ID: 1126527483

View in Genome Browser
Species Human (GRCh38)
Location 15:49672851-49672873
Sequence TTTATTCTAATATACTGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126527483_1126527487 21 Left 1126527483 15:49672851-49672873 CCAACTCAGTATATTAGAATAAA No data
Right 1126527487 15:49672895-49672917 ATATTGATTGGTTCTGGACATGG No data
1126527483_1126527486 15 Left 1126527483 15:49672851-49672873 CCAACTCAGTATATTAGAATAAA No data
Right 1126527486 15:49672889-49672911 TAACAAATATTGATTGGTTCTGG No data
1126527483_1126527485 9 Left 1126527483 15:49672851-49672873 CCAACTCAGTATATTAGAATAAA No data
Right 1126527485 15:49672883-49672905 AGGATTTAACAAATATTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126527483 Original CRISPR TTTATTCTAATATACTGAGT TGG (reversed) Intergenic
No off target data available for this crispr