ID: 1126558145

View in Genome Browser
Species Human (GRCh38)
Location 15:50013301-50013323
Sequence ATGTCCCCCTAGAAGAGCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 85}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126558145_1126558152 11 Left 1126558145 15:50013301-50013323 CCATAGCTCTTCTAGGGGGACAT 0: 1
1: 0
2: 1
3: 3
4: 85
Right 1126558152 15:50013335-50013357 TTGGGCTGTGAAGGTGACACTGG 0: 1
1: 0
2: 2
3: 10
4: 184
1126558145_1126558149 -7 Left 1126558145 15:50013301-50013323 CCATAGCTCTTCTAGGGGGACAT 0: 1
1: 0
2: 1
3: 3
4: 85
Right 1126558149 15:50013317-50013339 GGGACATAGGATGGCCTTTTGGG 0: 1
1: 0
2: 1
3: 9
4: 146
1126558145_1126558150 2 Left 1126558145 15:50013301-50013323 CCATAGCTCTTCTAGGGGGACAT 0: 1
1: 0
2: 1
3: 3
4: 85
Right 1126558150 15:50013326-50013348 GATGGCCTTTTGGGCTGTGAAGG 0: 1
1: 0
2: 2
3: 18
4: 347
1126558145_1126558148 -8 Left 1126558145 15:50013301-50013323 CCATAGCTCTTCTAGGGGGACAT 0: 1
1: 0
2: 1
3: 3
4: 85
Right 1126558148 15:50013316-50013338 GGGGACATAGGATGGCCTTTTGG 0: 1
1: 0
2: 1
3: 16
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126558145 Original CRISPR ATGTCCCCCTAGAAGAGCTA TGG (reversed) Intronic
900725732 1:4215346-4215368 GTGTTCCCCGAAAAGAGCTATGG - Intergenic
901072217 1:6526756-6526778 CTGTGCCCCCGGAAGAGCTAAGG - Exonic
904377316 1:30090068-30090090 CTGACCTCCTGGAAGAGCTAGGG - Intergenic
909741722 1:79037443-79037465 CTGTGTGCCTAGAAGAGCTATGG + Intergenic
910475527 1:87602212-87602234 ATGTCCCAGTAGAACAACTATGG - Intergenic
916275984 1:162993813-162993835 ATCTCCCCCTCAAAGAGCTTAGG + Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
922204281 1:223433011-223433033 ATATCCCCCAGGAAGACCTATGG + Intergenic
1068918385 10:62457973-62457995 ATGTCTCCCTGGGAGAGCTAAGG - Intronic
1075618160 10:123906280-123906302 ATGTCTACCTAGAAGAGAGATGG + Intronic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078580137 11:12533161-12533183 ATGTGTCCTGAGAAGAGCTAGGG + Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1090371224 11:126254495-126254517 ATGTTCCCCTTTAAGATCTATGG - Intronic
1091032785 11:132205924-132205946 AGTTCCCCCTAGAAGGTCTAGGG + Intronic
1091691323 12:2599340-2599362 ATGTCCCCCTTGGACAGCCACGG - Intronic
1093102474 12:15044664-15044686 ATTTCCCACTAAAAGAGCTTTGG + Intergenic
1097058666 12:56266627-56266649 ATGTCCCTCTAGAGAACCTAAGG + Intergenic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1110213702 13:73003202-73003224 ATGATTCCCTAGAAGAGCTTTGG + Intronic
1113424790 13:110199164-110199186 ATGTGCCCCTGGGAGAGCTGAGG + Intronic
1113870688 13:113558119-113558141 ATCTTCCGCTAGAAGAACTAGGG + Intergenic
1114345689 14:21792292-21792314 ATGTCTCCCTGGAAGAGGGAGGG + Intergenic
1118357989 14:65031243-65031265 ATGTGCCCCGAGAAGAATTAGGG + Intronic
1118505406 14:66405419-66405441 ATGTCTCCTTCGAAGGGCTATGG + Intergenic
1122076001 14:99234995-99235017 AAGTCCCTCTAGAAGAGAGACGG - Intronic
1123031534 14:105454071-105454093 ATGTCGCCCCACAAGAGCTCTGG + Intronic
1126558145 15:50013301-50013323 ATGTCCCCCTAGAAGAGCTATGG - Intronic
1128032879 15:64497404-64497426 ATGTCACAGTAGAAGAGCAAAGG - Intronic
1133321796 16:4918787-4918809 GTGTGCCCCTTGGAGAGCTATGG + Intronic
1137581023 16:49633668-49633690 ATGCCCCCCTAGAAAGGCTGAGG + Intronic
1141151792 16:81569435-81569457 ATGTCCCTCTGGGAGAGCCAGGG - Intronic
1154963176 18:21330006-21330028 ATGACCCCTTTGAAGACCTAGGG - Intronic
1154999428 18:21672261-21672283 ATCTCCTCCAAGAATAGCTAGGG - Intronic
1160455616 18:78996961-78996983 ATCACCCCCTAGGAGAGCCATGG - Exonic
1162448497 19:10739207-10739229 ATGTCCCCATAGAAGAACAAGGG - Intronic
1168517618 19:57021494-57021516 AGGAACCCCAAGAAGAGCTACGG - Intergenic
926522055 2:13927706-13927728 ATGTCCATCTAGAAGAGTGAAGG - Intergenic
928196996 2:29223202-29223224 TTGTCCTCCTAGGAGGGCTAGGG + Intronic
928238016 2:29562104-29562126 CTGTCTGCCTAGAAGAGCAAAGG - Intronic
930409708 2:51009744-51009766 CTGTCACCATAGAAGAGATATGG - Intronic
932126912 2:69152888-69152910 ATGTCTCCCCAGAATAGCTTAGG + Intronic
936089108 2:109489481-109489503 AAGTCCACTTAGAAGAGCTGGGG + Intronic
942592232 2:177558427-177558449 ATGTCTGCCTGGAAAAGCTATGG + Intergenic
1175249883 20:57602858-57602880 AAGTTCCCGTAGAAGGGCTATGG - Intergenic
1183643423 22:39107351-39107373 ATGTCCTTCTAGAAGAGTAAAGG - Intergenic
949315516 3:2750559-2750581 AAGTCCCCCTTGATGAGATATGG + Intronic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
956104829 3:65806849-65806871 ATGTCCCCCTTGAAGAGGGGAGG + Intronic
956785476 3:72638701-72638723 ATTTCCCCCTAGGAGATCTAAGG - Intergenic
960498731 3:118409050-118409072 ATGTCCCACTAAAATATCTACGG + Intergenic
965710581 3:171552958-171552980 ATGTAGGCCTATAAGAGCTATGG - Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
966885146 3:184373346-184373368 CAGTCCCCCTAGAAGACCTGAGG - Intronic
968386349 4:142529-142551 ATGCCCCTCTAGAAGAGTGAAGG - Intronic
968607793 4:1543696-1543718 ACTTCCCCCAAGAAGAGCTGAGG + Intergenic
969250341 4:5964004-5964026 ATGTGCAACTAGAAAAGCTAGGG + Intronic
972819190 4:42680004-42680026 ATGTCCTGCTAGAAGAGTGAAGG - Intergenic
974600309 4:64071216-64071238 ATGTCTCCGTAGAGGGGCTAGGG + Intergenic
979484506 4:121255198-121255220 TTGTCCCTCTAGAAGATCCAAGG + Intergenic
982151168 4:152459070-152459092 ATGGCCCCCTAGGAGAGGTGAGG + Intronic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
990833068 5:59982471-59982493 ATGTGCCCCTAGACAATCTAAGG - Intronic
992730396 5:79660870-79660892 ATGTCCCACTGGAAGATCTTTGG - Intronic
995063297 5:107834911-107834933 AAGCCCTCCCAGAAGAGCTATGG + Intergenic
997858774 5:137397209-137397231 ATGACCCTCTAGAACAGCAATGG + Intronic
1004425366 6:15503469-15503491 GCGTCCCCCTAGAAGTGATAGGG - Intronic
1018584693 6:165344498-165344520 ATGTGGACCTAGAAGAGGTAAGG - Intronic
1021960233 7:25863158-25863180 ATTTTCCACTAGCAGAGCTAGGG + Intergenic
1024594558 7:50921154-50921176 ATGACCCCCTACAAGAGATCGGG - Intergenic
1025715703 7:63953495-63953517 ATGTCTCCCCAGGAGAGCTGGGG + Intergenic
1026558476 7:71428416-71428438 ATGTCCACCAAGAAAAGCAATGG - Intronic
1026913407 7:74105964-74105986 ATGTGCCCCTGGACGAGGTACGG + Exonic
1026930683 7:74221519-74221541 ATGGCCCCCAAGAGGAGCAATGG + Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1033617356 7:143029397-143029419 ATGTCCTCCCAGAGGAGCTTAGG + Intergenic
1040402721 8:47068473-47068495 ATGCCCTCCTAGAAGAGTGAAGG - Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1052414895 9:28165684-28165706 ATTTCCCTCTAGAGAAGCTAAGG + Intronic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1060754314 9:126201351-126201373 ATGACCCACTAGAAGAGCTAAGG + Intergenic
1060925512 9:127452524-127452546 AGGGCCCGCTAGAGGAGCTAGGG - Intronic
1062244535 9:135558195-135558217 ATCTCCCCAGAGAAGATCTATGG - Intergenic
1187817484 X:23248474-23248496 TTGTCCCACTAGAGGAGATAGGG - Intergenic
1188059157 X:25579094-25579116 ATATCCCACTACAAAAGCTAAGG - Intergenic
1199501295 X:148509499-148509521 AAGTCTCCCAAGAAGAGCTTTGG + Intronic