ID: 1126548703

View in Genome Browser
Species Human (GRCh38)
Location 15:49903365-49903387
Sequence TTACGCAGCTTGGAAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 93}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126548703_1126548707 4 Left 1126548703 15:49903365-49903387 CCTGTTTTTTCCAAGCTGCGTAA 0: 1
1: 0
2: 1
3: 9
4: 93
Right 1126548707 15:49903392-49903414 GGGCAGTTTATTACAATTCTTGG 0: 1
1: 0
2: 0
3: 14
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126548703 Original CRISPR TTACGCAGCTTGGAAAAAAC AGG (reversed) Intronic
902405182 1:16178928-16178950 TTTTGCAGCTTTGAAGAAACAGG - Intergenic
910662868 1:89692458-89692480 CTACTCAGCTTGGAAAATACTGG + Intronic
911293961 1:96090819-96090841 TTATGCAGCTGTGAAAAAAGAGG - Intergenic
911440396 1:97919829-97919851 TTATGGAGCCTGGAGAAAACAGG + Intronic
912270290 1:108201239-108201261 TTACGCAGCTGTGAATGAACAGG - Intergenic
912275000 1:108246995-108247017 TTGAGCAGCTTGGAGAAAACTGG + Intergenic
912293222 1:108447356-108447378 TTGAGCAGCTTGGAGAAAACTGG - Intronic
914322711 1:146580723-146580745 AAAAGCAGCCTGGAAAAAACAGG + Intergenic
915520096 1:156436883-156436905 TTCGGCAGCTTGGAAAGAAAAGG - Intergenic
916070789 1:161168514-161168536 TTGCTCAGCTTGGAAGAGACTGG - Exonic
920374872 1:205502865-205502887 TTACCCCTCCTGGAAAAAACAGG + Intergenic
924646567 1:245883233-245883255 TTATACAGTTTGGAAAAAATAGG - Intronic
1064687797 10:17882248-17882270 TTATACAGCTTGGAAAAGAGAGG + Intronic
1068319919 10:55399030-55399052 TTACTCATCTTGTGAAAAACAGG + Intronic
1069296415 10:66850660-66850682 CTACCCAGCTTGAAAAAAAATGG - Intronic
1080679898 11:34464741-34464763 TGACGCAGATAGGAGAAAACAGG - Intronic
1080803811 11:35633617-35633639 GTACGTAGCTTGGAATAGACAGG - Intergenic
1080992640 11:37557916-37557938 TTTCACAGCTTGAAAAAAAGGGG - Intergenic
1084409160 11:68996608-68996630 TCACCCAGATTGCAAAAAACAGG + Intergenic
1092376880 12:7963136-7963158 TTAGGCAGCTTGTCATAAACAGG + Intergenic
1094369691 12:29724568-29724590 TTACACAGCTGGGAAATGACTGG + Intronic
1098123463 12:67266788-67266810 TGAAGCAGCTTGGAAACCACCGG + Intergenic
1101448296 12:104754109-104754131 TTTCCCAGCTTGGAAATAACTGG - Intronic
1105237341 13:18569607-18569629 TTACACACATTGAAAAAAACAGG - Intergenic
1111227278 13:85290176-85290198 TTTCGTTGCTTGGAAAACACTGG + Intergenic
1112064492 13:95778496-95778518 TTACTCAGCTTTTAAAAAGCAGG + Intronic
1115138804 14:30143683-30143705 TTGCACAGCTGGGAAAACACAGG + Intronic
1118729595 14:68656966-68656988 TTAAGCAGCCTGGTTAAAACAGG + Intronic
1126548703 15:49903365-49903387 TTACGCAGCTTGGAAAAAACAGG - Intronic
1128393686 15:67201512-67201534 TTACACAGCATGAAAGAAACAGG - Exonic
1128436945 15:67662044-67662066 TTCCACAGTTTGGAAATAACTGG - Intronic
1131800633 15:96065877-96065899 TTAGGCAACCTGGAAAAGACAGG + Intergenic
1135758154 16:25115156-25115178 TCAAGCAACTTGGAAAAAAGGGG - Intronic
1135777463 16:25269307-25269329 TTACTTAACTTGGAAATAACCGG - Intergenic
1138064136 16:53923067-53923089 TTAGGCTGCTTGGAAAACAGAGG + Intronic
1140536920 16:75718300-75718322 TTACACAACTAGGAAAACACTGG - Intronic
1142909001 17:3071327-3071349 TTACTCAGCTTGTAAAAGAATGG + Intergenic
1142925561 17:3232915-3232937 TTACTCAGCTTGTAAAAGAATGG - Intergenic
1145002763 17:19317184-19317206 TAGTGCTGCTTGGAAAAAACTGG - Intronic
1155987916 18:32250134-32250156 TTCTGCAGCTTAGAAAACACAGG - Intronic
1157030772 18:43905082-43905104 TCAAGCAGCTTGTAAAATACAGG - Intergenic
1158782375 18:60666856-60666878 TTACATAGGTTGGAACAAACAGG - Intergenic
1159674361 18:71263188-71263210 TATCGCAGCTTGGAAAATAATGG - Intergenic
925573205 2:5333217-5333239 TTACACAGTTTGCAAAACACTGG - Intergenic
929210165 2:39347433-39347455 TCACACAGCTTACAAAAAACAGG + Intronic
930240061 2:48927176-48927198 TTATGCAGCTGGGAATAAAATGG + Intergenic
933937058 2:87215040-87215062 TTACACAATTGGGAAAAAACAGG - Intergenic
936356083 2:111750784-111750806 TTACACAATTGGGAAAAAACAGG + Intergenic
936399547 2:112155152-112155174 TTTCTCAGCTTGGAAAAAGGGGG + Intronic
938512436 2:131964896-131964918 TTACACACATTGAAAAAAACAGG + Intergenic
939265852 2:139871998-139872020 TTAGGCAGATAGGAAAAAAGGGG + Intergenic
939631867 2:144535298-144535320 TTGCCCAGTTTGGAAAAAAAGGG + Intergenic
942385874 2:175442202-175442224 TTACACAGCTGGGCATAAACGGG + Intergenic
942788038 2:179723759-179723781 TTACGTAGCTTTGAAAAATTAGG - Intronic
945586842 2:211676233-211676255 TTACGTATCTTGTAAAAGACTGG - Intronic
947407003 2:229788797-229788819 TTACTGAGCTAGGAAAAACCTGG - Exonic
1170322249 20:15112920-15112942 TTATCCAGCCTGGAAAAAAAAGG - Intronic
1176781328 21:13197890-13197912 TTACACACATTGAAAAAAACAGG - Intergenic
1177618569 21:23557152-23557174 TTATGCAGCTTGCACAAAAACGG - Intergenic
1184900189 22:47441806-47441828 TTATGCAGCTTACAAAATACAGG + Intergenic
954739420 3:52736153-52736175 TTAAGTACCTGGGAAAAAACAGG - Intronic
956055580 3:65295178-65295200 TAAAGCATCTTGGAAAAAAGCGG - Intergenic
956689831 3:71865253-71865275 TTACTCAGCATACAAAAAACAGG + Intergenic
962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG + Intronic
967762017 3:193236834-193236856 ATAATCAGTTTGGAAAAAACTGG + Intergenic
969835996 4:9842084-9842106 TTACACAGATTGAAAAAAAATGG - Intronic
972030777 4:34455227-34455249 TTATCAAGCTTGTAAAAAACAGG + Intergenic
972498485 4:39656152-39656174 TTACTCTGCTTGCAAACAACTGG - Intergenic
975192014 4:71475503-71475525 TTACACAGCCTGGGAAAAACTGG - Intronic
980503512 4:133685834-133685856 TTAAGCAGCCAGGAAACAACAGG - Intergenic
980631073 4:135434339-135434361 TTTAGCAGCTTTGAAAAAAAAGG + Intergenic
983294954 4:165855220-165855242 TTAATCAGCTTGGAAAAAAATGG - Intergenic
983543110 4:168934091-168934113 TTAAGAATCTAGGAAAAAACTGG + Intronic
986573031 5:9184768-9184790 TTACTTTGCTTGGAAAAAAAAGG - Intronic
987301919 5:16605009-16605031 ATATGCACCTTGGAAAAAAATGG + Intronic
987464469 5:18255174-18255196 TGACACAGCATGGAAAAAAATGG + Intergenic
987598133 5:20028370-20028392 TTACACAGATTAGAAAATACTGG - Intronic
991291545 5:65037737-65037759 ATACTCAGCATGGAGAAAACTGG - Intergenic
996538442 5:124603384-124603406 TCACAGAGCATGGAAAAAACTGG + Intergenic
999001643 5:147930126-147930148 TGAAGCAGCATGGAGAAAACCGG - Intergenic
1000970518 5:167709206-167709228 GAACTCAGCTTGGAAAAGACAGG - Intronic
1004961422 6:20793458-20793480 TTAGGCATCATGGAAACAACAGG - Intronic
1005410452 6:25539677-25539699 TTAAGCAGCTTTGAAACCACAGG - Intronic
1007942147 6:45791483-45791505 TTAAGCAGCCTGGAAAAAACAGG - Intergenic
1012046707 6:94284944-94284966 TTACTCAGTTTGGAAAAAGAAGG - Intergenic
1015974986 6:138780939-138780961 TTATGCATCTTCTAAAAAACTGG - Intronic
1016270722 6:142286880-142286902 TTATGCAGCCTGGCAAAAATAGG - Intergenic
1019608702 7:1924043-1924065 TTAAGCAGCATGAAAAGAACCGG + Intronic
1019884945 7:3895643-3895665 TTACGCAACTTGAAAAGAAGAGG - Intronic
1024859220 7:53818232-53818254 TTACAAATCTTGGAAAAATCAGG + Intergenic
1027775499 7:82459459-82459481 TGATGCAGCTTGAAAAAGACTGG + Intergenic
1031557521 7:123196488-123196510 GTAAGCAGCTTGCAAAAATCTGG - Intronic
1032635923 7:133708707-133708729 TTACACAGCTTGTAAGTAACTGG + Intronic
1042610699 8:70597262-70597284 TTAAGAAGCTTGGAAAACACTGG + Intronic
1049039782 8:140103826-140103848 TTACCCAGCTAAGAAGAAACAGG + Intronic
1056054377 9:82805821-82805843 TTAGGGAGCCTGGAAAAAAATGG + Intergenic
1194204940 X:91001834-91001856 TTACTCAGCTTGGAAAAGAAAGG + Intergenic
1200425896 Y:3019979-3020001 TTAGGCAGAGAGGAAAAAACGGG - Intergenic
1200550766 Y:4576977-4576999 TTACTCAGCTTGGAAAAGAAAGG + Intergenic
1201055253 Y:9982545-9982567 TTTTTCAGCTTGTAAAAAACAGG - Intergenic
1202273030 Y:23088614-23088636 TTACACAGCTTGGAAATGAGAGG - Intergenic
1202292996 Y:23332068-23332090 TTACACAGCTTGGAAATGAGAGG + Intergenic
1202426027 Y:24722358-24722380 TTACACAGCTTGGAAATGAGAGG - Intergenic
1202444762 Y:24947728-24947750 TTACACAGCTTGGAAATGAGAGG + Intergenic