ID: 1126558148

View in Genome Browser
Species Human (GRCh38)
Location 15:50013316-50013338
Sequence GGGGACATAGGATGGCCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126558145_1126558148 -8 Left 1126558145 15:50013301-50013323 CCATAGCTCTTCTAGGGGGACAT 0: 1
1: 0
2: 1
3: 3
4: 85
Right 1126558148 15:50013316-50013338 GGGGACATAGGATGGCCTTTTGG 0: 1
1: 0
2: 1
3: 16
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126558148 Original CRISPR GGGGACATAGGATGGCCTTT TGG Intronic
900242584 1:1624101-1624123 GGGCACAGAGGGTGGCCTCTGGG + Intronic
906191644 1:43903006-43903028 GGGGACAAAAGAAGGCCTCTTGG + Intronic
908122711 1:61001142-61001164 GGGGACATAGGAGGGCGTGGTGG - Intronic
911370792 1:96992600-96992622 GGAGAAACAGGATGACCTTTCGG + Intergenic
912169193 1:107077378-107077400 GGGGACATTGTATGGCCATTTGG - Intergenic
917040772 1:170803767-170803789 GGGGACAAAGGAGAGACTTTAGG + Intergenic
917493370 1:175517505-175517527 AGGGACACAGGTTGGCATTTAGG + Intronic
922214623 1:223510228-223510250 GGGGAGGTATCATGGCCTTTGGG + Intergenic
1063392541 10:5659729-5659751 GGTGACAGGGGATGGCCTTAGGG - Intronic
1063573295 10:7237216-7237238 GGGGACATTGGATGTACATTTGG + Intronic
1063998399 10:11642384-11642406 GAGCACAGAGGATGGCCTTTGGG - Intergenic
1064058456 10:12117458-12117480 GGTTACATAAGATAGCCTTTTGG - Intronic
1064315084 10:14247774-14247796 GAGGACAGAGGCTGGGCTTTGGG - Intronic
1064444124 10:15378711-15378733 GGGGACAGAGGAGGGGCTCTAGG + Intergenic
1065406007 10:25365847-25365869 GGGGACATAAGGAGGCCTTCTGG - Intronic
1070965721 10:80529133-80529155 GGGGACCTGGGAGGGCCTTGTGG + Exonic
1071463561 10:85920484-85920506 GGAGAATTAGGATGGCCTGTTGG - Intronic
1073256881 10:102157979-102158001 AGGAACCTAGGATGCCCTTTGGG + Intronic
1073713482 10:106073442-106073464 GGGAACATAGAATGGCTTTTTGG - Intergenic
1073732510 10:106306607-106306629 AGGGACAGAGGATGTGCTTTGGG + Intergenic
1075158041 10:119996768-119996790 GGGGAGATAGTGTGGTCTTTTGG + Intergenic
1075456875 10:122590556-122590578 GGGGACATAGGGTGGACTGAAGG + Intronic
1076932528 10:133542421-133542443 GGGGACACACAATGGACTTTGGG + Intronic
1077162706 11:1121028-1121050 GGGGACAGAGCATGTCCTTGAGG + Intergenic
1079336163 11:19572528-19572550 GGGGAAACAGCATGGCTTTTGGG + Intronic
1080007083 11:27420991-27421013 GGTCACATATGAAGGCCTTTTGG - Intronic
1080211868 11:29795446-29795468 GGTGACATACGATGGGTTTTTGG - Intergenic
1083349680 11:62018529-62018551 GGGGACAGACTATGTCCTTTTGG + Intergenic
1083868986 11:65475508-65475530 GTGGCCATAGGATGACCTTTGGG - Intergenic
1086330379 11:85748049-85748071 AGGAACATAGGAAGCCCTTTAGG - Intronic
1095208230 12:39462738-39462760 GGGGACCAAGGATGGAATTTAGG + Intergenic
1095888816 12:47216541-47216563 GGGGAAATAGGTTAGCCTCTGGG - Exonic
1101084754 12:101224706-101224728 GGGGACATATGGGGGGCTTTAGG + Intergenic
1101473595 12:105022263-105022285 GGGGCCCAAGCATGGCCTTTGGG + Exonic
1102594364 12:113981283-113981305 GGGTACATGTGATGGCATTTAGG - Intergenic
1103904922 12:124322278-124322300 GGGGACATAGGATGGCTAAGAGG + Intergenic
1106843649 13:33713322-33713344 GGAGACCTAGGAAGGCCTTCAGG + Intergenic
1107472098 13:40700413-40700435 TGGCACATAGGATGGCCCTGAGG - Intergenic
1111987677 13:95081242-95081264 GGGGACTTAGGAAGGCTTTTTGG - Intronic
1114752807 14:25224531-25224553 AGGGACATAGGGTGAACTTTAGG + Intergenic
1114863495 14:26557210-26557232 GGGGACATAGTATCTCCTTAGGG + Intronic
1115319946 14:32069154-32069176 GGGGGCCTAGGATGGGCTGTTGG + Intergenic
1115890498 14:38022417-38022439 TAGGACATGGGTTGGCCTTTGGG + Intronic
1117164720 14:53022062-53022084 GGGGCCATAGGAAATCCTTTTGG - Intergenic
1118002377 14:61535612-61535634 CGTGACCTAGGATGTCCTTTGGG - Intronic
1118152383 14:63203717-63203739 GAGGGTATAGGATGGCTTTTTGG - Intergenic
1119332823 14:73807908-73807930 GGGGACAGAAAAAGGCCTTTAGG + Intergenic
1119528659 14:75343596-75343618 GGGTAGTTAGGATGGCTTTTTGG + Intergenic
1119967311 14:78931250-78931272 GGGGATATAGCATGGGATTTGGG + Intronic
1125533356 15:40428440-40428462 TGTGAAATAGGCTGGCCTTTGGG + Intronic
1126558148 15:50013316-50013338 GGGGACATAGGATGGCCTTTTGG + Intronic
1128146955 15:65337157-65337179 GGGCACAAAGGCTCGCCTTTTGG - Intronic
1129457439 15:75683298-75683320 GGGGACATAAGCTGGCCTTGAGG - Intronic
1129726352 15:77903647-77903669 GGGGACATAAGCTGGCCTTGAGG + Intergenic
1130977250 15:88786599-88786621 GGGCACTTATGATGGCATTTAGG + Intergenic
1132614006 16:831514-831536 GGGGACACAGGCTGGGGTTTTGG - Intergenic
1134671814 16:16061347-16061369 AGGGACAAAGGATGACCTGTTGG - Intronic
1136570335 16:31093083-31093105 GGGGACCTAGGATGTCTTTAAGG + Intronic
1138657162 16:58498172-58498194 GGGGACATGGGAGGGCATTGTGG + Intronic
1139328389 16:66169143-66169165 GGGGAGTTAGGAGGGCCTCTGGG - Intergenic
1139952146 16:70677692-70677714 GGGAAAAGAGGATGGCATTTGGG - Intronic
1141446245 16:84060493-84060515 GGGGACTAAGGATGGCCTCTCGG + Intronic
1142028915 16:87828834-87828856 GGGGACCTTGGATGGCCCTGCGG - Intergenic
1144367678 17:14560288-14560310 GGGGACAGAGAATGGGCTGTGGG + Intergenic
1148126095 17:45237732-45237754 GGGGACATTGGGTGGGCATTTGG + Intronic
1148345148 17:46898140-46898162 GTGGAGAAAGGTTGGCCTTTGGG - Intergenic
1148467011 17:47871177-47871199 AGGGATATAGGATGGGCTTCTGG - Intergenic
1148610340 17:48960488-48960510 CGGGGCATAGGATGGGCTCTGGG + Intronic
1150047400 17:61927240-61927262 GGGGACATAGGATAGTGTTGTGG - Intronic
1151971331 17:77458991-77459013 GGGGACAGAGGAGGGCCTTGGGG + Intronic
1152565151 17:81097107-81097129 GGGGACCTGAGATGGCATTTAGG - Intronic
1152656220 17:81520228-81520250 GGGGACACAGGAAGGCCTAGGGG + Intronic
1156427971 18:37036681-37036703 GTGGAAAGAGGGTGGCCTTTGGG - Intronic
1158373392 18:56834095-56834117 GGGAACTGAGGATGGCCTCTAGG - Intronic
1160286836 18:77550892-77550914 GGAGACAAAGAGTGGCCTTTGGG - Intergenic
1160695697 19:483308-483330 GCTGACATAGAGTGGCCTTTTGG - Intergenic
1161171983 19:2816680-2816702 GGGGGCACAGGATGGCCTTTGGG - Intergenic
1161473878 19:4473937-4473959 GGGGACCTTGGATGCCCCTTTGG + Intronic
1162561198 19:11418976-11418998 GAGGACATGGGGTGGCATTTGGG + Intronic
1164925978 19:32130276-32130298 GGGGGCAAAGGATGCCCTTGGGG - Intergenic
1164933192 19:32191121-32191143 ATGGACAGAGGATGGGCTTTGGG - Intergenic
1165317213 19:35063781-35063803 GGGGTCACAGCATGGGCTTTGGG + Intronic
1165793625 19:38506400-38506422 GGGGACATAGGGTGTCTTTGGGG + Intronic
1165828170 19:38717425-38717447 TGGGACATGGCATGGCCTTTCGG + Intronic
1166361471 19:42254507-42254529 GGGGATACGGGATGGCCTCTAGG - Intronic
1167010357 19:46803100-46803122 GGGGACATAGGCCTGCCCTTGGG + Intergenic
1167340610 19:48913672-48913694 GGGGACATAGGCTTGGCTCTTGG - Intronic
1167728797 19:51237478-51237500 GGGGCCAAAGAATGGCCTTTGGG + Intronic
926142164 2:10374140-10374162 GGGGACTTAGGATGCCCTGAAGG - Intronic
927504650 2:23604948-23604970 GGGGAAATAGGAAGGGCTGTTGG + Intronic
935172493 2:100621273-100621295 GCGGAGACAGGGTGGCCTTTGGG - Intergenic
935522291 2:104122251-104122273 GGGGAGATAGCATGGTATTTGGG - Intergenic
944540138 2:200746742-200746764 GGGGGCATAGGATACTCTTTGGG - Intergenic
1169182628 20:3583287-3583309 GGGGACCCAGGATGAACTTTAGG - Intronic
1169577706 20:6984003-6984025 GGGAAAATAGTATGGCCATTTGG - Intergenic
1170144137 20:13154180-13154202 GGTGACCTAAGATGGCTTTTTGG + Intronic
1170590305 20:17766371-17766393 GGGGACATAGGGAGCCCTTGAGG - Intergenic
1171291911 20:23987228-23987250 TGGGACCTAGGATGTCCTGTGGG - Intronic
1171369973 20:24656084-24656106 GGGGGCACAGGAAGGCCTTGGGG + Intronic
1172891571 20:38269661-38269683 GAGGTCCTAGGATGGGCTTTGGG + Intronic
1173530661 20:43766934-43766956 ATGGCCACAGGATGGCCTTTGGG - Intergenic
1174394163 20:50235759-50235781 GGGGACATGGGATGTTCTTAGGG + Intergenic
1175939796 20:62532711-62532733 GGGGCCATAGGAGGGCCTGGGGG + Intergenic
1175982468 20:62746010-62746032 GGCCACATAGGGTGGCCTTGAGG - Intronic
1176048934 20:63106410-63106432 GGGGACACAGGGTGTCCTCTAGG - Intergenic
1179676457 21:42986087-42986109 GGGGACATATGTGGGCCTTTGGG + Intronic
1182907282 22:33949197-33949219 AGGGACAAAGGGTGGCCTTAGGG + Intergenic
1183106381 22:35618000-35618022 CAGGAAATAGGATGCCCTTTGGG - Intronic
1184565422 22:45288971-45288993 GGGGATGTAGGATGGCCTAGGGG - Intronic
1184915409 22:47565533-47565555 GGGGACAAAGGAGGGCCACTTGG - Intergenic
950604201 3:14064056-14064078 GGGGACAGTGGAAGGCCTTGGGG - Exonic
950669167 3:14514990-14515012 AGGGACATAGGAAGATCTTTGGG - Intronic
954915551 3:54146380-54146402 GGGGACAAAGGCAGGCCTTTTGG + Intronic
959058339 3:101591302-101591324 GGGGACATAGTATGGGGTTGAGG - Intronic
959527471 3:107393809-107393831 AGGGACACAGAGTGGCCTTTAGG - Intergenic
963171251 3:142253041-142253063 GGGGAGCTAGTGTGGCCTTTTGG - Intergenic
963795051 3:149623487-149623509 GGCATCATAGCATGGCCTTTGGG - Intronic
968513100 4:1003823-1003845 GGGGACATGAGATGGACATTCGG + Intronic
968530183 4:1087161-1087183 GGGGAGAGAGGATGGCATTGGGG + Intronic
969523010 4:7689681-7689703 GAGGCCATAGTATGTCCTTTAGG + Intronic
973690072 4:53419005-53419027 TTGGACATATGAAGGCCTTTGGG + Intronic
981940753 4:150279289-150279311 GGGGTAATAGGATTGGCTTTTGG - Intronic
984959408 4:185080682-185080704 GTGGAGATAGCATGGCCTTCGGG + Intergenic
985788184 5:1910882-1910904 GGGGACATGGGAAGCCCTTGTGG + Intergenic
985847046 5:2357690-2357712 AGTGACTTAGGGTGGCCTTTTGG + Intergenic
986446188 5:7823637-7823659 GGGGACATGGGCTGGCCTGCAGG - Intronic
986745800 5:10743642-10743664 GCAGACATAGAATGGACTTTAGG - Intronic
987130445 5:14855149-14855171 GGGGACATAGTATTCTCTTTAGG + Intronic
988455255 5:31381781-31381803 GGGAACATAGGATTGCTTTTGGG - Intergenic
991098046 5:62760126-62760148 AGGGACACAAAATGGCCTTTAGG - Intergenic
992810487 5:80382869-80382891 TGTGAAATAGGAAGGCCTTTTGG - Intergenic
996422702 5:123279554-123279576 GGGGACAGAGAATGGCTGTTGGG - Intergenic
997233811 5:132261166-132261188 GGAGGCAGAGGATGGCCTTGAGG + Intronic
999160117 5:149488546-149488568 GGGGAAATAAGATGGTTTTTAGG - Intergenic
1000025516 5:157355589-157355611 GAGTCCATAGGATGGGCTTTGGG - Intronic
1000229897 5:159306035-159306057 GTGGAGATAGGAAGGCCTTTTGG - Intergenic
1001272519 5:170325736-170325758 GGAGAGAGAGGATGGCCTTCAGG + Intergenic
1001517328 5:172365082-172365104 AGGGAAATGGGAGGGCCTTTGGG + Intronic
1007070858 6:39037280-39037302 AGGGACACCGGATGTCCTTTAGG - Intergenic
1010465199 6:76159781-76159803 GGGGAAATAGAAGAGCCTTTTGG + Intergenic
1010654988 6:78502159-78502181 GGGGAGATAGTATGGTCATTTGG + Intergenic
1012955214 6:105562680-105562702 GGATACATATGATGGCATTTAGG - Intergenic
1014235098 6:118945141-118945163 GGGGAATTAGTGTGGCCTTTTGG - Intergenic
1014528784 6:122534300-122534322 GGGGACATAGATTGGAATTTTGG + Intronic
1015239207 6:131005301-131005323 GGGGACTTTGGATGTGCTTTGGG - Intronic
1020097840 7:5378258-5378280 GGGGACATAGACAGGCCTTTTGG - Intronic
1020280552 7:6647988-6648010 GGGGACATTGGTTGGCCCCTGGG + Intronic
1033954817 7:146833772-146833794 GGGGACATACAAAGGCATTTGGG - Intronic
1034269259 7:149795737-149795759 GGGGACACTGGAAGGCCCTTGGG - Intergenic
1037759325 8:21731428-21731450 AGGGGCATATGAAGGCCTTTTGG - Intronic
1038169434 8:25115697-25115719 GGATACATATGATGGCATTTAGG - Intergenic
1038273608 8:26098642-26098664 GGGGACAGAGGAGAGCCTGTGGG - Intergenic
1039862309 8:41469312-41469334 GGGGCCTTAGGATTGCATTTGGG - Intergenic
1046597889 8:116282972-116282994 AGGGAGATAGAATGGCCTTCAGG - Intergenic
1049226327 8:141452226-141452248 GGGGACAGAGAATGGACTATTGG + Intergenic
1053111724 9:35466592-35466614 GGGGACATAGGGTGGTTTATGGG + Intergenic
1053167756 9:35856557-35856579 TGGGGCAGAGGATGGACTTTGGG + Intergenic
1056279717 9:85029326-85029348 GGATACATGGGATTGCCTTTAGG + Intergenic
1057194777 9:93110866-93110888 GGGGCCAGAGGGTGGCCTCTGGG - Intronic
1061992946 9:134170080-134170102 GGGAACCTAGGAAGGCCTCTGGG - Intergenic
1062500234 9:136848996-136849018 GGGGAGAGAGGGAGGCCTTTGGG + Intronic
1186201438 X:7158891-7158913 GGAGACAAAACATGGCCTTTTGG + Intergenic
1186751721 X:12628506-12628528 TGGGACATAGAATAGCCTCTGGG + Intronic
1187204662 X:17170690-17170712 GAGGAAATAGGATGATCTTTAGG + Intergenic
1198057415 X:133008586-133008608 AGGGACATAGCATTGTCTTTTGG + Intergenic
1198221689 X:134608553-134608575 AGGGGCATAGGATTTCCTTTGGG + Intronic
1198307771 X:135399933-135399955 GGGGACACAGGAGGGGCCTTGGG - Intergenic
1199474312 X:148229060-148229082 AGGGACAGAGGATGGCATTGTGG - Intergenic