ID: 1126544780

View in Genome Browser
Species Human (GRCh38)
Location 15:49861508-49861530
Sequence CTCTCTCAGCATCACTGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 257}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126544773_1126544780 4 Left 1126544773 15:49861481-49861503 CCTACCTACCTACCTACCTACCT 0: 354
1: 351
2: 574
3: 979
4: 2581
Right 1126544780 15:49861508-49861530 CTCTCTCAGCATCACTGGCCTGG 0: 1
1: 0
2: 1
3: 16
4: 257
1126544774_1126544780 0 Left 1126544774 15:49861485-49861507 CCTACCTACCTACCTACCTCAGT 0: 1
1: 4
2: 25
3: 590
4: 906
Right 1126544780 15:49861508-49861530 CTCTCTCAGCATCACTGGCCTGG 0: 1
1: 0
2: 1
3: 16
4: 257
1126544776_1126544780 -8 Left 1126544776 15:49861493-49861515 CCTACCTACCTCAGTCTCTCTCA 0: 1
1: 0
2: 2
3: 64
4: 846
Right 1126544780 15:49861508-49861530 CTCTCTCAGCATCACTGGCCTGG 0: 1
1: 0
2: 1
3: 16
4: 257
1126544772_1126544780 8 Left 1126544772 15:49861477-49861499 CCTACCTACCTACCTACCTACCT 0: 354
1: 351
2: 574
3: 979
4: 2581
Right 1126544780 15:49861508-49861530 CTCTCTCAGCATCACTGGCCTGG 0: 1
1: 0
2: 1
3: 16
4: 257
1126544775_1126544780 -4 Left 1126544775 15:49861489-49861511 CCTACCTACCTACCTCAGTCTCT 0: 1
1: 0
2: 3
3: 75
4: 660
Right 1126544780 15:49861508-49861530 CTCTCTCAGCATCACTGGCCTGG 0: 1
1: 0
2: 1
3: 16
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126544780 Original CRISPR CTCTCTCAGCATCACTGGCC TGG Intronic
904484001 1:30812921-30812943 CACTCGCAGCCTCACTGCCCAGG + Intergenic
905257854 1:36696601-36696623 CTCTCTCAGCACCCCTCTCCTGG + Intergenic
905289282 1:36910550-36910572 CTCTCTCAGCAGCAGTGGTGGGG + Intronic
905292330 1:36930682-36930704 CACTCACACCATCCCTGGCCTGG - Intronic
905350267 1:37341007-37341029 CTCTCTCAGCTGCCCTTGCCTGG - Intergenic
906569021 1:46820568-46820590 TTCTCACAGCTTCACTGGACTGG - Intergenic
907319251 1:53592529-53592551 GTCTCCCAGCAGCCCTGGCCTGG + Intronic
907734607 1:57099959-57099981 CTCTATCAGCACCATTTGCCTGG - Intronic
910281495 1:85506486-85506508 CTCTCACAGCAACACTCACCTGG + Intronic
910986839 1:93013499-93013521 CCCTCTCAGCCTCTCTGGCATGG + Intergenic
913567813 1:120090732-120090754 CTTTCTCAGCATGAATTGCCAGG + Intergenic
914288562 1:146251441-146251463 CTTTCTCAGCATGAATTGCCAGG + Intergenic
914549597 1:148702185-148702207 CTTTCTCAGCATGAATTGCCAGG + Intergenic
914617085 1:149369531-149369553 CTTTCTCAGCATGAATTGCCAGG - Intergenic
916655177 1:166868818-166868840 CTCTCCCAGCATAACACGCCCGG + Intronic
918466716 1:184828188-184828210 CTATCTCAGAATAACTTGCCTGG - Intronic
921335035 1:214077117-214077139 CTCTCTCAGGAACACAGGGCTGG - Intergenic
921478544 1:215637273-215637295 CTGTGTCAGAATCACTGGACAGG + Intronic
922753026 1:228079859-228079881 CTCTCTGAACATCTGTGGCCTGG + Intergenic
922763335 1:228145523-228145545 CCCGCTCAGCACCACAGGCCTGG - Exonic
922784817 1:228277600-228277622 CCCTCCCAGAACCACTGGCCAGG - Exonic
922793153 1:228321703-228321725 CTCTCTGCTGATCACTGGCCTGG + Exonic
923234015 1:232015044-232015066 CTCTCTCAAATTCAGTGGCCAGG - Intronic
1063062291 10:2568454-2568476 AGGTCTCAGCATCCCTGGCCAGG + Intergenic
1063271034 10:4509968-4509990 CTCTCCCAGCCTCACAGGCTTGG - Intergenic
1063956054 10:11268406-11268428 CTCTCTGAGCATTACTGGGGGGG - Intronic
1063957254 10:11278854-11278876 CTCTCTAAGCCTCAGTTGCCCGG - Intronic
1064532522 10:16324717-16324739 TTCCTTCAGCATCACTGACCTGG + Intergenic
1065724266 10:28654874-28654896 ATCTCTCAGCATCACTGATGAGG + Intergenic
1066615320 10:37287876-37287898 CTCTCTCCTCATCACTGTCAGGG + Intronic
1067853154 10:49768405-49768427 CTCTCTGAGCAGGCCTGGCCGGG + Intergenic
1068789795 10:61015409-61015431 TTCTCTCAGCATAGCTGGCAAGG + Intergenic
1069915628 10:71785007-71785029 CACTGTCAGCGTCACTGGCCAGG - Intronic
1070535908 10:77377098-77377120 CTGTCCCAGCATCTCTGACCAGG - Intronic
1071166241 10:82810778-82810800 CACCCTCAGCATCACTGGCTTGG - Intronic
1072168363 10:92836418-92836440 CTCTCTCAGCATCACCCTCAAGG + Intronic
1073510256 10:104038439-104038461 CTCTATCAGCAGCTCTGGCCAGG - Exonic
1073666894 10:105543821-105543843 CTTTCTCAGCATTGCTGGCTGGG + Intergenic
1076199622 10:128547585-128547607 CTCTGTCAGCCTTGCTGGCCTGG + Intergenic
1076317647 10:129553863-129553885 CTCTCTCTGCCTCACTGAGCGGG + Intronic
1077145078 11:1041041-1041063 CCCTCTGAACATCACTGGACAGG - Intergenic
1077306092 11:1869252-1869274 CCCTCCCAGCATCCCTGGCCAGG - Intronic
1078465768 11:11549238-11549260 CTCTTCCAGGATCACAGGCCTGG - Intronic
1078615091 11:12857410-12857432 CTCTCTCTGACTCACTGGACAGG + Intronic
1079241202 11:18723382-18723404 CTTGCTCTGCCTCACTGGCCAGG + Intronic
1079925685 11:26489085-26489107 ACCTCTCACCATCACAGGCCCGG + Intronic
1081613010 11:44574495-44574517 CTATGTCAGAATCGCTGGCCTGG - Intronic
1082271133 11:50170372-50170394 CGCTCTCATCCTCACTGGACGGG - Intergenic
1083617771 11:64035128-64035150 CTCTCCCAGCCTCAGTGTCCTGG - Intronic
1083827469 11:65211625-65211647 CCCACTCAGCACCACCGGCCTGG + Exonic
1083890539 11:65593548-65593570 CTCGCTCAGCACCATTGGCCTGG - Exonic
1084237616 11:67798075-67798097 CTCCCACGGCATCACAGGCCTGG - Intergenic
1084430348 11:69107343-69107365 CTCTCCCAGCAGCACGGGCTGGG - Intergenic
1084889926 11:72231770-72231792 CTCTCCCAGCACCACTGGGAAGG + Intronic
1085245462 11:75097428-75097450 CTCTCACAGGATAACTGGGCAGG + Intergenic
1086131673 11:83408141-83408163 CTATCTCAGCATTTCTGGTCAGG + Intergenic
1088911423 11:114195395-114195417 CTCCCTCAGTCTCTCTGGCCAGG - Intronic
1090437343 11:126697699-126697721 CTCATTCAGCCTCACTTGCCGGG + Intronic
1090545953 11:127768624-127768646 CTCTCTCAGCTTCAGTGAACAGG - Intergenic
1091184611 11:133636614-133636636 GTCTCTGGGCATCACTGGCAGGG - Intergenic
1091324457 11:134676049-134676071 CCCTCACAGCATCAATGGTCAGG - Intergenic
1092253588 12:6914745-6914767 ACCTCTCCGCATCTCTGGCCCGG + Intronic
1097100792 12:56587643-56587665 CTCCCTCAGCAGCACAGGCACGG + Exonic
1101841695 12:108332162-108332184 CTCTCTCAACAACCCTGGGCAGG + Intronic
1101923856 12:108955223-108955245 CTCTCTGAGCATCCCTGGTAAGG + Intronic
1102761646 12:115391015-115391037 CTCACTCAGAATCTTTGGCCAGG + Intergenic
1103707894 12:122889049-122889071 CTCACTCAGCAGCACTACCCAGG + Intronic
1104393973 12:128415539-128415561 CTCTCCCTGCTTGACTGGCCTGG - Exonic
1104413397 12:128578151-128578173 CTCACTCAGCTCCACTGGCGTGG - Intronic
1104653053 12:130551245-130551267 CTCTACCATCATGACTGGCCAGG - Intronic
1104761861 12:131301508-131301530 CTCTCTCACCTTCAGTGGCTGGG + Intergenic
1104817915 12:131659276-131659298 CTCTCTCACCTTCAGTGGCTGGG - Intergenic
1106590408 13:31093671-31093693 CACTTTCTGAATCACTGGCCTGG + Intergenic
1106928985 13:34643391-34643413 GTCTGTCAGCACCACTGGTCTGG + Intergenic
1107595580 13:41960457-41960479 CTCTCTGAGCCTCAAGGGCCTGG - Intronic
1108471002 13:50766816-50766838 CTGTATCAGAATCACTGGCAGGG - Intronic
1108979537 13:56492659-56492681 CTCTCCCATCATCAAAGGCCTGG - Intergenic
1109886761 13:68554455-68554477 CTCTCTCAGCTTCCCTGGATGGG - Intergenic
1113263876 13:108594742-108594764 TTCGCTCAGCAACACTGGGCTGG - Intergenic
1113966975 13:114158278-114158300 ATCTCTGAGCATCTCTGGCTGGG + Intergenic
1115722828 14:36181843-36181865 ATCTCTCACCAACACTGCCCAGG - Intergenic
1118694923 14:68375254-68375276 CGCTCTCAGCTTCAGTGGCTGGG + Intronic
1121236949 14:92398596-92398618 CTGTCCCAGCAGCCCTGGCCAGG - Intronic
1121325463 14:93017120-93017142 ATTTCTCAGCATCACTTGCCTGG - Intronic
1121447791 14:93989068-93989090 CTCTCTCACCATCTCTCGCATGG - Intergenic
1122019842 14:98828537-98828559 CTCTCTCAGAGTCATTGCCCAGG - Intergenic
1122738277 14:103856128-103856150 CTGTCACAGGATCACTGTCCAGG + Intergenic
1122885006 14:104707038-104707060 CCCCCTCACCATCGCTGGCCAGG - Exonic
1123716911 15:23040155-23040177 CCCCCTCAGCACCTCTGGCCAGG - Intergenic
1123718625 15:23046017-23046039 CTCCCCCAGCACCTCTGGCCAGG - Intergenic
1123719220 15:23048088-23048110 CTCCCCCAGCACCTCTGGCCAGG - Intergenic
1123719679 15:23049650-23049672 CCCTCCCAGCACCTCTGGCCAGG - Intergenic
1123719903 15:23050439-23050461 CTCCCCCAGCACCTCTGGCCAGG - Intergenic
1126544780 15:49861508-49861530 CTCTCTCAGCATCACTGGCCTGG + Intronic
1128799107 15:70486385-70486407 CTCTCTCCACTTCACAGGCCAGG - Intergenic
1129654969 15:77518043-77518065 CACTCTCATCAACACTAGCCTGG + Intergenic
1130715352 15:86328731-86328753 CTCTCTCAGCCTCAGTTGCTTGG - Intronic
1130989116 15:88865222-88865244 CTCACTCATCATCACTGAGCAGG - Intronic
1133225244 16:4337706-4337728 CTCTCCCTGCATGACAGGCCAGG - Exonic
1133279869 16:4659242-4659264 CTCTCCCGGCATCACTGGCGTGG + Intronic
1136392404 16:29973916-29973938 CTCTCTCCGCACCACAGCCCCGG - Exonic
1136452256 16:30359948-30359970 CTCGCTCAGCAGGACTGGGCAGG - Intronic
1136536598 16:30903246-30903268 CTCTCTGTGCTTCCCTGGCCAGG + Exonic
1137626629 16:49912895-49912917 CTCTCTCTGCATCCCTGGCCAGG + Intergenic
1137797868 16:51237445-51237467 CTCATTCAGCACCACTGTCCAGG - Intergenic
1139364413 16:66425200-66425222 CTATTTGTGCATCACTGGCCTGG - Intergenic
1139972914 16:70787385-70787407 CCCTGTCAGCATCACTGTCCAGG - Intronic
1140908962 16:79434165-79434187 CTTTCTCAACATCACTAGCTAGG + Intergenic
1143620425 17:8077136-8077158 CCCACTCAGAATCACTGGGCAGG + Exonic
1143724436 17:8835746-8835768 CTCTCTCAGCATCCTGGCCCAGG + Intronic
1144736575 17:17558992-17559014 CTCTCTCTGCATCCCTGCCATGG + Intronic
1145056373 17:19706500-19706522 CCCTTCCAGCTTCACTGGCCAGG - Intronic
1146718696 17:35107550-35107572 GTCTTTGAACATCACTGGCCAGG + Intronic
1147728496 17:42581881-42581903 CCCCCTCAGCATCAGTGTCCAGG + Exonic
1148153336 17:45409314-45409336 CCCCATCAGCCTCACTGGCCTGG - Intronic
1148743126 17:49903972-49903994 CTCTATGAGCCTCACTGCCCTGG + Intergenic
1148758094 17:49985158-49985180 CTCTCTCAGCATCAGGGGAGGGG - Intergenic
1148934366 17:51153000-51153022 CTCTCGAAGAATCACTGGGCTGG + Intergenic
1150234134 17:63578955-63578977 CTTTATCAGAATCAATGGCCTGG - Intronic
1152313502 17:79565905-79565927 CTGTCTCACCATCACAGGCTTGG + Intergenic
1153815032 18:8784258-8784280 CACTCTCGGCATCGCTGTCCCGG - Exonic
1157160830 18:45312947-45312969 CTCCATCAGCATCACTGACGAGG - Intronic
1157271033 18:46276429-46276451 CTCTCTGAGCCTCCCTGGCATGG + Intergenic
1158541658 18:58361665-58361687 TTTTCACATCATCACTGGCCGGG - Intronic
1158571908 18:58603442-58603464 CTCTCTCATCAACTCTGCCCTGG - Intronic
1160496249 18:79377520-79377542 CTGTCTCAGCATCTGTGCCCTGG - Exonic
1160496277 18:79377651-79377673 CTGTCTCAGCATCTATGCCCTGG - Exonic
1160903857 19:1442923-1442945 GTCTCTGGGCAGCACTGGCCAGG + Intergenic
1161818472 19:6515141-6515163 CTTTCTCAGCACCAGTGGCCTGG - Intergenic
1161851491 19:6740045-6740067 CTCTCTCAGCCGCCCCGGCCTGG - Intronic
1162398189 19:10430176-10430198 CTCTCAGAGCACCACTGGCAGGG + Intronic
1162774882 19:12973454-12973476 CTCTCTCTACATCCCTGGCTCGG + Exonic
1163635210 19:18434205-18434227 CTCTCTCCGCAGTACTCGCCAGG + Exonic
1165509202 19:36256505-36256527 CTCTTTCAGCATGATTGGGCAGG + Intergenic
1165509716 19:36258920-36258942 CTCTTTCAGCATAATTGGGCAGG + Intergenic
1165511238 19:36267884-36267906 CTCTTTCAGCATGATTGGGCAGG + Intergenic
1166453741 19:42922904-42922926 CTCTCTCTGCCTCACCTGCCAGG - Intronic
1166698997 19:44871207-44871229 CTGTCTCTGCATCTCTGGCAGGG + Intronic
1167322496 19:48805697-48805719 CTCTCCCACCATCACTTCCCCGG + Intronic
1167534567 19:50041534-50041556 CTCCCTCTCCATCACTGGACTGG + Intronic
925685683 2:6470594-6470616 ACCTCTCAGCAGCACAGGCCAGG + Intergenic
926158278 2:10470074-10470096 CTCTCTCAGCGGCACTGGGAAGG + Intergenic
926409533 2:12588476-12588498 AGCTCTCAGAATCACTGTCCTGG + Intergenic
927514985 2:23666946-23666968 CTCTCTCAAGGCCACTGGCCAGG - Intronic
928645930 2:33352596-33352618 GTCTTTCAGCATCACTTACCTGG + Intronic
928943743 2:36753632-36753654 CTTTGTCAGCAGCACAGGCCTGG + Intronic
929040780 2:37742342-37742364 CTCTCTCCACCTCACAGGCCTGG + Intergenic
931800092 2:65749739-65749761 CTTTCTCAGCCTCACTGAGCAGG + Intergenic
931954006 2:67397606-67397628 CTCTCGCTGCCGCACTGGCCCGG - Exonic
932858151 2:75260497-75260519 ATCTCTCAGCTACCCTGGCCTGG + Intergenic
932974790 2:76585846-76585868 CTCTCTCATCTTAACTTGCCAGG - Intergenic
934128531 2:88922431-88922453 CTCTTAAAGCATCACAGGCCAGG - Intergenic
934664277 2:96158839-96158861 CTCTCTGGACCTCACTGGCCAGG - Intergenic
934759071 2:96843548-96843570 CTCTTTCACCATCACTATCCAGG + Intronic
934863581 2:97786100-97786122 CTGTATCAGCATCACTATCCTGG + Intronic
937031313 2:118743400-118743422 CTCTCTCAGAGTGACTGGGCTGG + Intergenic
938133320 2:128735314-128735336 CGCCCTCAGCCCCACTGGCCTGG - Intergenic
940649709 2:156429730-156429752 CTCTTTCAGAATCACTGACATGG + Intergenic
941462443 2:165787561-165787583 CTCTATCATCATCTCTTGCCTGG - Intronic
945431975 2:209775209-209775231 CTCTCTGAGTATCCCTGGCAAGG + Intronic
946252795 2:218423808-218423830 CTCTCTCAACATCACCACCCCGG + Exonic
946285906 2:218702400-218702422 CTCTGTCTTCATCACTGTCCTGG - Exonic
946792480 2:223315203-223315225 CTCTCTGATCATCACAGGCATGG - Intergenic
947488640 2:230575141-230575163 CCATCTCAGCATCAATGCCCAGG - Intergenic
948593865 2:239067398-239067420 CTCTCTAATCAGCACCGGCCTGG - Intronic
948615335 2:239194892-239194914 CTCTCTCACCAGCACTGCCAGGG - Intronic
948892416 2:240913975-240913997 CCCTCCCAGCATCCCTGGGCGGG - Intergenic
1169146124 20:3253670-3253692 CACTCCCAGCCTCACTGCCCGGG + Intronic
1172645529 20:36466808-36466830 GTCTCTGTACATCACTGGCCTGG + Intronic
1174711761 20:52714360-52714382 CTCTCTCTGCATCACAGCCTGGG + Intergenic
1175517153 20:59577147-59577169 CTCTCTGAGCCTCAGTGGTCTGG - Intergenic
1176342325 21:5710096-5710118 AACTCCCAGCATCCCTGGCCAGG + Intergenic
1176474579 21:7142248-7142270 AACTCCCAGCATCCCTGGCCAGG + Intergenic
1176502502 21:7614360-7614382 AACTCCCAGCATCCCTGGCCAGG - Intergenic
1176521689 21:7829517-7829539 CTCTCTCGGCATCTCAGACCCGG - Intronic
1176536646 21:8108165-8108187 AACTCCCAGCATCCCTGGCCAGG + Intergenic
1177732185 21:25041865-25041887 ATCTTTCAGCATCACAGGCTGGG - Intergenic
1178655709 21:34459529-34459551 CTCTCTCGGCATCTCAGACCCGG - Intergenic
1179321246 21:40293203-40293225 ATCTCTCTGGATCGCTGGCCGGG - Intronic
1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG + Intronic
1180004640 21:45014660-45014682 CTCTCTCGGCTCCCCTGGCCCGG - Intergenic
1180226087 21:46393356-46393378 CGCTCTCAGCATCTTTGCCCTGG + Intronic
1180702575 22:17789638-17789660 TTCTCTTCGTATCACTGGCCTGG - Exonic
1181039648 22:20185793-20185815 CTCTCTCAGCAGCACCAGCAAGG + Intergenic
1181488675 22:23247641-23247663 CTCTCTAGGCATATCTGGCCTGG + Intronic
1181864621 22:25845584-25845606 TTCTCTCAGCATCCCTGTCATGG - Intronic
1181920957 22:26320207-26320229 ATATCTCAGCATCACTGGATTGG - Intronic
1182270057 22:29147750-29147772 CTCTCTCCACAGCACTGGCTTGG - Intronic
1182797316 22:33000418-33000440 CTCTCTCCAGGTCACTGGCCAGG + Intronic
1184670740 22:46011308-46011330 CTCTGCCTGCCTCACTGGCCTGG + Intergenic
1184881365 22:47306501-47306523 GTTTCTCAACATCACTGGGCAGG - Intergenic
1185289871 22:50017886-50017908 CTCACTCACCTTCCCTGGCCTGG - Intronic
1203241593 22_KI270733v1_random:24576-24598 AACTCCCAGCATCCCTGGCCAGG + Intergenic
949310107 3:2687876-2687898 CTCTCTGAGTTTCACTGCCCTGG - Intronic
950438790 3:12995194-12995216 CTCGCTCAGCTTCTCTGGCTGGG - Intronic
952968732 3:38637357-38637379 CTCACCCAACATCACTGCCCTGG + Intronic
956793259 3:72696153-72696175 CTCTCACAGCAGCACTGGGAGGG - Intergenic
961040531 3:123675084-123675106 ATTTCTCAGCATCAGTGCCCAGG - Intronic
964051979 3:152405360-152405382 CTCTCTCAGTATTACTGGGAAGG - Intronic
965558200 3:170038297-170038319 CGCTCCCAGCCTCCCTGGCCGGG + Intronic
966314657 3:178632395-178632417 ATGTCTCAGCATGACTGGCGAGG + Intronic
968495356 4:912299-912321 CTGTCCCAGCATGACTGGGCGGG - Intronic
969057023 4:4408406-4408428 CTCTCTCTGCCTCTCTGGGCAGG + Intronic
971539378 4:27796468-27796490 TTCTCTGTGCATCACTGACCCGG - Intergenic
973980635 4:56305666-56305688 CTCTCCCAGCCTCACAGGACAGG - Intronic
977917715 4:102612651-102612673 CTCTGTTAACATCTCTGGCCAGG + Intronic
978257292 4:106708143-106708165 ATATCTCAGCAGCACTGGCATGG - Intergenic
978443776 4:108761912-108761934 CTCTCTCATGCCCACTGGCCCGG + Intronic
978605695 4:110476648-110476670 CGCTCTCATCCTCACTGGCCGGG - Exonic
978737836 4:112104236-112104258 CTCTCTCAGTATGAGTAGCCTGG + Intergenic
979509389 4:121535044-121535066 CTATCTCAGCTTCATTGGCCAGG + Intergenic
980974677 4:139599197-139599219 AGCTCTCAGCATCTCTTGCCTGG + Intronic
981288460 4:143046780-143046802 TGCTCTCAGCAGCGCTGGCCTGG - Intergenic
981534563 4:145785708-145785730 CTCTCCCAGAGTCACTAGCCAGG - Intronic
984133731 4:175910456-175910478 CTCTCTCAGCCTTACTGGGCTGG + Intronic
984764578 4:183389972-183389994 CTCTCTCAGAATGCCTGCCCCGG - Intergenic
986688486 5:10294689-10294711 CCCTCTCACCATCACCGTCCTGG - Intronic
989401384 5:41011321-41011343 CTCTCCAAGCATCATTGACCTGG - Intronic
990697272 5:58434195-58434217 ATCTCTCAACATCACTGTTCTGG - Intergenic
991527205 5:67573985-67574007 CTCACCCAGAATCTCTGGCCGGG - Intergenic
994955218 5:106521834-106521856 CTCTTTCAGAAGCACTGGCACGG + Intergenic
997361650 5:133299135-133299157 CTCTGTAAGCAGCCCTGGCCAGG - Intronic
999087933 5:148910196-148910218 CACTTTCAGCAACACTGCCCTGG + Intergenic
999931212 5:156434546-156434568 GTCTATCAGCATCGCTGGCCGGG - Intronic
999961547 5:156761275-156761297 CGCCAGCAGCATCACTGGCCAGG - Intronic
1002349770 5:178576001-178576023 CCCTCTCGACATCACTGTCCAGG - Intronic
1002583903 5:180229191-180229213 CAATTTTAGCATCACTGGCCTGG + Intergenic
1002616854 5:180461460-180461482 CCCTCTGAGAATCACTGTCCTGG - Intergenic
1007554964 6:42758108-42758130 CTCTCTCTGTCTCTCTGGCCTGG + Intronic
1011545674 6:88479338-88479360 GTCACTCAGCATCTCTGGCAAGG - Intergenic
1014363917 6:120516396-120516418 CTCTCTCTGCCTTACTGTCCTGG + Intergenic
1014865366 6:126522099-126522121 CCCTCTCAGCATCAGTGGCTTGG - Intergenic
1020320641 7:6936568-6936590 CTCCCACGGCATCACAGGCCTGG - Intergenic
1022703687 7:32784074-32784096 CTTTCCTAGCATCACTGGGCTGG - Intergenic
1022841586 7:34169318-34169340 CTTTCACAGCATCATTGTCCTGG - Intergenic
1022907928 7:34874203-34874225 CTTTCCTAGCATCACTGGGCTGG - Intronic
1029625204 7:101716415-101716437 CTTTCTCAGCATCCCTGGCAGGG + Intergenic
1030305374 7:108012946-108012968 CCCTTTCAGCCTCACTGCCCAGG + Intergenic
1032325198 7:130921608-130921630 CTCTCTTCGCATCAGTAGCCCGG - Intergenic
1034443639 7:151100932-151100954 CTCTCCCTGCAGCCCTGGCCTGG + Intronic
1034827000 7:154274920-154274942 CTCTGTCATAATCACAGGCCGGG + Intronic
1035528936 8:336252-336274 CTACCTGAGCATCCCTGGCCTGG - Intergenic
1037946932 8:22995629-22995651 GTCTCTCAGCCTCCCTGTCCAGG - Intronic
1040582996 8:48712603-48712625 CTTTATCGGCATCACTGCCCAGG - Intronic
1040671615 8:49698109-49698131 CCTGCTCAGCATCCCTGGCCTGG - Intergenic
1044866746 8:96578658-96578680 ATTTCACAGCTTCACTGGCCTGG - Intronic
1046990287 8:120445144-120445166 GTCACTCAGCCTTACTGGCCCGG + Exonic
1047031936 8:120891371-120891393 GTCTCACAGCATCCCTGGCCAGG - Intergenic
1047926605 8:129688721-129688743 CTCTCCCATCACCACTGACCTGG + Intergenic
1048277256 8:133076292-133076314 CTGTGTCAGCCTCACTGGACTGG - Intronic
1050308166 9:4327231-4327253 CTCTCTCAGTCTCACTGCTCTGG - Intronic
1051071664 9:13175824-13175846 CACACTCAGCATTACAGGCCAGG + Exonic
1052025802 9:23571860-23571882 CACTGTAAGCATCCCTGGCCAGG - Intergenic
1052714267 9:32096664-32096686 CTCTCTGAGCATCACTCACTTGG + Intergenic
1056757353 9:89390196-89390218 CTGTCAGAGCAGCACTGGCCAGG - Intronic
1060438183 9:123614335-123614357 AGCGCTCAGCATCACAGGCCTGG - Intronic
1060553322 9:124495825-124495847 CCCTATCAGCCTCACTGGGCAGG - Intronic
1060660474 9:125402392-125402414 CTCTCTGAGCCTCAGTTGCCAGG + Intergenic
1060883792 9:127136542-127136564 CTCTCTGAGCCTCCCTGTCCAGG + Intronic
1061993532 9:134172926-134172948 CTGTCTCTGCAGCACAGGCCGGG - Intergenic
1062100215 9:134724050-134724072 CCCTCTCAGGAGCACTGTCCTGG + Intronic
1062103464 9:134740142-134740164 CTTTCACAGCATCCCCGGCCTGG + Intronic
1062108187 9:134767050-134767072 CTCTCTCAGGCTCACTTACCTGG - Exonic
1203457916 Un_GL000220v1:7651-7673 AACTCCCAGCATCCCTGGCCAGG + Intergenic
1186203111 X:7174026-7174048 CTTTCTCAGAGTCCCTGGCCAGG - Intergenic
1187007185 X:15244044-15244066 CTTTTCCAGCATCACTGTCCTGG - Exonic
1188158873 X:26776222-26776244 TTCTCCCATCATCACAGGCCTGG + Intergenic
1190171935 X:48118255-48118277 CTCTCTCAGCTTTCCTGGACTGG + Intergenic
1193257668 X:79368361-79368383 CTCTATCAGTATCACTAACCTGG - Intergenic
1197276263 X:124483004-124483026 ATCTTTCAGTATCTCTGGCCTGG + Intronic
1198533054 X:137563910-137563932 CTCTCGCATCAGCGCTGGCCCGG + Intergenic
1199768700 X:150959623-150959645 CTCTCTCATCTTCCCTTGCCTGG - Intergenic
1202267165 Y:23031656-23031678 CTCTCTCAGCTACTCTGCCCCGG - Intergenic
1202420157 Y:24665400-24665422 CTCTCTCAGCTACTCTGCCCCGG - Intergenic
1202450629 Y:25004682-25004704 CTCTCTCAGCTACTCTGCCCCGG + Intergenic