCGGG + Intronic
1182373539 22:29829310-29829332 ACTAGCTTGTAGGTGTCTGGAGG + Intronic
950151067 3:10687892-10687914 AATAACTGGCAGATGTCTTGCGG - Intronic
951518716 3:23590475-23590497 AAGTGCTTGTAAATTTCTTAGGG + Exonic
955003405 3:54947769-54947791 AAAAGCTTCTAGTTGCCTTAGGG - Intronic
955611364 3:60760782-60760804 AATAGAATGAAGATCTCTTATGG - Intronic
957244345 3:77698882-77698904 AATACCTTGGACATGTCTTTGGG + Intergenic
959138519 3:102455438-102455460 AATAGCTTATAGATGGGTTTTGG - Intronic
959475087 3:106801415-106801437 ACTAGCTTGTAGGTTTCTCATGG - Intergenic
959854941 3:111141576-111141598 GATAGCATGCACATGTCTTATGG - Intronic
961117090 3:124339688-124339710 AATGTCTTGTAGATGCCTGATGG + Intronic
963670854 3:148250067-148250089 AATTGCCTGTAAATGACTTAAGG - Intergenic
965034107 3:163413664-163413686 AATGACTTTTAGATGTTTTAAGG - Intergenic
970833806 4:20375771-20375793 TATACTTTGTAGATGTCTGAAGG + Intronic
973104868 4:46322830-46322852 AAAAGCTCTCAGATGTCTTATGG + Intronic
974554167 4:63422282-63422304 AATAGTTTGAAAATGTGTTAAGG + Intergenic
976940464 4:90695666-90695688 AATAGCTTATAAATGTCAAAAGG + Intronic
979282406 4:118882298-118882320 AATAGCTTCTATATTTTTTAAGG - Intronic
980962932 4:139494077-139494099 AATGGCTTGTGAATGTCTTTTGG + Intergenic
981833524 4:149028838-149028860 AACAGCTGGTGGATGTCTTCAGG - Intergenic
981854110 4:149266905-149266927 AATAGATTGGAGGTGTCTTAAGG + Intergenic
982433922 4:155359004-155359026 AATAGTTTGGGGATTTCTTAAGG + Intronic
982440462 4:155429501-155429523 AAGAGATTTTAGGTGTCTTAGGG - Intergenic
983730621 4:170989350-170989372 AATATTTTGTAGATGTCTGTTGG + Intergenic
987600176 5:20058057-20058079 AATAGCTTTTTGATGAATTAAGG - Intronic
993072838 5:83187467-83187489 ATTAGCTTGTAGACATCTTTGGG + Intronic
993897328 5:93552142-93552164 ACTAGACTGTAGATTTCTTAAGG - Intergenic
994382869 5:99092368-99092390 AATAGTTTGTATTTGACTTAAGG - Intergenic
994562888 5:101398810-101398832 AATATCTTTTAGATGTTTTCAGG - Intergenic
996743439 5:126823882-126823904 AATTGCTATTATATGTCTTATGG + Intronic
997176572 5:131784217-131784239 AATTGCTTTTAGAGGTTTTATGG + Intronic
998952575 5:147406821-147406843 AATAGCTTGCAGATGCCCAATGG + Intronic
1000396532 5:160780878-160780900 AATAGCATGTTTATATCTTAAGG + Intronic
1001542073 5:172546586-172546608 GATTGGCTGTAGATGTCTTAGGG - Intergenic
1004212691 6:13666976-13666998 AATAGCTGGTAGATATATAAAGG + Intronic
1005338292 6:24819238-24819260 CTTACCTTGTAGATTTCTTATGG - Intronic
1009283490 6:61781521-61781543 AAAAGCTTGCAGATTTCTAATGG - Intronic
1010612314 6:77968501-77968523 GCTAGCATATAGATGTCTTAAGG - Intergenic
1011138038 6:84120541-84120563 AATAGCTTTTAGAGTACTTATGG + Intergenic
1012182164 6:96167807-96167829 AATAGCTTGTACGTGACCTAGGG + Intronic
1012360157 6:98367582-98367604 AGTAAATTGTAGATTTCTTATGG - Intergenic
1012375003 6:98551337-98551359 AATAGCTTGTTAGTGTCTAATGG + Intergenic
1012770128 6:103422738-103422760 AATAGTTTCTAGCTGTATTACGG + Intergenic
1013259443 6:108426642-108426664 AAAAGCTGATAGCTGTCTTATGG - Intronic
1014203007 6:118625252-118625274 CATAGCTTATTGATGTCTAAAGG + Intronic
1016596456 6:145807621-145807643 AATGGATTATAGATGTCTAATGG + Intronic
1017059877 6:150472368-150472390 AACAGCTTGTAAAGGTATTAGGG - Intergenic
1017557577 6:155588520-155588542 AAGAGTTTATAGATGTCTGATGG - Intergenic
1019780729 7:2938325-2938347 AATAGCTTGTACATGCCCAAGGG + Intronic
1021250977 7:18324526-18324548 AATAGCTTTTAAATGGCTTACGG + Intronic
1023497412 7:40813199-40813221 CATATTTTGTAGATGTCTTTTGG + Intronic
1024420578 7:49160951-49160973 ACTAGCTAGTAGTTGTCTTTAGG + Intergenic
1028002692 7:85519901-85519923 TATAGCCTGTAGATGTCAAATGG - Intergenic
1028444966 7:90911542-90911564 AATATCTTGTAGATTTTTCAGGG - Intronic
1035836685 8:2761920-2761942 AATATCTTGTAGATGACCTGTGG - Intergenic
1037039073 8:14208346-14208368 ACTACCTTGTGAATGTCTTACGG - Intronic
1037431752 8:18820516-18820538 AGTAGCTTAGAGATGACTTAAGG - Intronic
1037460047 8:19099725-19099747 AATTGCTTGTATCTGTGTTATGG - Intergenic
1038144793 8:24885402-24885424 ATGAGCATGTAGATGTGTTAGGG - Intergenic
1038701695 8:29855148-29855170 AATAGCTTGGTGATGTCCTATGG + Intergenic
1040720552 8:50317100-50317122 AATATCTGGTAGATTCCTTAGGG + Intronic
1040815476 8:51503895-51503917 AATATCATCTAGATGTCTCAAGG + Intronic
1041928030 8:63257063-63257085 GATAACTTTTTGATGTCTTAAGG + Intergenic
1042957155 8:74263132-74263154 AGGAGCTTGGAGATGTCTCAGGG - Intronic
1044043377 8:87398773-87398795 AATGGCATGTAGAAGCCTTAAGG - Intronic
1044091487 8:88007896-88007918 ATTAGAGTGTAGATGTCTTTGGG - Intergenic
1047886557 8:129256929-129256951 ATTAGATTGTAAATATCTTAAGG + Intergenic
1052032836 9:23647759-23647781 AATAGCTTAAAGATGTATTCAGG + Intergenic
1186234286 X:7490768-7490790 AATAGCTAGTCTATGTCTCAAGG - Intergenic
1188718886 X:33499439-33499461 AACAGTTTTCAGATGTCTTATGG - Intergenic