ID: 1126544657

View in Genome Browser
Species Human (GRCh38)
Location 15:49860214-49860236
Sequence CACCGTGAGCAGCTTTAGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 69}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126544657 Original CRISPR CACCGTGAGCAGCTTTAGCC AGG (reversed) Exonic
910309026 1:85802059-85802081 AACCGTGAACACCTATAGCCTGG + Intronic
916561902 1:165940772-165940794 CCACCTGAGCAGCTTTAGCAGGG + Intergenic
919728414 1:200898335-200898357 CACCGTGACCAGCCTGGGCCAGG - Exonic
921085913 1:211792401-211792423 CACAAAAAGCAGCTTTAGCCTGG - Intronic
1071321998 10:84470805-84470827 CTCTGTGAGCAGAATTAGCCTGG + Intronic
1075557666 10:123445052-123445074 GACAGTGAGCAGCTATGGCCTGG - Intergenic
1075792983 10:125098821-125098843 CACCCTGTGCTACTTTAGCCTGG + Intronic
1078021345 11:7658034-7658056 CACTGTAAGCACCTTTAGGCAGG - Intergenic
1079986618 11:27206800-27206822 CAACATGACCAGCCTTAGCCGGG - Intergenic
1084491576 11:69481470-69481492 CACAGTGAGCTGCATCAGCCTGG - Intergenic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1092015027 12:5151474-5151496 AACCATGAGCATCTCTAGCCTGG + Intergenic
1095986674 12:48004120-48004142 CCCCGGGAGCCGTTTTAGCCCGG + Intronic
1102601199 12:114032149-114032171 CACTGTAAGCAGCTCTAGCAAGG + Intergenic
1108742011 13:53347978-53348000 CACAGAGAGGAGCTATAGCCTGG + Intergenic
1113037120 13:106062413-106062435 CACCCTCAGCAGCTCTAGCCAGG + Intergenic
1122235448 14:100328635-100328657 CACCGTGAGCAACATGAGGCTGG + Intronic
1125477241 15:40055532-40055554 CACCTTCAGGAGCATTAGCCTGG + Intergenic
1125599617 15:40908028-40908050 CTCCCTGAGCAGCTTTACCGTGG + Intergenic
1126104849 15:45140935-45140957 CCCAGGGAGCAGCTCTAGCCAGG - Exonic
1126544657 15:49860214-49860236 CACCGTGAGCAGCTTTAGCCAGG - Exonic
1126702142 15:51378008-51378030 AACCCTGAGAAGCTCTAGCCCGG - Intronic
1127587466 15:60392213-60392235 CACTGTGAGCTTTTTTAGCCAGG - Intronic
1130409734 15:83635278-83635300 CACAGGCAGCATCTTTAGCCTGG + Intergenic
1130651872 15:85766628-85766650 CACTGGGAGCAGTTTGAGCCAGG - Intronic
1140168418 16:72578343-72578365 CACAGTGAGTATCTTTAACCGGG - Intergenic
1141165105 16:81655139-81655161 CCCCGTAAGCACCTTCAGCCAGG + Intronic
1151655994 17:75496270-75496292 CACCCTGAGCAGCATTGCCCTGG + Exonic
1159951383 18:74486725-74486747 CACCGTGAGAAGCTCTTCCCTGG + Intergenic
1163726592 19:18926481-18926503 TCCCGTGAGCAGATTTAGGCTGG + Intronic
929894082 2:45943419-45943441 CACTGTGAGCCCCTCTAGCCGGG + Intronic
938236934 2:129712783-129712805 CACCGTGAGGAGCTATAGCCTGG + Intergenic
942068392 2:172293509-172293531 CACACTGACCATCTTTAGCCTGG - Intergenic
1169151665 20:3294219-3294241 CGCCATCAGCAGCATTAGCCAGG - Exonic
1172749296 20:37238669-37238691 TGCAGTGAGCAGCTTTGGCCTGG + Intronic
1173360524 20:42340380-42340402 AACCCTAAGCAGCTGTAGCCAGG + Intronic
1182050018 22:27305515-27305537 CACCTTGAGAAGCTGTTGCCTGG + Intergenic
1183028723 22:35085894-35085916 CCAGGAGAGCAGCTTTAGCCAGG - Exonic
1184452525 22:44591505-44591527 GAGGGTGAGCAGCTTCAGCCCGG - Intergenic
1185251505 22:49804116-49804138 CACCGTGACCAGCCTGAACCAGG + Intronic
953928835 3:46996103-46996125 CACAGTGGGCAGGTGTAGCCTGG + Intronic
956646863 3:71465017-71465039 CACTGTGCCCAGCCTTAGCCTGG - Intronic
962045580 3:131756573-131756595 CACAGTGGCCAGCTTTGGCCAGG + Intronic
968577920 4:1376537-1376559 CACCGTGAGCAGCTGCAACACGG - Intronic
969666491 4:8560377-8560399 CACTGTCAGCAGCTTAAGGCAGG + Intronic
977766066 4:100799120-100799142 CAAACTGAGCAACTTTAGCCTGG + Intronic
981103828 4:140858260-140858282 CACAGTGAGCAGTATTAGCCTGG - Intergenic
986633674 5:9799366-9799388 CAAGGTGAGGAGATTTAGCCAGG + Intergenic
992965339 5:81993712-81993734 CACCGTGCCCAGCCTTAGCCTGG + Intronic
998535972 5:142930932-142930954 CACCCTGAGCAGCACAAGCCTGG - Intronic
998550945 5:143077608-143077630 CACGGTGACCTGCTTAAGCCAGG - Intronic
1000317528 5:160107113-160107135 CACCGTGACCGGCCTTAACCGGG + Intronic
1005564323 6:27074718-27074740 CAGCCTAAGCAGCTTTAACCAGG - Intergenic
1014639708 6:123894244-123894266 CACAGTGAACAGCTTCTGCCTGG - Intronic
1018095790 6:160386103-160386125 CACCTTGAGCACCTTGAGCACGG + Intronic
1019357050 7:585928-585950 CACAGTGAGCAGCATTTACCAGG + Intronic
1019530431 7:1500353-1500375 CACCGTGGGCAGCACTGGCCGGG + Exonic
1021021714 7:15608111-15608133 TACCCTGACCAGCTTTAGGCAGG + Intergenic
1022183050 7:27940321-27940343 CCCCGTGATCAGCCTTACCCTGG + Intronic
1022538698 7:31115117-31115139 CACCAGGAGCAGCTTTGGCTTGG + Intergenic
1025994291 7:66518481-66518503 CTCAGTGAGCAGCTTGGGCCTGG - Intergenic
1036453805 8:8891814-8891836 CATCAGGAGCAGCTTGAGCCGGG + Exonic
1038525870 8:28272861-28272883 CACCCTGAGGAGCTCTAGGCTGG + Intergenic
1042246071 8:66710175-66710197 CAAAGTGATCAGCCTTAGCCAGG + Intronic
1044743385 8:95350071-95350093 CAAAGTGAGCAGATCTAGCCTGG + Intergenic
1045005322 8:97912396-97912418 CAGCGAGAGCAGCTGGAGCCGGG + Intronic
1049757201 8:144315976-144315998 CACCGTGCTCAGCTTCAGCTTGG - Exonic
1057046927 9:91893206-91893228 CACCATGCCCAGCTTCAGCCTGG - Intronic
1057267835 9:93630665-93630687 CACCCTGTGCAGGTTCAGCCAGG + Intronic
1057434900 9:95031099-95031121 CACAGTGTGCAGTTTTACCCTGG + Intronic
1061306219 9:129734751-129734773 AACCATGAGGTGCTTTAGCCAGG + Intergenic
1061812010 9:133167675-133167697 CACCCTGAGCAGCTCTGTCCTGG + Intergenic
1062042534 9:134410719-134410741 CCTCGTGTGCAGCCTTAGCCTGG + Intronic
1195458871 X:105101051-105101073 AACTGTGAGCACCTTTAGGCTGG - Intronic