ID: 1126535103

View in Genome Browser
Species Human (GRCh38)
Location 15:49752703-49752725
Sequence TATGAGTCACAAGCAGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126535103_1126535106 5 Left 1126535103 15:49752703-49752725 CCTGTCCCTGCTTGTGACTCATA No data
Right 1126535106 15:49752731-49752753 ATTTAATGCTGACTCTGCAATGG No data
1126535103_1126535107 20 Left 1126535103 15:49752703-49752725 CCTGTCCCTGCTTGTGACTCATA No data
Right 1126535107 15:49752746-49752768 TGCAATGGAGAAAGTGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126535103 Original CRISPR TATGAGTCACAAGCAGGGAC AGG (reversed) Intergenic
No off target data available for this crispr