ID: 1126548707

View in Genome Browser
Species Human (GRCh38)
Location 15:49903392-49903414
Sequence GGGCAGTTTATTACAATTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 192}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126548703_1126548707 4 Left 1126548703 15:49903365-49903387 CCTGTTTTTTCCAAGCTGCGTAA 0: 1
1: 0
2: 1
3: 9
4: 93
Right 1126548707 15:49903392-49903414 GGGCAGTTTATTACAATTCTTGG 0: 1
1: 0
2: 0
3: 14
4: 192
1126548706_1126548707 -6 Left 1126548706 15:49903375-49903397 CCAAGCTGCGTAATGAAGGGCAG 0: 1
1: 0
2: 0
3: 6
4: 73
Right 1126548707 15:49903392-49903414 GGGCAGTTTATTACAATTCTTGG 0: 1
1: 0
2: 0
3: 14
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126548707 Original CRISPR GGGCAGTTTATTACAATTCT TGG Intronic
901296732 1:8166484-8166506 GAGCATTTTATTATAGTTCTTGG + Intergenic
902358692 1:15928792-15928814 GCTCAGTTTATTACAACTCCTGG - Exonic
906477107 1:46176562-46176584 GGGCCCTTTATTACAAGTCGTGG + Intronic
909665166 1:78124170-78124192 GCTCAGTTTATTTCAATACTTGG - Intronic
911034055 1:93520109-93520131 ATGCAGTATATTACAATTATTGG + Intronic
912465595 1:109871187-109871209 GGACAGATTATTAGAATTGTTGG + Intergenic
913494018 1:119410844-119410866 GGCCAGCTTATTAAAATTCTGGG - Intergenic
913507653 1:119533097-119533119 GGCCAGCTTATTAAACTTCTGGG - Intergenic
914394377 1:147250849-147250871 GTGGAGATTATTACAATTCAGGG - Intronic
916373185 1:164122479-164122501 AAGCAGTTTTTTCCAATTCTGGG + Intergenic
917826988 1:178833070-178833092 GGACAGTTCATTAAAATACTTGG + Intronic
917971240 1:180209201-180209223 GTGCAGATTATTACAATTCAAGG - Intergenic
918920232 1:190699158-190699180 GTGGAGATTATTACAATTCAAGG - Intergenic
921676742 1:217984413-217984435 GTGGAGATTATTACAATTCAAGG + Intergenic
923394860 1:233551774-233551796 GGGCAGTTTATCATTATTCCTGG - Intergenic
1063682173 10:8199249-8199271 GGCCACTTTATTGGAATTCTAGG + Intergenic
1064782161 10:18854017-18854039 GAGCTTTTTATTACAATACTTGG + Intergenic
1066237525 10:33500946-33500968 GGGTACCTTATTACAATTGTAGG + Intergenic
1068666553 10:59682154-59682176 GGGCATCTTATCAAAATTCTGGG - Intronic
1070225133 10:74496298-74496320 GTGGAGATTATTACAATTCAAGG - Intronic
1070996379 10:80786835-80786857 GTGGAGATTATTACAATTCAAGG + Intergenic
1074055727 10:109921930-109921952 TGGCAGGTTATGACAGTTCTAGG - Intronic
1075281816 10:121145176-121145198 GTGGAGATTATTACAATTCAAGG + Intergenic
1077930887 11:6731601-6731623 GAGTAGTTTTTTCCAATTCTGGG - Intergenic
1078027806 11:7714836-7714858 GTGGAGATTATTACAATTCAAGG - Intergenic
1080439576 11:32279186-32279208 GGCAACTTTATTACAATTCTGGG + Intergenic
1084513330 11:69619930-69619952 GTGGAGATTATTACAATTCAAGG + Intergenic
1085815823 11:79736003-79736025 GGGCAGTTTCTTGCAATATTGGG + Intergenic
1086322000 11:85659961-85659983 GGGTAGTTAATTACAATTTAGGG - Intronic
1091451008 12:571877-571899 GGGCAGTTACTTACCACTCTGGG - Intronic
1092568589 12:9696623-9696645 GTGGAGATTATTACAATTCAAGG + Intronic
1093344891 12:18028393-18028415 GAGTAGTTTTTTCCAATTCTGGG - Intergenic
1093759375 12:22890305-22890327 AGGGACTTTATTACAGTTCTAGG + Intergenic
1094408381 12:30143775-30143797 GGGCATTTTTTTAAACTTCTTGG - Intergenic
1094617413 12:32048419-32048441 GTTCAGTTTATTTCAAATCTTGG - Intergenic
1095041832 12:37450945-37450967 TAGCATTATATTACAATTCTGGG + Intergenic
1095328827 12:40932178-40932200 GTGAAGATTATTACAATTCAAGG - Intronic
1098575079 12:72032137-72032159 GGGAAGTTTCCTACAATTCTGGG - Exonic
1099862382 12:88235838-88235860 GTGGAGATTATTACAATTCAAGG + Intergenic
1099993729 12:89753837-89753859 GGGCACATTATTACAATACAGGG - Intergenic
1100222988 12:92526299-92526321 GGGCCCTTGATTACAATTATAGG - Intergenic
1101111726 12:101492854-101492876 GTGAAGATTATTACAATTCAAGG + Intergenic
1104263868 12:127212354-127212376 GTGGAGATTATTACAATTCAAGG + Intergenic
1106942917 13:34796750-34796772 GTGGAGATTATTACAATTCAAGG - Intergenic
1106963196 13:35026020-35026042 GTGGAGATTATTACAATTCAAGG - Intronic
1107638068 13:42413522-42413544 AGGGAGTTTATTACAGCTCTTGG - Intergenic
1109467101 13:62749714-62749736 TGGCATTTTATTAAAATACTAGG + Intergenic
1109832744 13:67813287-67813309 GTGGAGTTTATTGCAATTCAAGG + Intergenic
1110664215 13:78096893-78096915 GGGTAATTTCTTACAATTATAGG + Intergenic
1110830275 13:80023225-80023247 GGAAAGTTAATTCCAATTCTAGG + Intergenic
1112841449 13:103584104-103584126 GTGAAGATTATTACAATTCAAGG + Intergenic
1113200253 13:107859481-107859503 GGGTAGTTTTTTAAAATTCTTGG - Intronic
1120591068 14:86373556-86373578 ATGCAGATTATTACAATTCAAGG - Intergenic
1125332081 15:38592312-38592334 GGGGTGTCTATTCCAATTCTTGG + Intergenic
1126548707 15:49903392-49903414 GGGCAGTTTATTACAATTCTTGG + Intronic
1127787107 15:62365350-62365372 GTGGAGATTATTACAATTCAAGG - Intergenic
1130704926 15:86224171-86224193 GGGCAGTGTAGTATAATTATAGG - Intronic
1130730057 15:86482541-86482563 GTGCAGTTTGTTTCAATTATAGG - Intronic
1130735559 15:86544725-86544747 GTGGAGATTATTACAATTCAAGG + Intronic
1134907448 16:17992880-17992902 GTGGAGATTATTACAATTCAAGG - Intergenic
1135727224 16:24865143-24865165 CTGCAGTTTATTATATTTCTTGG - Intronic
1136084992 16:27878503-27878525 GAGGAGATTATTACAATTCAAGG + Intronic
1138072825 16:54010111-54010133 TTGCACTTTAATACAATTCTTGG + Intronic
1140595065 16:76398906-76398928 GGGGGGATTATTACAATTCAAGG - Intronic
1145853894 17:28133714-28133736 GTGCAGTTTATTCAAACTCTAGG + Intronic
1149029391 17:52066405-52066427 GTGGAGATTATTACAATTCAAGG - Intronic
1149081266 17:52660391-52660413 GGGTAGTTTATTTCTATTTTTGG - Intergenic
1151105023 17:71603100-71603122 GTGCAGATTATTACAATTCAAGG + Intergenic
1154506731 18:15047327-15047349 AGGGAGATTATTACAATTCAAGG + Intergenic
1156051109 18:32935284-32935306 TGTCACTTTATGACAATTCTGGG + Intergenic
1158328853 18:56339404-56339426 GTGGAGATTATTACAATTCAAGG + Intergenic
1159265656 18:66074948-66074970 GAGGAGATTATTACAATTCAAGG + Intergenic
1159446012 18:68542403-68542425 GTGGAGATTATTACAATTCAAGG + Intergenic
1160148932 18:76384841-76384863 GGGCACTTTATTAGAATTGAAGG + Intronic
1160303692 18:77710279-77710301 GTGAAGATTATTACAATTCATGG + Intergenic
1164739017 19:30563172-30563194 GGGCAGGTTATTATAAATCATGG + Intronic
925678969 2:6396677-6396699 TGGGAGATTATTACAATTCAAGG + Intergenic
925981517 2:9181053-9181075 GTGGAGGTTATTACAATTCAAGG - Intergenic
926367225 2:12144448-12144470 GGGACGTATATTACAATCCTGGG + Intergenic
928259463 2:29753796-29753818 GGTCAGTTTTTGACAATTCCAGG + Intronic
929696969 2:44125744-44125766 GGGCATTGTATTACTATTCTGGG - Intergenic
929860690 2:45674832-45674854 GAGGAGTTTATGAGAATTCTCGG + Intronic
930333525 2:50016729-50016751 GTGCTGATTATTACAATTCAAGG + Intronic
930979374 2:57504065-57504087 GTGGAGATTATTACAATTCAAGG + Intergenic
932027103 2:68145280-68145302 GGACAGTTTTTTTCAATTCTGGG + Intronic
933135737 2:78732880-78732902 GTGGAGATTATTACAATTCAAGG - Intergenic
934610290 2:95730427-95730449 GGGCAGATCATCACAATTATGGG + Intergenic
936543619 2:113372013-113372035 GGGCAGATCATCACAATTATGGG + Intergenic
936920636 2:117685126-117685148 GGGCAGTTTCCTACAGATCTAGG + Intergenic
937743235 2:125380305-125380327 GTGGAGATTATTACAATTCAAGG + Intergenic
938861114 2:135370790-135370812 ATGCAGATTATTACAATTCAAGG - Intronic
940405139 2:153292727-153292749 GGGCAGTTCATAACAAGTCAGGG + Intergenic
941581707 2:167304765-167304787 TGGCAGATTATGAGAATTCTTGG - Intergenic
943307150 2:186276862-186276884 GTGGAGATTATTACAATTCAAGG + Intergenic
943703453 2:191011600-191011622 GGGAATTATATTACAATTCGAGG - Intronic
943779378 2:191805130-191805152 GGCCCGTTTATGACAATTCCTGG + Intergenic
945214260 2:207416469-207416491 GGGCAATGTTTTAAAATTCTAGG - Intergenic
945222038 2:207493680-207493702 GGGTAATATATTAGAATTCTTGG + Intergenic
946694679 2:222342672-222342694 GTGGAGATTATTACAATTCAAGG + Intergenic
947000013 2:225443228-225443250 GGGCAAATTATTACTTTTCTAGG + Intronic
947154742 2:227150838-227150860 GTGGAGATTATTACAATTCAAGG + Intronic
947377508 2:229511541-229511563 GGGAAGTTTTTAACATTTCTTGG - Intronic
1169238197 20:3949722-3949744 GGGTAGTTTATGAGAGTTCTAGG + Intronic
1171536260 20:25894000-25894022 TAGCATTATATTACAATTCTGGG + Intergenic
1171804838 20:29667157-29667179 TAGCATTATATTACAATTCTGGG - Intergenic
1171839219 20:30189266-30189288 TAGCATTATATTACAATTCTGGG + Intergenic
1173542931 20:43868225-43868247 GTGCAGATTATTACGATTCAAGG - Intergenic
1173882477 20:46426471-46426493 GGCCAGTTTATGACAATTGGAGG + Intronic
1175527762 20:59647347-59647369 GTGGAGATTATTACAATTCAAGG + Intronic
1176403297 21:6336916-6336938 GTGGAGATTATTACAATTCAAGG + Intergenic
1176433860 21:6652188-6652210 GTGGAGATTATTACAATTCAAGG - Intergenic
1176791135 21:13321774-13321796 AGGGAGATTATTACAATTCAAGG - Intergenic
1177811953 21:25934342-25934364 GGGCAGTGTATTAGATTCCTAGG - Intronic
1177990660 21:28031591-28031613 AGGGAGATTATTACAATTCAAGG + Intergenic
1179155349 21:38845665-38845687 ACGCAGATTATTACAATTCAAGG + Intergenic
1182015749 22:27038338-27038360 GTGGAGATTATTACAATTCAAGG + Intergenic
1182632926 22:31701544-31701566 GAGCCATTTATTACATTTCTAGG - Intronic
949240735 3:1868501-1868523 GTGGAGATTATTACAATTCAAGG - Intergenic
949401527 3:3669747-3669769 GTGGAGGTTATTACAATTCAAGG + Intergenic
951160489 3:19413766-19413788 GGGCATTTTATTAGTTTTCTAGG - Intronic
951176711 3:19609912-19609934 GGGGGGGTTATTACAATTCAAGG + Intergenic
951291343 3:20875429-20875451 TAGTAGTTTATTCCAATTCTGGG + Intergenic
952418693 3:33112442-33112464 GGGCCGTTTCTTACAAAACTAGG - Intergenic
956285678 3:67607686-67607708 GTGGAGATTATTACAATTCAAGG - Intronic
960099952 3:113730835-113730857 GAGCAGTTGTTTACAATTTTAGG + Intronic
961598086 3:128035280-128035302 GGGTATTTTCTTACAGTTCTGGG - Intergenic
963787943 3:149554151-149554173 GAGCCCTTTATTCCAATTCTGGG + Intronic
964013514 3:151919037-151919059 GTGGAGTTTATTACAAGTCAAGG - Intergenic
964640545 3:158905830-158905852 GTGGAGATTATTACAATTCAAGG - Intergenic
964698443 3:159536440-159536462 GGGCAGAGTCTTACATTTCTTGG + Intronic
964711799 3:159678963-159678985 GTGGAGATTATTACAATTCAAGG + Intronic
964870036 3:161303497-161303519 GTGGAGATTATTACAATTCAAGG - Intergenic
969081614 4:4623252-4623274 GTGGAGATTATTACAATTCAAGG - Intergenic
970046404 4:11859487-11859509 GTGGAGATTATTACAATTCACGG - Intergenic
970261776 4:14232078-14232100 GTGGAGATTATTACAATTCAAGG + Intergenic
971102430 4:23482563-23482585 GTGGAGATTATTACAATTCAAGG + Intergenic
971498458 4:27292969-27292991 GTGGAGATTATTACAATTCAAGG - Intergenic
975883773 4:78940866-78940888 GGCCAGTTCATTCAAATTCTTGG + Intergenic
976880572 4:89919235-89919257 GGGCACTTTATTAACATTATCGG + Intronic
978192040 4:105925177-105925199 GGACAGTTTATTTCATTTCATGG + Intronic
979178815 4:117699940-117699962 AGGCAGCTTGTTGCAATTCTTGG - Intergenic
981394030 4:144224961-144224983 GGGCTGTTTATTAGATTTGTTGG + Intergenic
982775245 4:159434935-159434957 GTGGAGATTATTACAATTCAAGG - Intergenic
983999386 4:174222322-174222344 TGACTGTTTACTACAATTCTCGG + Intergenic
993743458 5:91566539-91566561 GTGGAGATTATTACAATTCAAGG + Intergenic
994448449 5:99908470-99908492 GGGAAGTTTATGACAGATCTAGG + Intergenic
995367493 5:111379912-111379934 GGACAGTTTATTAGAAATTTTGG + Intronic
996056228 5:118985871-118985893 GGGCAGTTTTTTCAAATTATAGG - Intronic
999702550 5:154241238-154241260 TGGCAGTTCCTTAGAATTCTGGG + Intronic
1000641684 5:163710500-163710522 GGTCTATTTACTACAATTCTGGG + Intergenic
1000690294 5:164309934-164309956 GGGCAAATTATTAAACTTCTGGG - Intergenic
1006605973 6:35258339-35258361 AGGCAGTTTATTTCCATACTAGG + Intergenic
1008131859 6:47727975-47727997 AGGCAGTTTACTTCAGTTCTTGG - Intergenic
1009837021 6:69014526-69014548 GGCCTGATTTTTACAATTCTTGG - Intronic
1009946382 6:70346651-70346673 GGGCTGCACATTACAATTCTGGG + Intergenic
1010111540 6:72240706-72240728 GGGCAGTCTATTAGAATTGGTGG + Intronic
1011805804 6:91071576-91071598 GTGGAGATTATTACAATTCAAGG - Intergenic
1012643226 6:101649053-101649075 GTGGAGATTATTACAATTCAAGG + Intronic
1014983811 6:127978261-127978283 GTGGGGATTATTACAATTCTAGG - Intronic
1015011845 6:128358887-128358909 GAGCAGTCTATTATAATTTTAGG - Intronic
1017797477 6:157858924-157858946 ATGCAGATTATTACAATTCAGGG + Intronic
1020466424 7:8484998-8485020 GGGCTGATTATTATAATTCAAGG - Intronic
1021174848 7:17439250-17439272 GGGGGGATTATTACAATTCAAGG + Intergenic
1021229966 7:18074454-18074476 GTGGAGATTATTACAATTCCAGG - Intergenic
1021700755 7:23317271-23317293 GGGCATTTTAATTCAAGTCTAGG + Intronic
1024118303 7:46213212-46213234 GTGGAGTTTATTACAATTCAGGG + Intergenic
1024492581 7:50002350-50002372 GTGGAGATTATTACAATTCAAGG + Intronic
1027521877 7:79219502-79219524 GGCCACTTTGTAACAATTCTGGG - Intronic
1029667896 7:102007657-102007679 GTCCAGTTTATTTTAATTCTGGG + Intronic
1032987365 7:137353204-137353226 AGACACTTTATTACAATTTTAGG + Intergenic
1033806081 7:144955777-144955799 GGGGTGGTTATTACAATTCAAGG - Intergenic
1033982000 7:147177238-147177260 GTGGAGATTATTACAATTCAAGG - Intronic
1035865184 8:3074752-3074774 TGGCATTTTATTATAATTTTTGG + Intronic
1036217015 8:6889243-6889265 GGGCAGTAAATCACAATTCTGGG - Intergenic
1038009135 8:23460011-23460033 TGGGAATTTATTAGAATTCTGGG + Intergenic
1038153617 8:24965688-24965710 GTGCAGTTTATTAGATTTGTAGG - Intergenic
1039260612 8:35767228-35767250 GGGAAGTTTAGTTCAATCCTCGG - Intronic
1039342290 8:36664152-36664174 GTGGGGGTTATTACAATTCTAGG + Intergenic
1039427599 8:37499406-37499428 GTGGAGATTATTACAATTCAAGG - Intergenic
1040692647 8:49958368-49958390 GGGCAGTGTCCTACAATTCCAGG + Intronic
1043468402 8:80537052-80537074 AGGCTATTTATTACAATTTTGGG + Intergenic
1044229034 8:89754089-89754111 GTTCAGTTTATGAAAATTCTTGG - Intergenic
1044571490 8:93723839-93723861 GGACAGTTTGTTGTAATTCTAGG + Intronic
1045932560 8:107644086-107644108 GTGGAGATTATTACAATTCAAGG - Intergenic
1048111458 8:131472831-131472853 GTGGAGATTATTACAATTCAAGG - Intergenic
1048801470 8:138198065-138198087 GTGGAGATTATTACAATTCAAGG - Intronic
1048808394 8:138262448-138262470 TGGGAGTTTATTACCACTCTAGG + Intronic
1050469871 9:5976469-5976491 GGTTTGTTTATTACTATTCTTGG + Intronic
1051415842 9:16839432-16839454 GGGCATTTTATTTCTATTCTAGG - Intronic
1052806062 9:33014368-33014390 GGGCAGTTTATTAGAAATCATGG + Intronic
1055366299 9:75548361-75548383 GGGCAGCTTCTAACAATACTAGG - Intergenic
1055631851 9:78232809-78232831 GTGGGGATTATTACAATTCTAGG + Intergenic
1058279812 9:103099847-103099869 ATGCAGATTATTACAATTCAAGG + Intergenic
1060455573 9:123792190-123792212 GGGAAGTTTATAACATTTCCTGG - Intronic
1185630500 X:1513337-1513359 GTGAAGATTATTACAATTCCAGG + Intronic
1187279465 X:17846846-17846868 ATGCAGATTATTACAATTCAAGG - Intronic
1188736420 X:33721981-33722003 GTGGGGTTTATTACAATTCAAGG + Intergenic
1188974038 X:36652109-36652131 GTGGAGATTATTACAATTCAAGG + Intergenic
1191607698 X:63080200-63080222 GTGGAGATTATTACAATTCAAGG - Intergenic
1194499281 X:94659555-94659577 GTGGAGATTATTACAATTCAAGG - Intergenic
1195502890 X:105623463-105623485 GGGCAGTTTTTTTCAGTTCTGGG + Intronic
1197498956 X:127221086-127221108 GTGGAGATTATTACAATTCAAGG - Intergenic
1198023618 X:132683202-132683224 GGGCATTTTATTTCAATTAAGGG + Intronic
1198938180 X:141921902-141921924 GTGGAGATTATTACAATTCAAGG - Intergenic
1199259048 X:145749324-145749346 GGGATGATTATTACAATTCAAGG + Intergenic
1200862662 Y:8009425-8009447 GGGCAGTTTAGTACATCTCTCGG - Intergenic
1201703618 Y:16911225-16911247 GTTCAGATTATTACAATTCAAGG - Intergenic