ID: 1126527485

View in Genome Browser
Species Human (GRCh38)
Location 15:49672883-49672905
Sequence AGGATTTAACAAATATTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126527483_1126527485 9 Left 1126527483 15:49672851-49672873 CCAACTCAGTATATTAGAATAAA No data
Right 1126527485 15:49672883-49672905 AGGATTTAACAAATATTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126527485 Original CRISPR AGGATTTAACAAATATTGAT TGG Intergenic
No off target data available for this crispr