ID: 1126558149

View in Genome Browser
Species Human (GRCh38)
Location 15:50013317-50013339
Sequence GGGACATAGGATGGCCTTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 146}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126558145_1126558149 -7 Left 1126558145 15:50013301-50013323 CCATAGCTCTTCTAGGGGGACAT 0: 1
1: 0
2: 1
3: 3
4: 85
Right 1126558149 15:50013317-50013339 GGGACATAGGATGGCCTTTTGGG 0: 1
1: 0
2: 1
3: 9
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126558149 Original CRISPR GGGACATAGGATGGCCTTTT GGG Intronic
901159435 1:7163631-7163653 GGGAGAAAAGATGGCATTTTGGG + Intronic
904855837 1:33497633-33497655 TGCAATTAGGATGGCCTTTTGGG + Intergenic
908470342 1:64437939-64437961 GGGAGGTAGTATGGCCTCTTTGG + Intergenic
908993993 1:70129574-70129596 TGGTCATAGGAGGGACTTTTTGG - Intronic
909396333 1:75174631-75174653 AGGAAATAGGATGGCTTTTGAGG - Intergenic
910456605 1:87404012-87404034 AGGAGAAAGGATGGCATTTTGGG + Intergenic
910768215 1:90803731-90803753 TGGATAAAAGATGGCCTTTTCGG - Intergenic
915498070 1:156295110-156295132 TGGACAAAGGATGGGATTTTGGG + Intronic
920140517 1:203808619-203808641 GTGACATATGTTGGCATTTTTGG + Intronic
920162111 1:204006766-204006788 GGGAAATTGTATGGCCTCTTTGG + Intergenic
920401383 1:205678956-205678978 GGGAAACAGGCTGGCCTATTGGG - Intronic
921660700 1:217797947-217797969 GGGATATAGGATGGGCTGCTAGG - Intronic
921829866 1:219715242-219715264 TGGAGTTAGGATGGCCTGTTAGG - Intronic
1062883418 10:997381-997403 GGGATTCAGGATGGCCTTGTAGG + Intronic
1063573296 10:7237217-7237239 GGGACATTGGATGTACATTTGGG + Intronic
1066786576 10:39010960-39010982 GGGACATTTGAGAGCCTTTTGGG - Intergenic
1070293592 10:75139778-75139800 GGGACAGAGGAAGGATTTTTAGG - Intronic
1070965722 10:80529134-80529156 GGGACCTGGGAGGGCCTTGTGGG + Exonic
1071062712 10:81591626-81591648 GGGAGCTAGTATGGTCTTTTTGG - Intergenic
1071463560 10:85920483-85920505 GAGAATTAGGATGGCCTGTTGGG - Intronic
1072831050 10:98659051-98659073 TGGATATAGGATTTCCTTTTAGG - Intronic
1073249576 10:102113629-102113651 GGGAGAAAGGATGGCCTAGTTGG - Intronic
1073805895 10:107097436-107097458 GTGTCATAGGATGGCAGTTTTGG + Intronic
1075121713 10:119669415-119669437 GGGAAATGTGAGGGCCTTTTTGG + Intronic
1075158042 10:119996769-119996791 GGGAGATAGTGTGGTCTTTTGGG + Intergenic
1079190489 11:18273002-18273024 GGGTAATATGATGGCCTTTATGG + Intergenic
1079990391 11:27240458-27240480 GGGACACAGGAGGCCTTTTTAGG - Intergenic
1080007082 11:27420990-27421012 GTCACATATGAAGGCCTTTTGGG - Intronic
1081653716 11:44842870-44842892 GGGGCATAGGAGAGCCTTCTGGG - Intronic
1085518746 11:77126149-77126171 GGGACACAGGAAAGTCTTTTTGG - Exonic
1086780395 11:90897080-90897102 GTGACAGAGGGTGGCATTTTGGG + Intergenic
1087730549 11:101773727-101773749 GGGACATTGCCTGGCCATTTGGG - Intronic
1089735988 11:120550549-120550571 GGGGCAGAGGATGGCATTCTGGG + Intronic
1089740649 11:120579680-120579702 TGGACATAGTATGGCCTTGGAGG + Intronic
1090647080 11:128774940-128774962 GGTGCAGAGGATGGCATTTTGGG + Intronic
1091567536 12:1660086-1660108 GGGACACAAGATGTTCTTTTAGG + Intergenic
1097331669 12:58338409-58338431 AAGACATAGGCTGGACTTTTGGG - Intergenic
1097365945 12:58712681-58712703 GGAAAAAAGGATGGCTTTTTTGG + Intronic
1104385898 12:128351290-128351312 GGGACATAGAAAGGTCTGTTGGG + Intronic
1107378512 13:39830917-39830939 GGGACATAGGCTCTGCTTTTCGG - Intergenic
1107553068 13:41494736-41494758 GGGAAACAGGATGGGTTTTTTGG + Intergenic
1109324009 13:60845799-60845821 GGGTCATTGGGTGGGCTTTTTGG + Intergenic
1111987676 13:95081241-95081263 GGGACTTAGGAAGGCTTTTTGGG - Intronic
1114752808 14:25224532-25224554 GGGACATAGGGTGAACTTTAGGG + Intergenic
1118231499 14:63954758-63954780 GAGAAATGGGATGGCTTTTTTGG + Exonic
1121772114 14:96555113-96555135 GGGCCACTGGATGGGCTTTTAGG + Intronic
1122125809 14:99578020-99578042 GGGATATAGGATGGGCTGTATGG - Intronic
1122125850 14:99578280-99578302 GGGATATAGGATGGGCTGTATGG - Intronic
1126558149 15:50013317-50013339 GGGACATAGGATGGCCTTTTGGG + Intronic
1127627774 15:60797142-60797164 GGGAAATGGGATTTCCTTTTGGG + Intronic
1128146954 15:65337156-65337178 GGCACAAAGGCTCGCCTTTTGGG - Intronic
1129457438 15:75683297-75683319 GGGACATAAGCTGGCCTTGAGGG - Intronic
1129573367 15:76714590-76714612 GGGACATAAAAGGGGCTTTTGGG + Intronic
1129726353 15:77903648-77903670 GGGACATAAGCTGGCCTTGAGGG + Intergenic
1132614005 16:831513-831535 GGGACACAGGCTGGGGTTTTGGG - Intergenic
1133117815 16:3588195-3588217 GGGATACAGGGTGTCCTTTTGGG - Intronic
1133220644 16:4317791-4317813 GGGACTTGGGATGGTGTTTTGGG + Intronic
1136065494 16:27755509-27755531 GGAACCTGGGATGGCCCTTTGGG + Intronic
1138482186 16:57310887-57310909 AGGACATAGGTTGGTCTTCTAGG - Intergenic
1138657163 16:58498173-58498195 GGGACATGGGAGGGCATTGTGGG + Intronic
1141283871 16:82653423-82653445 GGGACCCAGGAAGGCCTTCTGGG + Intronic
1147268052 17:39246781-39246803 GGGACCCAGGATGCCCTTCTTGG + Intergenic
1148126096 17:45237733-45237755 GGGACATTGGGTGGGCATTTGGG + Intronic
1148410818 17:47465512-47465534 GGGGCCTAGGAAAGCCTTTTTGG - Intergenic
1150670244 17:67189291-67189313 GGGACATAGGATGGGGTTCATGG - Intronic
1151256543 17:72881167-72881189 TGGACATATGATGTCATTTTTGG - Intronic
1151971332 17:77458992-77459014 GGGACAGAGGAGGGCCTTGGGGG + Intronic
1156901330 18:42303507-42303529 GGAACACAGGATAGCATTTTTGG - Intergenic
1159025522 18:63179389-63179411 GGGACTCAGGATGGCCTTTTCGG - Intronic
1160695696 19:483307-483329 CTGACATAGAGTGGCCTTTTGGG - Intergenic
1161934807 19:7365060-7365082 GGTACATGGGATGCCCTTTATGG - Intronic
1164018350 19:21273403-21273425 GGGAGCTAGACTGGCCTTTTGGG - Intronic
1164933191 19:32191120-32191142 TGGACAGAGGATGGGCTTTGGGG - Intergenic
1165117241 19:33536081-33536103 GGGACACAGGAGGGACTTCTGGG + Intergenic
1167340609 19:48913671-48913693 GGGACATAGGCTTGGCTCTTGGG - Intronic
926675798 2:15618993-15619015 GGGGCAAGGGAGGGCCTTTTAGG + Intronic
927165158 2:20312409-20312431 GGGACATTGAATGGTCTGTTTGG + Exonic
927167393 2:20338039-20338061 GGGAAAGAGCATGGGCTTTTTGG - Intronic
927504651 2:23604949-23604971 GGGAAATAGGAAGGGCTGTTGGG + Intronic
933828563 2:86187170-86187192 TGGATATAGGATTTCCTTTTAGG - Intronic
933912729 2:86957573-86957595 GGTATATAGGATGGTGTTTTTGG + Intronic
934010266 2:87812317-87812339 GGTATATAGGATGGTGTTTTTGG - Intronic
935229506 2:101083645-101083667 GAGACATAGGAGGGCCTTTGAGG - Intronic
935773830 2:106453037-106453059 GGTATATAGGATGGTGTTTTTGG - Intronic
935906233 2:107842876-107842898 GGTATATAGGATGGTGTTTTTGG + Intronic
935992700 2:108735399-108735421 GGTATATAGGATGGTGTTTTTGG + Intronic
936902880 2:117503924-117503946 GTGACCTAGGATGGCATTTCAGG + Intergenic
940910932 2:159209481-159209503 GGCACATTGCCTGGCCTTTTGGG + Intronic
941577448 2:167250970-167250992 TGGACATGGGATGGCCCCTTTGG - Exonic
945525689 2:210885553-210885575 GGTAGGTAGGATGGCTTTTTCGG + Intergenic
947088311 2:226480215-226480237 GGGAGATAAGATGGCCCTTCTGG - Intergenic
1168867270 20:1098074-1098096 GGGCAATAGGATGTCCATTTGGG - Intergenic
1171419804 20:25010483-25010505 TGGATATAGGAAGGCCTTTCAGG - Intronic
1174366813 20:50061478-50061500 GGGGGATAGGGTGGCCTTGTGGG - Intergenic
1175417526 20:58811578-58811600 TGGACAGAGGATGGCTTCTTGGG - Intergenic
1175941154 20:62538093-62538115 GGCACATGGGCTGGGCTTTTGGG - Intergenic
1177578856 21:22994007-22994029 GGGAGTAAGGCTGGCCTTTTGGG + Intergenic
1178413407 21:32384271-32384293 GTGACAAAGGATGGGCCTTTGGG - Intronic
1179162622 21:38910530-38910552 GGGCCATGGGATGCCCTGTTTGG + Intergenic
1182510412 22:30815758-30815780 AAGATAGAGGATGGCCTTTTGGG - Intronic
1182907283 22:33949198-33949220 GGGACAAAGGGTGGCCTTAGGGG + Intergenic
1184915408 22:47565532-47565554 GGGACAAAGGAGGGCCACTTGGG - Intergenic
950669166 3:14514989-14515011 GGGACATAGGAAGATCTTTGGGG - Intronic
954915552 3:54146381-54146403 GGGACAAAGGCAGGCCTTTTGGG + Intronic
956837984 3:73111278-73111300 CGGACATAAGGTGGACTTTTCGG + Intergenic
961559122 3:127716814-127716836 GGGTCATAGGACGGCCATGTGGG + Intronic
961703777 3:128767588-128767610 GGGACATAGGAAGTGGTTTTGGG + Intronic
962191998 3:133320130-133320152 GGGAGCTAGTATGGTCTTTTTGG - Intronic
963171250 3:142253040-142253062 GGGAGCTAGTGTGGCCTTTTGGG - Intergenic
965326747 3:167314683-167314705 GTGACACAAGAGGGCCTTTTCGG - Intronic
968920835 4:3521469-3521491 GTGACAGAGGATGGACCTTTGGG - Intronic
970786345 4:19801416-19801438 GGGAAATAGGTTTGACTTTTAGG - Intergenic
971161098 4:24135171-24135193 TGCACATAGGATAGCCATTTTGG - Intergenic
972025754 4:34374662-34374684 GGTACATGTGATGGCATTTTGGG + Intergenic
973690073 4:53419006-53419028 TGGACATATGAAGGCCTTTGGGG + Intronic
974800912 4:66816959-66816981 GGGAAATAGGATGAAATTTTGGG - Intergenic
975300785 4:72788629-72788651 GGGAAATAGGATGACTTTTTTGG - Intergenic
975832251 4:78381786-78381808 GGGACAAAGAATGGCAGTTTAGG + Intronic
980519315 4:133910267-133910289 GGGAGAGAGACTGGCCTTTTGGG - Intergenic
983977458 4:173952767-173952789 GGGAATGAGGATGGCCTTTACGG + Intergenic
991426571 5:66498543-66498565 CCGTCATAGGATGCCCTTTTGGG + Intergenic
991918654 5:71631507-71631529 GGGAAAGAGGATGGCCTTTCAGG + Intronic
992645670 5:78808813-78808835 GGGACACAGGATGGCCCCCTGGG + Intronic
993311065 5:86332463-86332485 GGGGCCTGGGAGGGCCTTTTGGG - Intergenic
993353199 5:86875244-86875266 GGGACATGAGAAAGCCTTTTTGG + Intergenic
999744113 5:154578539-154578561 GGTACATAGGCTGGAGTTTTGGG - Intergenic
1000005151 5:157176317-157176339 AGGACATAGGTTGTCCTCTTGGG - Intronic
1000493864 5:161952346-161952368 TGGACTTAGAATGGCCTTCTGGG - Intergenic
1001129812 5:169054572-169054594 GGGACTTAGGGTTGCGTTTTGGG - Intronic
1003864947 6:10354293-10354315 TGGAAGTAGGATGGCCTGTTAGG + Intergenic
1004865802 6:19853047-19853069 GGGACATAGGCAGCCCTTCTAGG + Intergenic
1005012612 6:21350153-21350175 GGCACATGGGAGGGCTTTTTTGG - Intergenic
1007070857 6:39037279-39037301 GGGACACCGGATGTCCTTTAGGG - Intergenic
1007192980 6:40035789-40035811 GGCACATATGATGGCCCTCTTGG - Intergenic
1009778867 6:68242868-68242890 GGTACATAGGATGCTCTCTTAGG + Intergenic
1009969930 6:70615399-70615421 GGGGCAAAGGATTGCCTTTCAGG - Intergenic
1011164477 6:84430776-84430798 GGGGCATAAGATGGTCTTTTTGG + Intergenic
1014235097 6:118945140-118945162 GGGAATTAGTGTGGCCTTTTGGG - Intergenic
1014695257 6:124612926-124612948 GGGAAATAAGATAGTCTTTTGGG + Intronic
1026127732 7:67594336-67594358 ATGACATAGGATGGCAGTTTGGG - Intergenic
1026151684 7:67793137-67793159 TGGACATAGGAGGGCCTTCCAGG - Intergenic
1032473242 7:132193475-132193497 GGGAGATAGGATGGCATAATGGG + Intronic
1032981984 7:137294550-137294572 GGGGCATGGGATGGCCTGGTAGG - Intronic
1039165106 8:34670185-34670207 GATACATAGGCAGGCCTTTTGGG + Intergenic
1040140273 8:43901546-43901568 GGGACATTTGATAGCCCTTTGGG - Intergenic
1045104991 8:98883820-98883842 GGGACATTGAATGGCCTATTTGG + Exonic
1051198101 9:14586100-14586122 GGGACCTGGCATGGCCTTTTTGG - Intergenic
1056833861 9:89938532-89938554 GAGACATAGATTGGCATTTTCGG + Intergenic
1056918965 9:90769470-90769492 GGGACACAGGTTTGACTTTTAGG + Intergenic
1186650653 X:11556406-11556428 GGCACATAGCCTGGCCTCTTGGG - Intronic
1186751722 X:12628507-12628529 GGGACATAGAATAGCCTCTGGGG + Intronic
1188735962 X:33716337-33716359 TGGACATAGGTAGCCCTTTTTGG + Intergenic
1190917541 X:54821591-54821613 GGGACAGAGGAGGGCCGTCTAGG + Intergenic
1192229840 X:69257251-69257273 GGGACATAGAGTGGCTTCTTTGG - Intergenic
1195069310 X:101263962-101263984 GGGAAATTGGATGGGATTTTTGG - Exonic
1197092826 X:122558905-122558927 AGGACATAGGATGGCCATACTGG + Intergenic
1198057416 X:133008587-133008609 GGGACATAGCATTGTCTTTTGGG + Intergenic