ID: 1126554889

View in Genome Browser
Species Human (GRCh38)
Location 15:49975350-49975372
Sequence GGGGGATCCCTTACATAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 62}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126554882_1126554889 29 Left 1126554882 15:49975298-49975320 CCATAGTCTTATAGATTTGTTCT 0: 1
1: 0
2: 1
3: 24
4: 235
Right 1126554889 15:49975350-49975372 GGGGGATCCCTTACATAAAATGG 0: 1
1: 0
2: 0
3: 4
4: 62
1126554887_1126554889 -10 Left 1126554887 15:49975337-49975359 CCCTTGAATCTGTGGGGGATCCC 0: 1
1: 0
2: 0
3: 5
4: 100
Right 1126554889 15:49975350-49975372 GGGGGATCCCTTACATAAAATGG 0: 1
1: 0
2: 0
3: 4
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126554889 Original CRISPR GGGGGATCCCTTACATAAAA TGG Intronic
917810749 1:178656178-178656200 GGGATATCCCATACATCAAAAGG + Intergenic
919368108 1:196691063-196691085 GGGGGCTGCCTTTCATTAAAAGG + Intronic
919441631 1:197640976-197640998 GAGGCCTTCCTTACATAAAATGG + Intronic
923804613 1:237244367-237244389 GGGGGCTGCTTTACATTAAAAGG - Intronic
924285335 1:242480262-242480284 GGGGTAGCCCTTTCAAAAAATGG + Intronic
1066361863 10:34739041-34739063 AGGTGATCCCTTAAACAAAACGG - Intronic
1068736647 10:60420753-60420775 GAGAGATCCCTTTTATAAAAGGG + Intronic
1070461205 10:76672213-76672235 GGGGGCTCCTTTTCATTAAAAGG + Intergenic
1085270419 11:75266830-75266852 GGGGGATCCCAGACAGAAGAAGG + Intronic
1088099820 11:106143049-106143071 GGGGGCTCCTTTTCATTAAAAGG + Intergenic
1090552078 11:127830964-127830986 GGGAGATCTCTTACCTACAAAGG + Intergenic
1090563244 11:127956717-127956739 GCAGTATCCCTTACATAAAAAGG - Intergenic
1092942969 12:13427723-13427745 GGTGAATCCTTTACATCAAAGGG + Intergenic
1095394128 12:41743147-41743169 CTGGGATCCCTTACAACAAAAGG - Intergenic
1097156845 12:57018169-57018191 GGTGGAGCCCTTTAATAAAAAGG - Intronic
1100163241 12:91886269-91886291 GAGGGATCCATGCCATAAAAAGG + Intergenic
1101481699 12:105104257-105104279 TTAGGATCCCTTAAATAAAAGGG + Intergenic
1103810865 12:123612591-123612613 GGGGGAACTCTTAAATAATAGGG + Intronic
1106860850 13:33906586-33906608 GGAGTAGCCCTTTCATAAAAGGG - Intronic
1110582361 13:77145402-77145424 GGGGCATTCCTTAAATTAAACGG - Intronic
1117179665 14:53179371-53179393 GGGGGATAATTTATATAAAAAGG - Intergenic
1124468083 15:29957888-29957910 GGGGGAGTCCTTAAATACAAGGG + Intronic
1126554889 15:49975350-49975372 GGGGGATCCCTTACATAAAATGG + Intronic
1133116155 16:3579055-3579077 TGGGTATCCGTCACATAAAAGGG + Intergenic
1143988800 17:10939068-10939090 GGGGTGTCCCTGACACAAAACGG - Intergenic
1154146430 18:11870092-11870114 GGAGGCTCCCTTATATGAAATGG - Intronic
1161288405 19:3480197-3480219 GGGGGGTCCCTTACAGAGGAGGG + Intronic
1162763667 19:12904445-12904467 GGGGGATTCCTTATGCAAAAGGG - Intronic
1164267218 19:23631267-23631289 GGTGGAACCCATAGATAAAAAGG - Intronic
927511535 2:23647122-23647144 TGGGGACCCCTTCCCTAAAAGGG + Intronic
935469857 2:103445248-103445270 AGGGGTTGCCTGACATAAAAGGG - Intergenic
937294717 2:120803045-120803067 GGGTCTTCCCATACATAAAATGG + Intronic
939580235 2:143937911-143937933 GGGGAACCTCTTACAAAAAAGGG + Intergenic
942530949 2:176909666-176909688 GGATGATCCCTGACATACAATGG + Intergenic
944146165 2:196509677-196509699 CCTGGATCCCTTAAATAAAAAGG + Intronic
1173110439 20:40182734-40182756 GGGGGATTCCTTTCAGGAAAGGG - Intergenic
1175070243 20:56326954-56326976 GGGAGTTCCCTTTCATTAAATGG + Intergenic
1175976329 20:62712176-62712198 CGGGGAAACCTTTCATAAAATGG - Intronic
1177589557 21:23145009-23145031 GGGGCTTCACTTACATAACAAGG - Intergenic
951636245 3:24781070-24781092 GGGGAATCCTTTACATATAAAGG - Intergenic
957714524 3:83907948-83907970 GGGGCATCACTTACCCAAAAGGG + Intergenic
961611702 3:128144810-128144832 AGGGGATCCCCTACAGGAAATGG - Intronic
962681768 3:137807882-137807904 GGAGAATCCCTTCCATAAATGGG - Intergenic
967543414 3:190695401-190695423 GGGGAATTCCTTAAATAACAGGG - Intergenic
968820468 4:2846580-2846602 GAGGTATCTCTTACAGAAAAGGG + Intronic
984097486 4:175450173-175450195 GGGGGATCCCTGCCAAAAAATGG + Intergenic
984316508 4:178137951-178137973 GGGGAGTCCCTGCCATAAAAAGG + Intergenic
984673638 4:182521578-182521600 GGGGGGTCGCTAAGATAAAATGG + Intronic
986268570 5:6211598-6211620 GGGGGTTGCTTTACATTAAAAGG + Intergenic
992985707 5:82227313-82227335 TGGGGATACCTTAAATAAAGGGG - Intronic
1000838658 5:166188412-166188434 GGGTGATCCATTACTTTAAATGG - Intergenic
1003627165 6:7752367-7752389 GTGGGTTCCCTGACATATAAGGG + Intronic
1007198488 6:40084454-40084476 AGGGTTTCCCTTACTTAAAATGG + Intergenic
1014291777 6:119566649-119566671 GGGGGCTGCTTTTCATAAAAAGG - Intergenic
1016196313 6:141346826-141346848 GGGAGATCCCATAGACAAAAGGG - Intergenic
1022899440 7:34789256-34789278 AGGGTTTCCCTTTCATAAAAAGG + Intronic
1026308593 7:69164720-69164742 GGGGGATCCCTTCCATCAGAAGG + Intergenic
1032638829 7:133741970-133741992 GGGGCATTCATTTCATAAAAGGG - Intronic
1041996002 8:64059084-64059106 TGGAAATCCCTTATATAAAATGG - Intergenic
1044931125 8:97252652-97252674 TGGGGCTCCTTTAAATAAAATGG + Intergenic
1052408523 9:28092978-28093000 TTGGCATCCCTTCCATAAAATGG - Intronic
1053296424 9:36917451-36917473 GGGGATTCCCTTACAAAAACTGG - Intronic
1057710114 9:97433017-97433039 GGTGGACCCTTTACAGAAAAAGG + Intronic
1187040629 X:15591613-15591635 GGGGTATCCCTGATATCAAAGGG + Intronic
1188607453 X:32049546-32049568 GGGGGCTCGCTTATAGAAAATGG - Intronic
1190654947 X:52603388-52603410 GGAGGATCCCTTAGATATACAGG - Intergenic
1197636538 X:128921119-128921141 GGGGGCTACCTTAGGTAAAATGG - Intergenic