ID: 1126533767

View in Genome Browser
Species Human (GRCh38)
Location 15:49738287-49738309
Sequence CCTCCCTAACACACTCCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126533761_1126533767 16 Left 1126533761 15:49738248-49738270 CCTACTGAAACTAGTCCAACAAA No data
Right 1126533767 15:49738287-49738309 CCTCCCTAACACACTCCATGAGG No data
1126533760_1126533767 21 Left 1126533760 15:49738243-49738265 CCATTCCTACTGAAACTAGTCCA No data
Right 1126533767 15:49738287-49738309 CCTCCCTAACACACTCCATGAGG No data
1126533765_1126533767 1 Left 1126533765 15:49738263-49738285 CCAACAAATGAAGAAGGAGGGAC No data
Right 1126533767 15:49738287-49738309 CCTCCCTAACACACTCCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126533767 Original CRISPR CCTCCCTAACACACTCCATG AGG Intergenic
No off target data available for this crispr